# HG changeset patch # User davidvanzessen # Date 1481891432 18000 # Node ID d001d0c05dbe8d918de49e3435d82aa3f50e3329 # Parent bcec7bb4e08974217f69e4cde821f037e9ed6b1b Uploaded diff -r bcec7bb4e089 -r d001d0c05dbe experimental_design.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/experimental_design.xml Fri Dec 16 07:30:32 2016 -0500 @@ -0,0 +1,57 @@ + + + + experimental_design/experimental_design.sh + #for $i, $f in enumerate($patients) + "$f.id" + #for $j, $g in enumerate($f.samples) + ${g.sample} + #end for + #end for + $out_file + + + + + + + + + + + + + +Takes the ARGalaxy proprietary format and merges several samples and/or patients together. + + + + 10.1093/bioinformatics/btq281 + + + @ARTICLE{Kim07aninterior-point, + author = {Seung-jean Kim and Kwangmoo Koh and Michael Lustig and Stephen Boyd and Dimitry Gorinevsky}, + title = {An interior-point method for large-scale l1-regularized logistic regression}, + journal = {Journal of Machine Learning Research}, + year = {2007}, + volume = {8}, + pages = {1519-1555} + } + + + + + + + + + + + + + + + + + + diff -r bcec7bb4e089 -r d001d0c05dbe igblast/igblast.sh --- a/igblast/igblast.sh Mon Dec 12 05:22:57 2016 -0500 +++ b/igblast/igblast.sh Fri Dec 16 07:30:32 2016 -0500 @@ -7,6 +7,9 @@ locus=$3 output=$4 +declare -A speciesdict + +speciesdict=(["Bos taurus functional"]="BosTaurus" ["Bos taurus non-functional"]="BosTaurus" ["Camelus dromedarius functional"]="CamelusDromedarius" ["Camelus dromedarius non-functional"]="CamelusDromedarius" ["Canis lupus familiaris functional"]="CanisLupusFamiliaris" ["Canis lupus familiaris non-functional"]="CanisLupusFamiliaris" ["Danio rerio non-functional"]="DanioRerio" ["Danio rerio functional"]="DanioRerio" ["Homo sapiens functional"]="HomoSapiens" ["Homo sapiens non-functional"]="HomoSapiens" ["Macaca mulatta non-functional"]="MacacaMulatta" ["Macaca mulatta functional"]="MacacaMulatta" ["Mus musculus functional"]="MusMusculus" ["Mus musculus non-functional"]="MusMusculus" ["Mus spretus functional"]="MusSpretus" ["Mus spretus non-functional"]="MusSpretus" ["Oncorhynchus mykiss functional"]="OncorhynchusMykiss" ["Oncorhynchus mykiss non-functional"]="OncorhynchusMykiss" ["Oryctolagus cuniculus functional"]="OryctolagusCuniculus" ["Oryctolagus cuniculus non-functional"]="OryctolagusCuniculus" ["Rattus norvegicus functional"]="RattusNorvegicus" ["Rattus norvegicus non-functional"]="RattusNorvegicus" ["Sus scrofa functional"]="SusScrofa" ["Sus scrofa non-functional"]="SusScrofa" ["BosTaurus"]="BosTaurus" ["CamelusDromedarius"]="CamelusDromedarius" ["CanisLupusFamiliaris"]="CanisLupusFamiliaris" ["DanioRerio"]="DanioRerio" ["HomoSapiens"]="HomoSapiens" ["MacacaMulatta"]="MacacaMulatta" ["MusMusculus"]="MusMusculus" ["MusSpretus"]="MusSpretus" ["OncorhynchusMykiss"]="OncorhynchusMykiss" ["OryctolagusCuniculus"]="OryctolagusCuniculus" ["RattusNorvegicus"]="RattusNorvegicus" ["SusScrofa"]="SusScrofa") echo "$input $species $locus $output" diff -r bcec7bb4e089 -r d001d0c05dbe igblastn.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/igblastn.xml Fri Dec 16 07:30:32 2016 -0500 @@ -0,0 +1,107 @@ + + + + igblast/igblast.sh $input $species $locus $output + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + igblastwrp + + +============ +iReport +============ + +This tool uses the online igBLAST website hosted by NCBI to blast a FASTA file, it retrieves the result and generates a convenient tabular format for further processing. + +**NOTE** + +.. class:: warningmark + +- Everything goes through the servers of NCBI, so if you have sensitive data that that isn't allowed to leave your local network, this isn't the tool the use. + +**USAGE** + +.. class:: infomark + +- This tool uses a free service provided by NCBI, and although there doesn't seem to be any restrictions on usage, avoid unnecessary usage to lighten the load on NCBI's servers. + + +**INPUT** + +This tool accepts FASTA files as input: + +:: + + >lcl|FLN1FA002RWEZA.1| + ggctggagtgggtttcatacattagtagtaatagtggtgccatatactacgcagactctgtgaagggccgattcaccatc + tccagaaacaatgccaaggactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgc + gagagcgatcccccggtattactatgatactagtggcccaaacgactactggggccagggaaccctggtcaccgtctcct + cag + >lcl|FLN1FA001BLION.1| + aggcttgagtggatgggatggatcaacgctggcaatggtaacacaaaatattcacagaagttccagggcagagtcaccat + taccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtg + cgagagtgggcagcagctggtctgatgcttttgattatctggggccaagggacaatggtcaccgtctcctcag + +**OUTPUT** + +The following data is used for ARGalaxy + ++-----------------+----------------------------------------------+ +| Column name | Column contents | ++-----------------+----------------------------------------------+ +| ID | The Sequence ID provided by the sequencer. | ++-----------------+----------------------------------------------+ +| VDJ Frame | In-frame/Out-frame | ++-----------------+----------------------------------------------+ +| Top V Gene | The best matching V gene found. | ++-----------------+----------------------------------------------+ +| Top D Gene | The best matching D gene found. | ++-----------------+----------------------------------------------+ +| Top J Gene | The best matching J gene found. | ++-----------------+----------------------------------------------+ +| CDR3 Seq | The CDR3 region. | ++-----------------+----------------------------------------------+ +| CDR3 Length | The length of the CDR3 region. | ++-----------------+----------------------------------------------+ +| CDR3 Seq DNA | The CDR3 sequence region. | ++-----------------+----------------------------------------------+ +| CDR3 Length DNA | The length of the CDR3 sequence region. | ++-----------------+----------------------------------------------+ +| Functionality | If sequence is productive/unproductive | ++-----------------+----------------------------------------------+ + + + + diff -r bcec7bb4e089 -r d001d0c05dbe igparse.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/igparse.xml Fri Dec 16 07:30:32 2016 -0500 @@ -0,0 +1,15 @@ + + + + igblastparser/igparse.pl $input 0 2>/dev/null | grep -v "D:" | cut -f2- > $output + + + + + + + + + Step 2 of the Immune Repertoire tools, extracts the relevant information needed from the reports generated by igblast (Step 1) + + diff -r bcec7bb4e089 -r d001d0c05dbe imgt_loader.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/imgt_loader.xml Fri Dec 16 07:30:32 2016 -0500 @@ -0,0 +1,48 @@ + + + + imgt_loader/imgt_loader.sh $in_file $out_file "tmp" + + + + + + + + +**INPUT** + +This tool accepts an IMGT/HIGHV-QUEST ZIP file + +**OUTPUT** + +The following data is used for ARGalaxy + ++-----------------+----------------------------------------------+ +| Column name | Column contents | ++-----------------+----------------------------------------------+ +| ID | The Sequence ID provided by the sequencer. | ++-----------------+----------------------------------------------+ +| VDJ Frame | In-frame/Out-frame | ++-----------------+----------------------------------------------+ +| Top V Gene | The best matching V gene found. | ++-----------------+----------------------------------------------+ +| Top D Gene | The best matching D gene found. | ++-----------------+----------------------------------------------+ +| Top J Gene | The best matching J gene found. | ++-----------------+----------------------------------------------+ +| CDR3 Seq | The CDR3 region. | ++-----------------+----------------------------------------------+ +| CDR3 Length | The length of the CDR3 region. | ++-----------------+----------------------------------------------+ +| CDR3 Seq DNA | The CDR3 sequence region. | ++-----------------+----------------------------------------------+ +| CDR3 Length DNA | The length of the CDR3 sequence region. | ++-----------------+----------------------------------------------+ +| Functionality | If sequence is productive/unproductive | ++-----------------+----------------------------------------------+ + + + + + diff -r bcec7bb4e089 -r d001d0c05dbe report_clonality/RScript.r --- a/report_clonality/RScript.r Mon Dec 12 05:22:57 2016 -0500 +++ b/report_clonality/RScript.r Fri Dec 16 07:30:32 2016 -0500 @@ -400,6 +400,10 @@ maxVD = data.frame(data.table(VandDCount)[, list(max=max(l)), by=c("Sample")]) VandDCount = merge(VandDCount, maxVD, by.x="Sample", by.y="Sample", all.x=T) VandDCount$relLength = VandDCount$l / VandDCount$max + check = is.nan(VandDCount$relLength) + if(any(check)){ + VandDCount[check,"relLength"] = 0 + } cartegianProductVD = expand.grid(Top.V.Gene = Vchain$v.name, Top.D.Gene = Dchain$v.name) @@ -446,6 +450,11 @@ VandJCount = merge(VandJCount, maxVJ, by.x="Sample", by.y="Sample", all.x=T) VandJCount$relLength = VandJCount$l / VandJCount$max +check = is.nan(VandJCount$relLength) +if(any(check)){ + VandJCount[check,"relLength"] = 0 +} + cartegianProductVJ = expand.grid(Top.V.Gene = Vchain$v.name, Top.J.Gene = Jchain$v.name) completeVJ = merge(VandJCount, cartegianProductVJ, all.y=TRUE) @@ -490,6 +499,11 @@ DandJCount = merge(DandJCount, maxDJ, by.x="Sample", by.y="Sample", all.x=T) DandJCount$relLength = DandJCount$l / DandJCount$max + check = is.nan(DandJCount$relLength) + if(any(check)){ + DandJCount[check,"relLength"] = 0 + } + cartegianProductDJ = expand.grid(Top.D.Gene = Dchain$v.name, Top.J.Gene = Jchain$v.name) completeDJ = merge(DandJCount, cartegianProductDJ, all.y=TRUE) diff -r bcec7bb4e089 -r d001d0c05dbe report_clonality_igg.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/report_clonality_igg.xml Fri Dec 16 07:30:32 2016 -0500 @@ -0,0 +1,197 @@ + + + +#if $gene_selection.source == "imgtdb" + report_clonality/r_wrapper.sh $in_file $out_file $out_file.files_path "$clonaltype" "${gene_selection.species}" "${gene_selection.locus}" $filterproductive $clonality_method +#else + report_clonality/r_wrapper.sh $in_file $out_file $out_file.files_path "$clonaltype" "custom" "${gene_selection.vgenes};${gene_selection.dgenes};${gene_selection.jgenes}" $filterproductive $clonality_method +#end if + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + weblogo + + + +**INPUT** + +One or more ARGalaxy proprietary format files combined with the ARGalaxy Experimental Design tool + + +.. class:: warningmark + +Custom gene ordering based on position on genome: + +**Human** + +IGH:: + + V: + IGHV7-81,IGHV3-74,IGHV3-73,IGHV3-72,IGHV3-71,IGHV2-70,IGHV1-69,IGHV3-66,IGHV3-64,IGHV4-61,IGHV4-59,IGHV1-58,IGHV3-53,IGHV3-52,IGHV5-a,IGHV5-51,IGHV3-49,IGHV3-48,IGHV3-47,IGHV1-46,IGHV1-45,IGHV3-43,IGHV4-39,IGHV3-35,IGHV4-34,IGHV3-33,IGHV4-31,IGHV4-30-4,IGHV4-30-2,IGHV3-30-3,IGHV3-30,IGHV4-28,IGHV2-26,IGHV1-24,IGHV3-23,IGHV3-22,IGHV3-21,IGHV3-20,IGHV3-19,IGHV1-18,IGHV3-15,IGHV3-13,IGHV3-11,IGHV3-9,IGHV1-8,IGHV3-7,IGHV2-5,IGHV7-4-1,IGHV4-4,IGHV4-b,IGHV1-3,IGHV1-2,IGHV6-1 + D: + IGHD1-1,IGHD2-2,IGHD3-3,IGHD6-6,IGHD1-7,IGHD2-8,IGHD3-9,IGHD3-10,IGHD4-11,IGHD5-12,IGHD6-13,IGHD1-14,IGHD2-15,IGHD3-16,IGHD4-17,IGHD5-18,IGHD6-19,IGHD1-20,IGHD2-21,IGHD3-22,IGHD4-23,IGHD5-24,IGHD6-25,IGHD1-26,IGHD7-27 + J: + IGHJ1,IGHJ2,IGHJ3,IGHJ4,IGHJ5,IGHJ6 + + +IGK:: + + V: + IGKV3D-7,IGKV1D-8,IGKV1D-43,IGKV3D-11,IGKV1D-12,IGKV1D-13,IGKV3D-15,IGKV1D-16,IGKV1D-17,IGKV3D-20,IGKV2D-26,IGKV2D-28,IGKV2D-29,IGKV2D-30,IGKV1D-33,IGKV1D-39,IGKV2D-40,IGKV2-40,IGKV1-39,IGKV1-33,IGKV2-30,IGKV2-29,IGKV2-28,IGKV1-27,IGKV2-24,IGKV3-20,IGKV1-17,IGKV1-16,IGKV3-15,IGKV1-13,IGKV1-12,IGKV3-11,IGKV1-9,IGKV1-8,IGKV1-6,IGKV1-5,IGKV5-2,IGKV4-1 + J: + IGKJ1,IGKJ2,IGKJ3,IGKJ4,IGKJ5 + + +IGL:: + + V: + IGLV4-69,IGLV8-61,IGLV4-60,IGLV6-57,IGLV5-52,IGLV1-51,IGLV9-49,IGLV1-47,IGLV7-46,IGLV5-45,IGLV1-44,IGLV7-43,IGLV1-41,IGLV1-40,IGLV5-39,IGLV5-37,IGLV1-36,IGLV3-27,IGLV3-25,IGLV2-23,IGLV3-22,IGLV3-21,IGLV3-19,IGLV2-18,IGLV3-16,IGLV2-14,IGLV3-12,IGLV2-11,IGLV3-10,IGLV3-9,IGLV2-8,IGLV4-3,IGLV3-1 + J: + IGLJ1,IGLJ2,IGLJ3,IGLJ6,IGLJ7 + + +TRB:: + + V: + TRBV2,TRBV3-1,TRBV4-1,TRBV5-1,TRBV6-1,TRBV4-2,TRBV6-2,TRBV4-3,TRBV6-3,TRBV7-2,TRBV6-4,TRBV7-3,TRBV9,TRBV10-1,TRBV11-1,TRBV10-2,TRBV11-2,TRBV6-5,TRBV7-4,TRBV5-4,TRBV6-6,TRBV5-5,TRBV7-6,TRBV5-6,TRBV6-8,TRBV7-7,TRBV6-9,TRBV7-8,TRBV5-8,TRBV7-9,TRBV13,TRBV10-3,TRBV11-3,TRBV12-3,TRBV12-4,TRBV12-5,TRBV14,TRBV15,TRBV16,TRBV18,TRBV19,TRBV20-1,TRBV24-1,TRBV25-1,TRBV27,TRBV28,TRBV29-1,TRBV30 + D: + TRBD1,TRBD2 + J: + TRBJ1-1,TRBJ1-2,TRBJ1-3,TRBJ1-4,TRBJ1-5,TRBJ1-6,TRBJ2-1,TRBJ2-2,TRBJ2-3,TRBJ2-4,TRBJ2-5,TRBJ2-6,TRBJ2-7 + + +TRA:: + + V: + TRAV1-1,TRAV1-2,TRAV2,TRAV3,TRAV4,TRAV5,TRAV6,TRAV7,TRAV8-1,TRAV9-1,TRAV10,TRAV12-1,TRAV8-2,TRAV8-3,TRAV13-1,TRAV12-2,TRAV8-4,TRAV13-2,TRAV14/DV4,TRAV9-2,TRAV12-3,TRAV8-6,TRAV16,TRAV17,TRAV18,TRAV19,TRAV20,TRAV21,TRAV22,TRAV23/DV6,TRAV24,TRAV25,TRAV26-1,TRAV27,TRAV29/DV5,TRAV30,TRAV26-2,TRAV34,TRAV35,TRAV36/DV7,TRAV38-1,TRAV38-2/DV8,TRAV39,TRAV40,TRAV41 + J: + TRAJ57,TRAJ56,TRAJ54,TRAJ53,TRAJ52,TRAJ50,TRAJ49,TRAJ48,TRAJ47,TRAJ46,TRAJ45,TRAJ44,TRAJ43,TRAJ42,TRAJ41,TRAJ40,TRAJ39,TRAJ38,TRAJ37,TRAJ36,TRAJ34,TRAJ33,TRAJ32,TRAJ31,TRAJ30,TRAJ29,TRAJ28,TRAJ27,TRAJ26,TRAJ24,TRAJ23,TRAJ22,TRAJ21,TRAJ20,TRAJ18,TRAJ17,TRAJ16,TRAJ15,TRAJ14,TRAJ13,TRAJ12,TRAJ11,TRAJ10,TRAJ9,TRAJ8,TRAJ7,TRAJ6,TRAJ5,TRAJ4,TRAJ3 + + +TRG:: + + V: + TRGV9,TRGV8,TRGV5,TRGV4,TRGV3,TRGV2 + J: + TRGJ2,TRGJP2,TRGJ1,TRGJP1 + + +TRD:: + + V: + TRDV1,TRDV2,TRDV3 + D: + TRDD1,TRDD2,TRDD3 + J: + TRDJ1,TRDJ4,TRDJ2,TRDJ3 + + +**Mouse** + +TRB:: + + V: + TRBV1,TRBV2,TRBV3,TRBV4,TRBV5,TRBV12-1,TRBV13-1,TRBV12-2,TRBV13-2,TRBV13-3,TRBV14,TRBV15,TRBV16,TRBV17,TRBV19,TRBV20,TRBV23,TRBV24,TRBV26,TRBV29,TRBV30,TRBV31 + D: + TRBD1,TRBD2 + J: + TRBJ1-1,TRBJ1-2,TRBJ1-3,TRBJ1-4,TRBJ1-5,TRBJ2-1,TRBJ2-2,TRBJ2-3,TRBJ2-4,TRBJ2-5,TRBJ2-6,TRBJ2-7 + + +**OUTPUT** + +It generates the following result: + +