# HG changeset patch
# User davidvanzessen
# Date 1482158254 18000
# Node ID 768e258f8dbaaab4e660a34814d7bb56155919ac
# Parent efa1f5a17b6e31f135399456efae838edb66a7e5
Uploaded
diff -r efa1f5a17b6e -r 768e258f8dba experimental_design.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/experimental_design.xml Mon Dec 19 09:37:34 2016 -0500
@@ -0,0 +1,57 @@
+
+
+
+ experimental_design/experimental_design.sh
+ #for $i, $f in enumerate($patients)
+ "$f.id"
+ #for $j, $g in enumerate($f.samples)
+ ${g.sample}
+ #end for
+ #end for
+ $out_file
+
+
+
+
+
+
+
+
+
+
+
+
+
+Takes the ARGalaxy proprietary format and merges several samples and/or patients together.
+
+
+
+ 10.1093/bioinformatics/btq281
+
+
+ @ARTICLE{Kim07aninterior-point,
+ author = {Seung-jean Kim and Kwangmoo Koh and Michael Lustig and Stephen Boyd and Dimitry Gorinevsky},
+ title = {An interior-point method for large-scale l1-regularized logistic regression},
+ journal = {Journal of Machine Learning Research},
+ year = {2007},
+ volume = {8},
+ pages = {1519-1555}
+ }
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
diff -r efa1f5a17b6e -r 768e258f8dba igblastn.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/igblastn.xml Mon Dec 19 09:37:34 2016 -0500
@@ -0,0 +1,107 @@
+
+
+
+ igblast/igblast.sh $input $species $locus $output
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ igblastwrp
+
+
+============
+iReport
+============
+
+This tool uses the online igBLAST website hosted by NCBI to blast a FASTA file, it retrieves the result and generates a convenient tabular format for further processing.
+
+**NOTE**
+
+.. class:: warningmark
+
+- Everything goes through the servers of NCBI, so if you have sensitive data that that isn't allowed to leave your local network, this isn't the tool the use.
+
+**USAGE**
+
+.. class:: infomark
+
+- This tool uses a free service provided by NCBI, and although there doesn't seem to be any restrictions on usage, avoid unnecessary usage to lighten the load on NCBI's servers.
+
+
+**INPUT**
+
+This tool accepts FASTA files as input:
+
+::
+
+ >lcl|FLN1FA002RWEZA.1|
+ ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc
+ tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc
+ gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct
+ cag
+ >lcl|FLN1FA001BLION.1|
+ aggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagttccagggcagagtcaccat
+ taccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtg
+ cgagagtgggcagcagctggtctgatgcttttgattatctggggccaagggacaatggtcaccgtctcctcag
+
+**OUTPUT**
+
+The following data is used for ARGalaxy
+
++-----------------+----------------------------------------------+
+| Column name | Column contents |
++-----------------+----------------------------------------------+
+| ID | The Sequence ID provided by the sequencer. |
++-----------------+----------------------------------------------+
+| VDJ Frame | In-frame/Out-frame |
++-----------------+----------------------------------------------+
+| Top V Gene | The best matching V gene found. |
++-----------------+----------------------------------------------+
+| Top D Gene | The best matching D gene found. |
++-----------------+----------------------------------------------+
+| Top J Gene | The best matching J gene found. |
++-----------------+----------------------------------------------+
+| CDR3 Seq | The CDR3 region. |
++-----------------+----------------------------------------------+
+| CDR3 Length | The length of the CDR3 region. |
++-----------------+----------------------------------------------+
+| CDR3 Seq DNA | The CDR3 sequence region. |
++-----------------+----------------------------------------------+
+| CDR3 Length DNA | The length of the CDR3 sequence region. |
++-----------------+----------------------------------------------+
+| Functionality | If sequence is productive/unproductive |
++-----------------+----------------------------------------------+
+
+
+
+
diff -r efa1f5a17b6e -r 768e258f8dba igparse.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/igparse.xml Mon Dec 19 09:37:34 2016 -0500
@@ -0,0 +1,15 @@
+
+
+
+ igblastparser/igparse.pl $input 0 2>/dev/null | grep -v "D:" | cut -f2- > $output
+
+
+
+
+
+
+
+
+ Step 2 of the Immune Repertoire tools, extracts the relevant information needed from the reports generated by igblast (Step 1)
+
+
diff -r efa1f5a17b6e -r 768e258f8dba imgt_loader.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/imgt_loader.xml Mon Dec 19 09:37:34 2016 -0500
@@ -0,0 +1,48 @@
+
+
+
+ imgt_loader/imgt_loader.sh $in_file $out_file "tmp"
+
+
+
+
+
+
+
+
+**INPUT**
+
+This tool accepts an IMGT/HIGHV-QUEST ZIP file
+
+**OUTPUT**
+
+The following data is used for ARGalaxy
+
++-----------------+----------------------------------------------+
+| Column name | Column contents |
++-----------------+----------------------------------------------+
+| ID | The Sequence ID provided by the sequencer. |
++-----------------+----------------------------------------------+
+| VDJ Frame | In-frame/Out-frame |
++-----------------+----------------------------------------------+
+| Top V Gene | The best matching V gene found. |
++-----------------+----------------------------------------------+
+| Top D Gene | The best matching D gene found. |
++-----------------+----------------------------------------------+
+| Top J Gene | The best matching J gene found. |
++-----------------+----------------------------------------------+
+| CDR3 Seq | The CDR3 region. |
++-----------------+----------------------------------------------+
+| CDR3 Length | The length of the CDR3 region. |
++-----------------+----------------------------------------------+
+| CDR3 Seq DNA | The CDR3 sequence region. |
++-----------------+----------------------------------------------+
+| CDR3 Length DNA | The length of the CDR3 sequence region. |
++-----------------+----------------------------------------------+
+| Functionality | If sequence is productive/unproductive |
++-----------------+----------------------------------------------+
+
+
+
+
+
diff -r efa1f5a17b6e -r 768e258f8dba report_clonality_igg.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/report_clonality_igg.xml Mon Dec 19 09:37:34 2016 -0500
@@ -0,0 +1,197 @@
+
+
+
+#if $gene_selection.source == "imgtdb"
+ report_clonality/r_wrapper.sh $in_file $out_file $out_file.files_path "$clonaltype" "${gene_selection.species}" "${gene_selection.locus}" $filterproductive $clonality_method
+#else
+ report_clonality/r_wrapper.sh $in_file $out_file $out_file.files_path "$clonaltype" "custom" "${gene_selection.vgenes};${gene_selection.dgenes};${gene_selection.jgenes}" $filterproductive $clonality_method
+#end if
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ weblogo
+
+
+
+**INPUT**
+
+One or more ARGalaxy proprietary format files combined with the ARGalaxy Experimental Design tool
+
+
+.. class:: warningmark
+
+Custom gene ordering based on position on genome:
+
+**Human**
+
+IGH::
+
+ V:
+ IGHV7-81,IGHV3-74,IGHV3-73,IGHV3-72,IGHV3-71,IGHV2-70,IGHV1-69,IGHV3-66,IGHV3-64,IGHV4-61,IGHV4-59,IGHV1-58,IGHV3-53,IGHV3-52,IGHV5-a,IGHV5-51,IGHV3-49,IGHV3-48,IGHV3-47,IGHV1-46,IGHV1-45,IGHV3-43,IGHV4-39,IGHV3-35,IGHV4-34,IGHV3-33,IGHV4-31,IGHV4-30-4,IGHV4-30-2,IGHV3-30-3,IGHV3-30,IGHV4-28,IGHV2-26,IGHV1-24,IGHV3-23,IGHV3-22,IGHV3-21,IGHV3-20,IGHV3-19,IGHV1-18,IGHV3-15,IGHV3-13,IGHV3-11,IGHV3-9,IGHV1-8,IGHV3-7,IGHV2-5,IGHV7-4-1,IGHV4-4,IGHV4-b,IGHV1-3,IGHV1-2,IGHV6-1
+ D:
+ IGHD1-1,IGHD2-2,IGHD3-3,IGHD6-6,IGHD1-7,IGHD2-8,IGHD3-9,IGHD3-10,IGHD4-11,IGHD5-12,IGHD6-13,IGHD1-14,IGHD2-15,IGHD3-16,IGHD4-17,IGHD5-18,IGHD6-19,IGHD1-20,IGHD2-21,IGHD3-22,IGHD4-23,IGHD5-24,IGHD6-25,IGHD1-26,IGHD7-27
+ J:
+ IGHJ1,IGHJ2,IGHJ3,IGHJ4,IGHJ5,IGHJ6
+
+
+IGK::
+
+ V:
+ IGKV3D-7,IGKV1D-8,IGKV1D-43,IGKV3D-11,IGKV1D-12,IGKV1D-13,IGKV3D-15,IGKV1D-16,IGKV1D-17,IGKV3D-20,IGKV2D-26,IGKV2D-28,IGKV2D-29,IGKV2D-30,IGKV1D-33,IGKV1D-39,IGKV2D-40,IGKV2-40,IGKV1-39,IGKV1-33,IGKV2-30,IGKV2-29,IGKV2-28,IGKV1-27,IGKV2-24,IGKV3-20,IGKV1-17,IGKV1-16,IGKV3-15,IGKV1-13,IGKV1-12,IGKV3-11,IGKV1-9,IGKV1-8,IGKV1-6,IGKV1-5,IGKV5-2,IGKV4-1
+ J:
+ IGKJ1,IGKJ2,IGKJ3,IGKJ4,IGKJ5
+
+
+IGL::
+
+ V:
+ IGLV4-69,IGLV8-61,IGLV4-60,IGLV6-57,IGLV5-52,IGLV1-51,IGLV9-49,IGLV1-47,IGLV7-46,IGLV5-45,IGLV1-44,IGLV7-43,IGLV1-41,IGLV1-40,IGLV5-39,IGLV5-37,IGLV1-36,IGLV3-27,IGLV3-25,IGLV2-23,IGLV3-22,IGLV3-21,IGLV3-19,IGLV2-18,IGLV3-16,IGLV2-14,IGLV3-12,IGLV2-11,IGLV3-10,IGLV3-9,IGLV2-8,IGLV4-3,IGLV3-1
+ J:
+ IGLJ1,IGLJ2,IGLJ3,IGLJ6,IGLJ7
+
+
+TRB::
+
+ V:
+ TRBV2,TRBV3-1,TRBV4-1,TRBV5-1,TRBV6-1,TRBV4-2,TRBV6-2,TRBV4-3,TRBV6-3,TRBV7-2,TRBV6-4,TRBV7-3,TRBV9,TRBV10-1,TRBV11-1,TRBV10-2,TRBV11-2,TRBV6-5,TRBV7-4,TRBV5-4,TRBV6-6,TRBV5-5,TRBV7-6,TRBV5-6,TRBV6-8,TRBV7-7,TRBV6-9,TRBV7-8,TRBV5-8,TRBV7-9,TRBV13,TRBV10-3,TRBV11-3,TRBV12-3,TRBV12-4,TRBV12-5,TRBV14,TRBV15,TRBV16,TRBV18,TRBV19,TRBV20-1,TRBV24-1,TRBV25-1,TRBV27,TRBV28,TRBV29-1,TRBV30
+ D:
+ TRBD1,TRBD2
+ J:
+ TRBJ1-1,TRBJ1-2,TRBJ1-3,TRBJ1-4,TRBJ1-5,TRBJ1-6,TRBJ2-1,TRBJ2-2,TRBJ2-3,TRBJ2-4,TRBJ2-5,TRBJ2-6,TRBJ2-7
+
+
+TRA::
+
+ V:
+ TRAV1-1,TRAV1-2,TRAV2,TRAV3,TRAV4,TRAV5,TRAV6,TRAV7,TRAV8-1,TRAV9-1,TRAV10,TRAV12-1,TRAV8-2,TRAV8-3,TRAV13-1,TRAV12-2,TRAV8-4,TRAV13-2,TRAV14/DV4,TRAV9-2,TRAV12-3,TRAV8-6,TRAV16,TRAV17,TRAV18,TRAV19,TRAV20,TRAV21,TRAV22,TRAV23/DV6,TRAV24,TRAV25,TRAV26-1,TRAV27,TRAV29/DV5,TRAV30,TRAV26-2,TRAV34,TRAV35,TRAV36/DV7,TRAV38-1,TRAV38-2/DV8,TRAV39,TRAV40,TRAV41
+ J:
+ TRAJ57,TRAJ56,TRAJ54,TRAJ53,TRAJ52,TRAJ50,TRAJ49,TRAJ48,TRAJ47,TRAJ46,TRAJ45,TRAJ44,TRAJ43,TRAJ42,TRAJ41,TRAJ40,TRAJ39,TRAJ38,TRAJ37,TRAJ36,TRAJ34,TRAJ33,TRAJ32,TRAJ31,TRAJ30,TRAJ29,TRAJ28,TRAJ27,TRAJ26,TRAJ24,TRAJ23,TRAJ22,TRAJ21,TRAJ20,TRAJ18,TRAJ17,TRAJ16,TRAJ15,TRAJ14,TRAJ13,TRAJ12,TRAJ11,TRAJ10,TRAJ9,TRAJ8,TRAJ7,TRAJ6,TRAJ5,TRAJ4,TRAJ3
+
+
+TRG::
+
+ V:
+ TRGV9,TRGV8,TRGV5,TRGV4,TRGV3,TRGV2
+ J:
+ TRGJ2,TRGJP2,TRGJ1,TRGJP1
+
+
+TRD::
+
+ V:
+ TRDV1,TRDV2,TRDV3
+ D:
+ TRDD1,TRDD2,TRDD3
+ J:
+ TRDJ1,TRDJ4,TRDJ2,TRDJ3
+
+
+**Mouse**
+
+TRB::
+
+ V:
+ TRBV1,TRBV2,TRBV3,TRBV4,TRBV5,TRBV12-1,TRBV13-1,TRBV12-2,TRBV13-2,TRBV13-3,TRBV14,TRBV15,TRBV16,TRBV17,TRBV19,TRBV20,TRBV23,TRBV24,TRBV26,TRBV29,TRBV30,TRBV31
+ D:
+ TRBD1,TRBD2
+ J:
+ TRBJ1-1,TRBJ1-2,TRBJ1-3,TRBJ1-4,TRBJ1-5,TRBJ2-1,TRBJ2-2,TRBJ2-3,TRBJ2-4,TRBJ2-5,TRBJ2-6,TRBJ2-7
+
+
+**OUTPUT**
+
+It generates the following result:
+
+