Mercurial > repos > davidmurphy > codonlogo
diff corebio/seq_io/intelligenetics_io.py @ 0:c55bdc2fb9fa
Uploaded
author | davidmurphy |
---|---|
date | Thu, 27 Oct 2011 12:09:09 -0400 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/corebio/seq_io/intelligenetics_io.py Thu Oct 27 12:09:09 2011 -0400 @@ -0,0 +1,203 @@ +#!/usr/bin/env python + +# Copyright (c) 2005 Gavin E. Crooks <gec@threeplusone.com> +# +# This software is distributed under the MIT Open Source License. +# <http://www.opensource.org/licenses/mit-license.html> +# +# Permission is hereby granted, free of charge, to any person obtaining a +# copy of this software and associated documentation files (the "Software"), +# to deal in the Software without restriction, including without limitation +# the rights to use, copy, modify, merge, publish, distribute, sublicense, +# and/or sell copies of the Software, and to permit persons to whom the +# Software is furnished to do so, subject to the following conditions: +# +# The above copyright notice and this permission notice shall be included +# in all copies or substantial portions of the Software. +# +# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +# AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +# OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN +# THE SOFTWARE. +# + +"""Read and write sequence information in IntelliGenetics format. + +A sequence file in IG format can contain several sequences, each consisting of a +number of comment lines that must begin with a semicolon (";"), a line with the +sequence name and the sequence itself terminated with the termination character +'1' for linear or '2' for circular sequences. The termination caracter is +defacto optional. + +--- Example IG File --- + +;H.sapiens fau mRNA, 518 bases +HSFAU +ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtc +actcttaagtcttttgtaattctggctttctctaataaaaaagccactta +gttcagtcaaaaaaaaaa1 +;H.sapiens fau 1 gene, 2016 bases +HSFAU1 +ctaccattttccctctcgattctatatgtacactcgggacaagttctcct +gatcgaaaacggcaaaactaaggccccaagtaggaatgccttagttttcg +gggttaacaatgattaacactgagcctcacacccacgcgatgccctcagc +tcctcgctcagcgctctcaccaacagccgtagcccgcagccccgctggac +accggttctccatccccgcagcgtagcccggaacatggtagctgccatct +ttacctgctacgccagccttctgtgcgcgcaactgtctggtcccgcccc2 + +""" + +from corebio.utils import * +from corebio.seq import * +from corebio.seq_io import * + + +names = ( 'intelligenetics', 'ig', 'stanford', ) +extensions = ('ig') + + +example = """ +;H.sapiens fau mRNA, 518 bases +HSFAU +ttcctctttctcgactccatcttcgcggtagctgggaccgccgttcagtc +actcttaagtcttttgtaattctggctttctctaataaaaaagccactta +gttcagtcaaaaaaaaaa1 +;H.sapiens fau 1 gene, 2016 bases +HSFAU1 +ctaccattttccctctcgattctatatgtacactcgggacaagttctcct +gatcgaaaacggcaaaactaaggccccaagtaggaatgccttagttttcg +gggttaacaatgattaacactgagcctcacacccacgcgatgccctcagc +tcctcgctcagcgctctcaccaacagccgtagcccgcagccccgctggac +accggttctccatccccgcagcgtagcccggaacatggtagctgccatct +ttacctgctacgccagccttctgtgcgcgcaactgtctggtcccgcccc2 +""" + + + + +def read(fin, alphabet=None): + """Read and parse an IG file. + + Args: + fin -- A stream or file to read + alphabet -- The expected alphabet of the data, if given + Returns: + SeqList -- A list of sequences + Raises: + ValueError -- If the file is unparsable + """ + seqs = [ s for s in iterseq(fin, alphabet)] + return SeqList(seqs) + + +def iterseq(fin, alphabet=None): + """ Parse an IG file and generate sequences. + + Args: + fin -- A stream or file to read + alphabet -- The expected alphabet of the data, if given + Yeilds: + Seq -- One alphabetic sequence at a time. + Raises: + ValueError -- If the file is unparsable + """ + alphabet = Alphabet(alphabet) + + seqs = [] + header = [] + start_lineno = -1 + name = None + + def build_seq(seqs,alphabet, name, comments, lineno) : + try : + desc = '\n'.join(comments) + s = Seq( "".join(seqs), alphabet, name=name, description=desc) + except ValueError : + raise ValueError( + "Parsed failed with sequence starting at line %d: " + "Character not in alphabet: %s" % (lineno, alphabet) ) + return s + + for lineno, line in enumerate(fin) : + line = line.strip() + if line == '' : continue + if line.startswith(';') : + if seqs : + # end of sequence + yield build_seq(seqs,alphabet, name, header, start_lineno) + header = [] + seqs = [] + name = None + header.append(line[1:]) + start_lineno = lineno + elif not name : + name = line + elif line[-1] == '1' or line[-1]=='2': + # End of sequence + seqs.append(remove_whitespace(line[0:-1])) + yield build_seq(seqs,alphabet, name, header, start_lineno) + header = [] + seqs = [] + name = None + else: + seqs.append( remove_whitespace(line)) + + if seqs : + yield build_seq(seqs,alphabet, name, header, start_lineno) + return + + + + + +def write(fout, seqs): + """Write an IG file. + + Args: + fout -- A writable stream. + seqs -- A list of Seq's + Raises: + ValueError -- If a sequence is missing a name + """ + for s in seqs : + writeseq(fout, s) + + +def writeseq(fout, seq): + """ Write a single sequence in IG format. + + Args: + afile -- A writable stream. + seq -- A Seq instance + Raises: + ValueError -- If a sequence is missing a name + """ + + desc = seq.description or '' + + # We prepend ';' to each line + for h in desc.splitlines() : + print >> fout, ';' +h + + if not seq.name : + raise ValueError( + "Write failed with missing sequence name: %s"% str(seq) ) + print >>fout, seq.name + L = len(seq) + line_length = 80 + for n in range (1+ int(L/line_length)) : + print >>fout, seq[n * line_length: (n+1) * line_length] + print >>fout + + + + + + + + + + \ No newline at end of file