# HG changeset patch # User curtisross # Date 1632414345 0 # Node ID d85af06ab3dbf34581b03a8da130c48b623d6cb5 # Parent 2b42545705fa7b07479b1bb9bc6b9b0e9aa49768 Uploaded XML diff -r 2b42545705fa -r d85af06ab3db fasta_remove_id.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fasta_remove_id.xml Thu Sep 23 16:25:45 2021 +0000 @@ -0,0 +1,57 @@ + + + from fasta file + + macros.xml + cpt-macros.xml + + + +$__tool_directory__/fasta_remove_id.py +@SEQUENCE@ +> $out + + + + + + + + + + + + + + + + + + +**What it does** + +From an input FASTA file, removes the "description" field (all characters after +the first space in the top line until a return) after the FASTA ID (from the > +to the first space). + +This is a permanent removal of the description. It is useful for tools that +behave in unexpected ways if it is present, e.g. Glimmer/GeneMarkS. + +**Example Input/Output** + +For an input FASTA file:: + + >1|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 288 bp + acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct + >2|random sequence|A: 0.25|C: 0.25|G: 0.25|T: 0.25|length: 232 bp + gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat + +The resulting FASTA will contain only IDs without a description:: + + >1|random + acttacgcggagagatgagaccaacgctcgcctaggggcacgcttgtaattgacttatct + >2|random + gttggggacccacctatcagggagtgtagtagtataagactgtccaataccccccaacat + + +