changeset 0:c33d93683a09 draft

Uploaded
author davidvanzessen
date Thu, 13 Oct 2016 10:52:24 -0400 (2016-10-13)
parents
children faae21ba5c63
files aa_histogram.r baseline/Baseline_Functions.r baseline/Baseline_Main.r baseline/FiveS_Mutability.RData baseline/FiveS_Substitution.RData baseline/IMGT-reference-seqs-IGHV-2015-11-05.fa baseline/comparePDFs.r baseline/filter.r baseline/script_imgt.py baseline/script_xlsx.py baseline/wrapper.sh change_o/DefineClones.py change_o/MakeDb.py change_o/define_clones.r change_o/define_clones.sh change_o/makedb.sh datatypes_conf.xml gene_identification.py imgt_loader.r merge.r merge_and_filter.r naive_output.r new_imgt.r pattern_plots.r sequence_overview.r shm_csr.py shm_csr.r shm_csr.xml style.tar.gz subclass_definition.db.nhr subclass_definition.db.nin subclass_definition.db.nsq summary_to_fasta.py wrapper.sh
diffstat 34 files changed, 8769 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/aa_histogram.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,63 @@
+library(ggplot2)
+
+args <- commandArgs(trailingOnly = TRUE)
+
+mutations.by.id.file = args[1]
+absent.aa.by.id.file = args[2]
+genes = strsplit(args[3], ",")[[1]]
+genes = c(genes, "")
+outdir = args[4]
+
+
+print("---------------- read input ----------------")
+
+mutations.by.id = read.table(mutations.by.id.file, sep="\t", fill=T, header=T, quote="")
+absent.aa.by.id = read.table(absent.aa.by.id.file, sep="\t", fill=T, header=T, quote="")
+
+for(gene in genes){
+
+        if(gene == ""){
+                mutations.by.id.gene = mutations.by.id[!grepl("unmatched", mutations.by.id$best_match),]
+                absent.aa.by.id.gene = absent.aa.by.id[!grepl("unmatched", absent.aa.by.id$best_match),]
+        } else {
+                mutations.by.id.gene = mutations.by.id[grepl(paste("^", gene, sep=""), mutations.by.id$best_match),]
+                absent.aa.by.id.gene = absent.aa.by.id[grepl(paste("^", gene, sep=""), absent.aa.by.id$best_match),]
+        }
+        print(paste("nrow", gene, nrow(absent.aa.by.id.gene)))
+        if(nrow(mutations.by.id.gene) == 0){
+                next
+        }
+
+        mutations.at.position = colSums(mutations.by.id.gene[,-c(1,2)])
+        aa.at.position = colSums(absent.aa.by.id.gene[,-c(1,2,3,4)])
+
+        dat_freq = mutations.at.position / aa.at.position
+        dat_freq[is.na(dat_freq)] = 0
+        dat_dt = data.frame(i=1:length(dat_freq), freq=dat_freq)
+
+        print("---------------- plot ----------------")
+
+        m = ggplot(dat_dt, aes(x=i, y=freq)) + theme(axis.text.x = element_text(angle = 90, hjust = 1))
+        m = m + geom_bar(stat="identity", colour = "black", fill = "darkgrey", alpha=0.8) + scale_x_continuous(breaks=dat_dt$i, labels=dat_dt$i)
+        m = m + annotate("segment", x = 0.5, y = -0.05, xend=26.5, yend=-0.05, colour="darkgreen", size=1) + annotate("text", x = 13, y = -0.1, label="FR1")
+        m = m + annotate("segment", x = 26.5, y = -0.07, xend=38.5, yend=-0.07, colour="darkblue", size=1) + annotate("text", x = 32.5, y = -0.15, label="CDR1")
+        m = m + annotate("segment", x = 38.5, y = -0.05, xend=55.5, yend=-0.05, colour="darkgreen", size=1) + annotate("text", x = 47, y = -0.1, label="FR2")
+        m = m + annotate("segment", x = 55.5, y = -0.07, xend=65.5, yend=-0.07, colour="darkblue", size=1) + annotate("text", x = 60.5, y = -0.15, label="CDR2")
+        m = m + annotate("segment", x = 65.5, y = -0.05, xend=104.5, yend=-0.05, colour="darkgreen", size=1) + annotate("text", x = 85, y = -0.1, label="FR3")
+        m = m + expand_limits(y=c(-0.1,1)) + xlab("AA position") + ylab("Frequency") + ggtitle(paste(gene, "AA mutation frequency")) 
+        m = m + theme(panel.background = element_rect(fill = "white", colour="black"), panel.grid.major.y = element_line(colour = "black"), panel.grid.major.x = element_blank())
+        m = m + scale_colour_manual(values=c("black"))
+
+        print("---------------- write/print ----------------")
+
+        png(filename=paste(outdir, "/aa_histogram_", gene, ".png", sep=""), width=1280, height=720)
+        print(m)
+        dev.off()
+
+        dat.sums = data.frame(index=1:length(mutations.at.position), mutations.at.position=mutations.at.position, aa.at.position=aa.at.position)
+
+        write.table(dat.sums, paste(outdir, "/aa_histogram_sum_", gene, ".txt", sep=""), sep="\t",quote=F,row.names=F,col.names=T)
+        write.table(mutations.by.id.gene, paste(outdir, "/aa_histogram_count_", gene, ".txt", sep=""), sep="\t",quote=F,row.names=F,col.names=T)
+        write.table(absent.aa.by.id.gene, paste(outdir, "/aa_histogram_absent_", gene, ".txt", sep=""), sep="\t",quote=F,row.names=F,col.names=T)
+        write.table(dat_dt, paste(outdir, "/aa_histogram_", gene, ".txt", sep=""), sep="\t",quote=F,row.names=F,col.names=T)
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/baseline/Baseline_Functions.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,2287 @@
+#########################################################################################
+# License Agreement
+# 
+# THIS WORK IS PROVIDED UNDER THE TERMS OF THIS CREATIVE COMMONS PUBLIC LICENSE 
+# ("CCPL" OR "LICENSE"). THE WORK IS PROTECTED BY COPYRIGHT AND/OR OTHER 
+# APPLICABLE LAW. ANY USE OF THE WORK OTHER THAN AS AUTHORIZED UNDER THIS LICENSE 
+# OR COPYRIGHT LAW IS PROHIBITED.
+# 
+# BY EXERCISING ANY RIGHTS TO THE WORK PROVIDED HERE, YOU ACCEPT AND AGREE TO BE 
+# BOUND BY THE TERMS OF THIS LICENSE. TO THE EXTENT THIS LICENSE MAY BE CONSIDERED 
+# TO BE A CONTRACT, THE LICENSOR GRANTS YOU THE RIGHTS CONTAINED HERE IN 
+# CONSIDERATION OF YOUR ACCEPTANCE OF SUCH TERMS AND CONDITIONS.
+#
+# BASELIne: Bayesian Estimation of Antigen-Driven Selection in Immunoglobulin Sequences
+# Coded by: Mohamed Uduman & Gur Yaari
+# Copyright 2012 Kleinstein Lab
+# Version: 1.3 (01/23/2014)
+#########################################################################################
+
+# Global variables  
+  
+  FILTER_BY_MUTATIONS = 1000
+
+  # Nucleotides
+  NUCLEOTIDES = c("A","C","G","T")
+  
+  # Amino Acids
+  AMINO_ACIDS <- c("F", "F", "L", "L", "S", "S", "S", "S", "Y", "Y", "*", "*", "C", "C", "*", "W", "L", "L", "L", "L", "P", "P", "P", "P", "H", "H", "Q", "Q", "R", "R", "R", "R", "I", "I", "I", "M", "T", "T", "T", "T", "N", "N", "K", "K", "S", "S", "R", "R", "V", "V", "V", "V", "A", "A", "A", "A", "D", "D", "E", "E", "G", "G", "G", "G")
+  names(AMINO_ACIDS) <- c("TTT", "TTC", "TTA", "TTG", "TCT", "TCC", "TCA", "TCG", "TAT", "TAC", "TAA", "TAG", "TGT", "TGC", "TGA", "TGG", "CTT", "CTC", "CTA", "CTG", "CCT", "CCC", "CCA", "CCG", "CAT", "CAC", "CAA", "CAG", "CGT", "CGC", "CGA", "CGG", "ATT", "ATC", "ATA", "ATG", "ACT", "ACC", "ACA", "ACG", "AAT", "AAC", "AAA", "AAG", "AGT", "AGC", "AGA", "AGG", "GTT", "GTC", "GTA", "GTG", "GCT", "GCC", "GCA", "GCG", "GAT", "GAC", "GAA", "GAG", "GGT", "GGC", "GGA", "GGG")
+  names(AMINO_ACIDS) <- names(AMINO_ACIDS)
+
+  #Amino Acid Traits
+  #"*" "A" "C" "D" "E" "F" "G" "H" "I" "K" "L" "M" "N" "P" "Q" "R" "S" "T" "V" "W" "Y"
+  #B = "Hydrophobic/Burried"  N = "Intermediate/Neutral"  S="Hydrophilic/Surface") 
+  TRAITS_AMINO_ACIDS_CHOTHIA98 <- c("*","N","B","S","S","B","N","N","B","S","B","B","S","N","S","S","N","N","B","B","N")
+  names(TRAITS_AMINO_ACIDS_CHOTHIA98) <- sort(unique(AMINO_ACIDS))
+  TRAITS_AMINO_ACIDS <- array(NA,21)
+  
+  # Codon Table
+  CODON_TABLE <- as.data.frame(matrix(NA,ncol=64,nrow=12))
+
+  # Substitution Model: Smith DS et al. 1996
+  substitution_Literature_Mouse <- matrix(c(0, 0.156222928, 0.601501588, 0.242275484, 0.172506739, 0, 0.241239892, 0.586253369, 0.54636291, 0.255795364, 0, 0.197841727, 0.290240811, 0.467680608, 0.24207858, 0),nrow=4,byrow=T,dimnames=list(NUCLEOTIDES,NUCLEOTIDES))
+  substitution_Flu_Human <- matrix(c(0,0.2795596,0.5026927,0.2177477,0.1693210,0,0.3264723,0.5042067,0.4983549,0.3328321,0,0.1688130,0.2021079,0.4696077,0.3282844,0),4,4,byrow=T,dimnames=list(NUCLEOTIDES,NUCLEOTIDES))
+  substitution_Flu25_Human <- matrix(c(0,0.2580641,0.5163685,0.2255674,0.1541125,0,0.3210224,0.5248651,0.5239281,0.3101292,0,0.1659427,0.1997207,0.4579444,0.3423350,0),4,4,byrow=T,dimnames=list(NUCLEOTIDES,NUCLEOTIDES))
+  load("FiveS_Substitution.RData")
+
+  # Mutability Models: Shapiro GS et al. 2002
+  triMutability_Literature_Human <- matrix(c(0.24, 1.2, 0.96, 0.43, 2.14, 2, 1.11, 1.9, 0.85, 1.83, 2.36, 1.31, 0.82, 0.52, 0.89, 1.33, 1.4, 0.82, 1.83, 0.73, 1.83, 1.62, 1.53, 0.57, 0.92, 0.42, 0.42, 1.47, 3.44, 2.58, 1.18, 0.47, 0.39, 1.12, 1.8, 0.68, 0.47, 2.19, 2.35, 2.19, 1.05, 1.84, 1.26, 0.28, 0.98, 2.37, 0.66, 1.58, 0.67, 0.92, 1.76, 0.83, 0.97, 0.56, 0.75, 0.62, 2.26, 0.62, 0.74, 1.11, 1.16, 0.61, 0.88, 0.67, 0.37, 0.07, 1.08, 0.46, 0.31, 0.94, 0.62, 0.57, 0.29, NA, 1.44, 0.46, 0.69, 0.57, 0.24, 0.37, 1.1, 0.99, 1.39, 0.6, 2.26, 1.24, 1.36, 0.52, 0.33, 0.26, 1.25, 0.37, 0.58, 1.03, 1.2, 0.34, 0.49, 0.33, 2.62, 0.16, 0.4, 0.16, 0.35, 0.75, 1.85, 0.94, 1.61, 0.85, 2.09, 1.39, 0.3, 0.52, 1.33, 0.29, 0.51, 0.26, 0.51, 3.83, 2.01, 0.71, 0.58, 0.62, 1.07, 0.28, 1.2, 0.74, 0.25, 0.59, 1.09, 0.91, 1.36, 0.45, 2.89, 1.27, 3.7, 0.69, 0.28, 0.41, 1.17, 0.56, 0.93, 3.41, 1, 1, NA, 5.9, 0.74, 2.51, 2.24, 2.24, 1.95, 3.32, 2.34, 1.3, 2.3, 1, 0.66, 0.73, 0.93, 0.41, 0.65, 0.89, 0.65, 0.32, NA, 0.43, 0.85, 0.43, 0.31, 0.31, 0.23, 0.29, 0.57, 0.71, 0.48, 0.44, 0.76, 0.51, 1.7, 0.85, 0.74, 2.23, 2.08, 1.16, 0.51, 0.51, 1, 0.5, NA, NA, 0.71, 2.14), nrow=64,byrow=T)
+  triMutability_Literature_Mouse <- matrix(c(1.31, 1.35, 1.42, 1.18, 2.02, 2.02, 1.02, 1.61, 1.99, 1.42, 2.01, 1.03, 2.02, 0.97, 0.53, 0.71, 1.19, 0.83, 0.96, 0.96, 0, 1.7, 2.22, 0.59, 1.24, 1.07, 0.51, 1.68, 3.36, 3.36, 1.14, 0.29, 0.33, 0.9, 1.11, 0.63, 1.08, 2.07, 2.27, 1.74, 0.22, 1.19, 2.37, 1.15, 1.15, 1.56, 0.81, 0.34, 0.87, 0.79, 2.13, 0.49, 0.85, 0.97, 0.36, 0.82, 0.66, 0.63, 1.15, 0.94, 0.85, 0.25, 0.93, 1.19, 0.4, 0.2, 0.44, 0.44, 0.88, 1.06, 0.77, 0.39, 0, 0, 0, 0, 0, 0, 0.43, 0.43, 0.86, 0.59, 0.59, 0, 1.18, 0.86, 2.9, 1.66, 0.4, 0.2, 1.54, 0.43, 0.69, 1.71, 0.68, 0.55, 0.91, 0.7, 1.71, 0.09, 0.27, 0.63, 0.2, 0.45, 1.01, 1.63, 0.96, 1.48, 2.18, 1.2, 1.31, 0.66, 2.13, 0.49, 0, 0, 0, 2.97, 2.8, 0.79, 0.4, 0.5, 0.4, 0.11, 1.68, 0.42, 0.13, 0.44, 0.93, 0.71, 1.11, 1.19, 2.71, 1.08, 3.43, 0.4, 0.67, 0.47, 1.02, 0.14, 1.56, 1.98, 0.53, 0.33, 0.63, 2.06, 1.77, 1.46, 3.74, 2.93, 2.1, 2.18, 0.78, 0.73, 2.93, 0.63, 0.57, 0.17, 0.85, 0.52, 0.31, 0.31, 0, 0, 0.51, 0.29, 0.83, 0.54, 0.28, 0.47, 0.9, 0.99, 1.24, 2.47, 0.73, 0.23, 1.13, 0.24, 2.12, 0.24, 0.33, 0.83, 1.41, 0.62, 0.28, 0.35, 0.77, 0.17, 0.72, 0.58, 0.45, 0.41), nrow=64,byrow=T)
+  triMutability_Names <- c("AAA", "AAC", "AAG", "AAT", "ACA", "ACC", "ACG", "ACT", "AGA", "AGC", "AGG", "AGT", "ATA", "ATC", "ATG", "ATT", "CAA", "CAC", "CAG", "CAT", "CCA", "CCC", "CCG", "CCT", "CGA", "CGC", "CGG", "CGT", "CTA", "CTC", "CTG", "CTT", "GAA", "GAC", "GAG", "GAT", "GCA", "GCC", "GCG", "GCT", "GGA", "GGC", "GGG", "GGT", "GTA", "GTC", "GTG", "GTT", "TAA", "TAC", "TAG", "TAT", "TCA", "TCC", "TCG", "TCT", "TGA", "TGC", "TGG", "TGT", "TTA", "TTC", "TTG", "TTT")
+  load("FiveS_Mutability.RData")
+
+# Functions
+  
+  # Translate codon to amino acid
+  translateCodonToAminoAcid<-function(Codon){
+     return(AMINO_ACIDS[Codon])
+  }
+
+  # Translate amino acid to trait change
+  translateAminoAcidToTraitChange<-function(AminoAcid){
+     return(TRAITS_AMINO_ACIDS[AminoAcid])
+  }
+    
+  # Initialize Amino Acid Trait Changes
+  initializeTraitChange <- function(traitChangeModel=1,species=1,traitChangeFileName=NULL){
+    if(!is.null(traitChangeFileName)){
+      tryCatch(
+          traitChange <- read.delim(traitChangeFileName,sep="\t",header=T)
+          , error = function(ex){
+            cat("Error|Error reading trait changes. Please check file name/path and format.\n")
+            q()
+          }
+        )
+    }else{
+      traitChange <- TRAITS_AMINO_ACIDS_CHOTHIA98
+    }
+    TRAITS_AMINO_ACIDS <<- traitChange
+ } 
+  
+  # Read in formatted nucleotide substitution matrix
+  initializeSubstitutionMatrix <- function(substitutionModel,species,subsMatFileName=NULL){
+    if(!is.null(subsMatFileName)){
+      tryCatch(
+          subsMat <- read.delim(subsMatFileName,sep="\t",header=T)
+          , error = function(ex){
+            cat("Error|Error reading substitution matrix. Please check file name/path and format.\n")
+            q()
+          }
+        )
+      if(sum(apply(subsMat,1,sum)==1)!=4) subsMat = t(apply(subsMat,1,function(x)x/sum(x)))
+    }else{
+      if(substitutionModel==1)subsMat <- substitution_Literature_Mouse
+      if(substitutionModel==2)subsMat <- substitution_Flu_Human      
+      if(substitutionModel==3)subsMat <- substitution_Flu25_Human      
+       
+    }
+
+    if(substitutionModel==0){
+      subsMat <- matrix(1,4,4)
+      subsMat[,] = 1/3
+      subsMat[1,1] = 0
+      subsMat[2,2] = 0
+      subsMat[3,3] = 0
+      subsMat[4,4] = 0
+    }
+    
+    
+    NUCLEOTIDESN = c(NUCLEOTIDES,"N", "-")
+    if(substitutionModel==5){
+      subsMat <- FiveS_Substitution
+      return(subsMat)
+    }else{
+      subsMat <- rbind(subsMat,rep(NA,4),rep(NA,4))
+      return( matrix(data.matrix(subsMat),6,4,dimnames=list(NUCLEOTIDESN,NUCLEOTIDES) ) )
+    }
+  }
+
+   
+  # Read in formatted Mutability file
+  initializeMutabilityMatrix <- function(mutabilityModel=1, species=1,mutabilityMatFileName=NULL){
+    if(!is.null(mutabilityMatFileName)){
+        tryCatch(
+            mutabilityMat <- read.delim(mutabilityMatFileName,sep="\t",header=T)
+            , error = function(ex){
+              cat("Error|Error reading mutability matrix. Please check file name/path and format.\n")
+              q()
+            }
+          )
+    }else{
+      mutabilityMat <- triMutability_Literature_Human
+      if(species==2) mutabilityMat <- triMutability_Literature_Mouse
+    }
+
+  if(mutabilityModel==0){ mutabilityMat <- matrix(1,64,3)}
+  
+    if(mutabilityModel==5){
+      mutabilityMat <- FiveS_Mutability
+      return(mutabilityMat)
+    }else{
+      return( matrix( data.matrix(mutabilityMat), 64, 3, dimnames=list(triMutability_Names,1:3)) )
+    }
+  }
+
+  # Read FASTA file formats
+  # Modified from read.fasta from the seqinR package
+  baseline.read.fasta <-
+  function (file = system.file("sequences/sample.fasta", package = "seqinr"), 
+      seqtype = c("DNA", "AA"), as.string = FALSE, forceDNAtolower = TRUE, 
+      set.attributes = TRUE, legacy.mode = TRUE, seqonly = FALSE, 
+      strip.desc = FALSE,  sizeof.longlong = .Machine$sizeof.longlong, 
+      endian = .Platform$endian, apply.mask = TRUE) 
+  {
+      seqtype <- match.arg(seqtype)
+  
+          lines <- readLines(file)
+          
+          if (legacy.mode) {
+              comments <- grep("^;", lines)
+              if (length(comments) > 0) 
+                  lines <- lines[-comments]
+          }
+          
+          
+          ind_groups<-which(substr(lines, 1L, 3L) == ">>>")
+          lines_mod<-lines
+  
+          if(!length(ind_groups)){
+              lines_mod<-c(">>>All sequences combined",lines)            
+          }
+          
+          ind_groups<-which(substr(lines_mod, 1L, 3L) == ">>>")
+  
+          lines <- array("BLA",dim=(length(ind_groups)+length(lines_mod)))
+          id<-sapply(1:length(ind_groups),function(i)ind_groups[i]+i-1)+1
+          lines[id] <- "THIS IS A FAKE SEQUENCE"
+          lines[-id] <- lines_mod
+          rm(lines_mod)
+  
+  		ind <- which(substr(lines, 1L, 1L) == ">")
+          nseq <- length(ind)
+          if (nseq == 0) {
+               stop("no line starting with a > character found")
+          }        
+          start <- ind + 1
+          end <- ind - 1
+  
+          while( any(which(ind%in%end)) ){
+            ind=ind[-which(ind%in%end)]
+            nseq <- length(ind)
+            if (nseq == 0) {
+                stop("no line starting with a > character found")
+            }        
+            start <- ind + 1
+            end <- ind - 1        
+          }
+          
+          end <- c(end[-1], length(lines))
+          sequences <- lapply(seq_len(nseq), function(i) paste(lines[start[i]:end[i]], collapse = ""))
+          if (seqonly) 
+              return(sequences)
+          nomseq <- lapply(seq_len(nseq), function(i) {
+          
+              #firstword <- strsplit(lines[ind[i]], " ")[[1]][1]
+              substr(lines[ind[i]], 2, nchar(lines[ind[i]]))
+          
+          })
+          if (seqtype == "DNA") {
+              if (forceDNAtolower) {
+                  sequences <- as.list(tolower(chartr(".","-",sequences)))
+              }else{
+                  sequences <- as.list(toupper(chartr(".","-",sequences)))
+              }
+          }
+          if (as.string == FALSE) 
+              sequences <- lapply(sequences, s2c)
+          if (set.attributes) {
+              for (i in seq_len(nseq)) {
+                  Annot <- lines[ind[i]]
+                  if (strip.desc) 
+                    Annot <- substr(Annot, 2L, nchar(Annot))
+                  attributes(sequences[[i]]) <- list(name = nomseq[[i]], 
+                    Annot = Annot, class = switch(seqtype, AA = "SeqFastaAA", 
+                      DNA = "SeqFastadna"))
+              }
+          }
+          names(sequences) <- nomseq
+          return(sequences)
+  }
+
+  
+  # Replaces non FASTA characters in input files with N  
+  replaceNonFASTAChars <-function(inSeq="ACGTN-AApA"){
+    gsub('[^ACGTNacgt[:punct:]-[:punct:].]','N',inSeq,perl=TRUE)
+  }    
+  
+  # Find the germlines in the FASTA list
+  germlinesInFile <- function(seqIDs){
+    firstChar = sapply(seqIDs,function(x){substr(x,1,1)})
+    secondChar = sapply(seqIDs,function(x){substr(x,2,2)})
+    return(firstChar==">" & secondChar!=">")
+  }
+  
+  # Find the groups in the FASTA list
+  groupsInFile <- function(seqIDs){
+    sapply(seqIDs,function(x){substr(x,1,2)})==">>"
+  }
+
+  # In the process of finding germlines/groups, expand from the start to end of the group
+  expandTillNext <- function(vecPosToID){    
+    IDs = names(vecPosToID)
+    posOfInterests =  which(vecPosToID)
+  
+    expandedID = rep(NA,length(IDs))
+    expandedIDNames = gsub(">","",IDs[posOfInterests])
+    startIndexes = c(1,posOfInterests[-1])
+    stopIndexes = c(posOfInterests[-1]-1,length(IDs))
+    expandedID  = unlist(sapply(1:length(startIndexes),function(i){
+                                    rep(i,stopIndexes[i]-startIndexes[i]+1)
+                                  }))
+    names(expandedID) = unlist(sapply(1:length(startIndexes),function(i){
+                                    rep(expandedIDNames[i],stopIndexes[i]-startIndexes[i]+1)
+                                  }))  
+    return(expandedID)                                                                                                  
+  }
+    
+  # Process FASTA (list) to return a matrix[input, germline)
+  processInputAdvanced <- function(inputFASTA){
+  
+    seqIDs = names(inputFASTA)
+    numbSeqs = length(seqIDs)
+    posGermlines1 = germlinesInFile(seqIDs)
+    numbGermlines = sum(posGermlines1)
+    posGroups1 = groupsInFile(seqIDs)
+    numbGroups = sum(posGroups1)
+    consDef = NA
+    
+    if(numbGermlines==0){
+      posGermlines = 2
+      numbGermlines = 1  
+    }
+  
+      glPositionsSum = cumsum(posGermlines1)
+      glPositions = table(glPositionsSum)
+      #Find the position of the conservation row
+      consDefPos = as.numeric(names(glPositions[names(glPositions)!=0 & glPositions==1]))+1  
+    if( length(consDefPos)> 0 ){
+      consDefID =  match(consDefPos, glPositionsSum) 
+      #The coservation rows need to be pulled out and stores seperately 
+      consDef =  inputFASTA[consDefID]
+      inputFASTA =  inputFASTA[-consDefID]
+  
+      seqIDs = names(inputFASTA)
+      numbSeqs = length(seqIDs)
+      posGermlines1 = germlinesInFile(seqIDs)
+      numbGermlines = sum(posGermlines1)
+      posGroups1 = groupsInFile(seqIDs)
+      numbGroups = sum(posGroups1)
+      if(numbGermlines==0){
+        posGermlines = 2
+        numbGermlines = 1  
+      }    
+    }
+    
+    posGroups <- expandTillNext(posGroups1)
+    posGermlines <- expandTillNext(posGermlines1)
+    posGermlines[posGroups1] = 0
+    names(posGermlines)[posGroups1] = names(posGroups)[posGroups1]
+    posInput = rep(TRUE,numbSeqs)
+    posInput[posGroups1 | posGermlines1] = FALSE
+    
+    matInput = matrix(NA, nrow=sum(posInput), ncol=2)
+    rownames(matInput) = seqIDs[posInput]
+    colnames(matInput) = c("Input","Germline")
+    
+    vecInputFASTA = unlist(inputFASTA)  
+    matInput[,1] = vecInputFASTA[posInput]
+    matInput[,2] = vecInputFASTA[ which( names(inputFASTA)%in%paste(">",names(posGermlines)[posInput],sep="") )[ posGermlines[posInput]] ]
+    
+    germlines = posGermlines[posInput]
+    groups = posGroups[posInput]
+    
+    return( list("matInput"=matInput, "germlines"=germlines, "groups"=groups, "conservationDefinition"=consDef ))      
+  }
+
+
+  # Replace leading and trailing dashes in the sequence
+  replaceLeadingTrailingDashes <- function(x,readEnd){
+    iiGap = unlist(gregexpr("-",x[1]))
+    ggGap = unlist(gregexpr("-",x[2]))  
+    #posToChange = intersect(iiGap,ggGap)
+    
+    
+    seqIn = replaceLeadingTrailingDashesHelper(x[1])
+    seqGL = replaceLeadingTrailingDashesHelper(x[2])
+    seqTemplate = rep('N',readEnd)
+    seqIn <- c(seqIn,seqTemplate[(length(seqIn)+1):readEnd])
+    seqGL <- c(seqGL,seqTemplate[(length(seqGL)+1):readEnd])
+#    if(posToChange!=-1){
+#      seqIn[posToChange] = "-"
+#      seqGL[posToChange] = "-"
+#    }
+  
+    seqIn = c2s(seqIn[1:readEnd])
+    seqGL = c2s(seqGL[1:readEnd])
+  
+    lenGL = nchar(seqGL)
+    if(lenGL<readEnd){
+      seqGL = paste(seqGL,c2s(rep("N",readEnd-lenGL)),sep="")
+    }
+  
+    lenInput = nchar(seqIn)
+    if(lenInput<readEnd){
+      seqIn = paste(seqIn,c2s(rep("N",readEnd-lenInput)),sep="")
+    }    
+    return( c(seqIn,seqGL) )
+  }  
+
+  replaceLeadingTrailingDashesHelper <- function(x){
+    grepResults = gregexpr("-*",x)
+    grepResultsPos = unlist(grepResults)
+    grepResultsLen =  attr(grepResults[[1]],"match.length")   
+    #print(paste("x = '", x, "'", sep=""))
+    x = s2c(x)
+    if(x[1]=="-"){
+      x[1:grepResultsLen[1]] = "N"      
+    }
+    if(x[length(x)]=="-"){
+      x[(length(x)-grepResultsLen[length(grepResultsLen)]+1):length(x)] = "N"      
+    }
+    return(x)
+  }
+
+
+
+  
+  # Check sequences for indels
+  checkForInDels <- function(matInputP){
+    insPos <- checkInsertion(matInputP)
+    delPos <- checkDeletions(matInputP)
+    return(list("Insertions"=insPos, "Deletions"=delPos))
+  }
+
+  # Check sequences for insertions
+  checkInsertion <- function(matInputP){
+    insertionCheck = apply( matInputP,1, function(x){
+                                          inputGaps <- as.vector( gregexpr("-",x[1])[[1]] )
+                                          glGaps <- as.vector( gregexpr("-",x[2])[[1]] )                                          
+                                          return( is.finite( match(FALSE, glGaps%in%inputGaps ) ) )
+                                        })   
+    return(as.vector(insertionCheck))
+  }
+  # Fix inserstions
+  fixInsertions <- function(matInputP){
+    insPos <- checkInsertion(matInputP)
+    sapply((1:nrow(matInputP))[insPos],function(rowIndex){
+                                                x <- matInputP[rowIndex,]
+                                                inputGaps <- gregexpr("-",x[1])[[1]]
+                                                glGaps <- gregexpr("-",x[2])[[1]]
+                                                posInsertions <- glGaps[!(glGaps%in%inputGaps)]
+                                                inputInsertionToN <- s2c(x[2])
+                                                inputInsertionToN[posInsertions]!="-"
+                                                inputInsertionToN[posInsertions] <- "N"
+                                                inputInsertionToN <- c2s(inputInsertionToN)
+                                                matInput[rowIndex,2] <<- inputInsertionToN 
+                                              })                                                               
+    return(insPos)
+  } 
+    
+  # Check sequences for deletions
+  checkDeletions <-function(matInputP){
+    deletionCheck = apply( matInputP,1, function(x){
+                                          inputGaps <- as.vector( gregexpr("-",x[1])[[1]] )
+                                          glGaps <- as.vector( gregexpr("-",x[2])[[1]] )
+                                          return( is.finite( match(FALSE, inputGaps%in%glGaps ) ) )
+                                      })
+    return(as.vector(deletionCheck))                                      
+  }
+  # Fix sequences with deletions
+  fixDeletions <- function(matInputP){
+    delPos <- checkDeletions(matInputP)    
+    sapply((1:nrow(matInputP))[delPos],function(rowIndex){
+                                                x <- matInputP[rowIndex,]
+                                                inputGaps <- gregexpr("-",x[1])[[1]]
+                                                glGaps <- gregexpr("-",x[2])[[1]]
+                                                posDeletions <- inputGaps[!(inputGaps%in%glGaps)]
+                                                inputDeletionToN <- s2c(x[1])
+                                                inputDeletionToN[posDeletions] <- "N"
+                                                inputDeletionToN <- c2s(inputDeletionToN)
+                                                matInput[rowIndex,1] <<- inputDeletionToN 
+                                              })                                                                   
+    return(delPos)
+  }  
+    
+
+  # Trim DNA sequence to the last codon
+  trimToLastCodon <- function(seqToTrim){
+    seqLen = nchar(seqToTrim)  
+    trimmedSeq = s2c(seqToTrim)
+    poi = seqLen
+    tailLen = 0
+    
+    while(trimmedSeq[poi]=="-" || trimmedSeq[poi]=="."){
+      tailLen = tailLen + 1
+      poi = poi - 1   
+    }
+    
+    trimmedSeq = c2s(trimmedSeq[1:(seqLen-tailLen)])
+    seqLen = nchar(trimmedSeq)
+    # Trim sequence to last codon
+  	if( getCodonPos(seqLen)[3] > seqLen )
+  	  trimmedSeq = substr(seqToTrim,1, ( (getCodonPos(seqLen)[1])-1 ) )
+    
+    return(trimmedSeq)
+  }
+  
+  # Given a nuclotide position, returns the pos of the 3 nucs that made the codon
+  # e.g. nuc 86 is part of nucs 85,86,87
+  getCodonPos <- function(nucPos){
+    codonNum =  (ceiling(nucPos/3))*3
+    return( (codonNum-2):codonNum)
+  }
+  
+  # Given a nuclotide position, returns the codon number
+  # e.g. nuc 86  = codon 29
+  getCodonNumb <- function(nucPos){
+    return( ceiling(nucPos/3) )
+  }
+  
+  # Given a codon, returns all the nuc positions that make the codon
+  getCodonNucs <- function(codonNumb){
+    getCodonPos(codonNumb*3)
+  }  
+
+  computeCodonTable <- function(testID=1){
+                  
+    if(testID<=4){    
+      # Pre-compute every codons
+      intCounter = 1
+      for(pOne in NUCLEOTIDES){
+        for(pTwo in NUCLEOTIDES){
+          for(pThree in NUCLEOTIDES){
+            codon = paste(pOne,pTwo,pThree,sep="")
+            colnames(CODON_TABLE)[intCounter] =  codon
+            intCounter = intCounter + 1
+            CODON_TABLE[,codon] = mutationTypeOptimized(cbind(permutateAllCodon(codon),rep(codon,12)))
+          }  
+        }
+      }
+      chars = c("N","A","C","G","T", "-")
+      for(a in chars){
+        for(b in chars){
+          for(c in chars){
+            if(a=="N" | b=="N" | c=="N"){ 
+              #cat(paste(a,b,c),sep="","\n") 
+              CODON_TABLE[,paste(a,b,c,sep="")] = rep(NA,12)
+            }
+          }  
+        }
+      }
+      
+      chars = c("-","A","C","G","T")
+      for(a in chars){
+        for(b in chars){
+          for(c in chars){
+            if(a=="-" | b=="-" | c=="-"){ 
+              #cat(paste(a,b,c),sep="","\n") 
+              CODON_TABLE[,paste(a,b,c,sep="")] = rep(NA,12)
+            }
+          }  
+        }
+      }
+      CODON_TABLE <<- as.matrix(CODON_TABLE)
+    }
+  }
+  
+  collapseClone <- function(vecInputSeqs,glSeq,readEnd,nonTerminalOnly=0){
+  #print(length(vecInputSeqs))
+    vecInputSeqs = unique(vecInputSeqs) 
+    if(length(vecInputSeqs)==1){
+      return( list( c(vecInputSeqs,glSeq), F) )
+    }else{
+      charInputSeqs <- sapply(vecInputSeqs, function(x){
+                                              s2c(x)[1:readEnd]
+                                            })
+      charGLSeq <- s2c(glSeq)
+      matClone <- sapply(1:readEnd, function(i){
+                                            posNucs = unique(charInputSeqs[i,])
+                                            posGL = charGLSeq[i]
+                                            error = FALSE                                            
+                                            if(posGL=="-" & sum(!(posNucs%in%c("-","N")))==0 ){
+                                              return(c("-",error))
+                                            }
+                                            if(length(posNucs)==1)
+                                              return(c(posNucs[1],error))
+                                            else{
+                                              if("N"%in%posNucs){
+                                                error=TRUE
+                                              }
+                                              if(sum(!posNucs[posNucs!="N"]%in%posGL)==0){
+                                                return( c(posGL,error) )  
+                                              }else{
+                                                #return( c(sample(posNucs[posNucs!="N"],1),error) )  
+                                                if(nonTerminalOnly==0){
+                                                  return( c(sample(charInputSeqs[i,charInputSeqs[i,]!="N" & charInputSeqs[i,]!=posGL],1),error) )  
+                                                }else{
+                                                  posNucs = charInputSeqs[i,charInputSeqs[i,]!="N" & charInputSeqs[i,]!=posGL]
+                                                  posNucsTable = table(posNucs)
+                                                  if(sum(posNucsTable>1)==0){
+                                                    return( c(posGL,error) )
+                                                  }else{
+                                                    return( c(sample( posNucs[posNucs%in%names(posNucsTable)[posNucsTable>1]],1),error) )
+                                                  }
+                                                }
+                                                
+                                              }
+                                            } 
+                                          })
+      
+                                          
+      #print(length(vecInputSeqs))                                        
+      return(list(c(c2s(matClone[1,]),glSeq),"TRUE"%in%matClone[2,]))
+    }
+  }
+
+  # Compute the expected for each sequence-germline pair
+  getExpectedIndividual <- function(matInput){
+  if( any(grep("multicore",search())) ){ 
+    facGL <- factor(matInput[,2])
+    facLevels = levels(facGL)
+    LisGLs_MutabilityU = mclapply(1:length(facLevels),  function(x){
+                                                      computeMutabilities(facLevels[x])
+                                                    })
+    facIndex = match(facGL,facLevels)
+    
+    LisGLs_Mutability = mclapply(1:nrow(matInput),  function(x){
+                                                      cInput = rep(NA,nchar(matInput[x,1]))
+                                                      cInput[s2c(matInput[x,1])!="N"] = 1
+                                                      LisGLs_MutabilityU[[facIndex[x]]] * cInput                                                   
+                                                    })
+                                                    
+    LisGLs_Targeting =  mclapply(1:dim(matInput)[1],  function(x){
+                                                      computeTargeting(matInput[x,2],LisGLs_Mutability[[x]])
+                                                    })
+                                                    
+    LisGLs_MutationTypes  = mclapply(1:length(matInput[,2]),function(x){
+                                                    #print(x)
+                                                    computeMutationTypes(matInput[x,2])
+                                                })
+    
+    LisGLs_Exp = mclapply(1:dim(matInput)[1],  function(x){
+                                                  computeExpected(LisGLs_Targeting[[x]],LisGLs_MutationTypes[[x]])
+                                                })
+    
+    ul_LisGLs_Exp =  unlist(LisGLs_Exp)                                            
+    return(matrix(ul_LisGLs_Exp,ncol=4,nrow=(length(ul_LisGLs_Exp)/4),byrow=T))
+  }else{
+    facGL <- factor(matInput[,2])
+    facLevels = levels(facGL)
+    LisGLs_MutabilityU = lapply(1:length(facLevels),  function(x){
+      computeMutabilities(facLevels[x])
+    })
+    facIndex = match(facGL,facLevels)
+    
+    LisGLs_Mutability = lapply(1:nrow(matInput),  function(x){
+      cInput = rep(NA,nchar(matInput[x,1]))
+      cInput[s2c(matInput[x,1])!="N"] = 1
+      LisGLs_MutabilityU[[facIndex[x]]] * cInput                                                   
+    })
+    
+    LisGLs_Targeting =  lapply(1:dim(matInput)[1],  function(x){
+      computeTargeting(matInput[x,2],LisGLs_Mutability[[x]])
+    })
+    
+    LisGLs_MutationTypes  = lapply(1:length(matInput[,2]),function(x){
+      #print(x)
+      computeMutationTypes(matInput[x,2])
+    })
+    
+    LisGLs_Exp = lapply(1:dim(matInput)[1],  function(x){
+      computeExpected(LisGLs_Targeting[[x]],LisGLs_MutationTypes[[x]])
+    })
+    
+    ul_LisGLs_Exp =  unlist(LisGLs_Exp)                                            
+    return(matrix(ul_LisGLs_Exp,ncol=4,nrow=(length(ul_LisGLs_Exp)/4),byrow=T))
+    
+  }
+  }
+
+  # Compute mutabilities of sequence based on the tri-nucleotide model
+  computeMutabilities <- function(paramSeq){
+    seqLen = nchar(paramSeq)
+    seqMutabilites = rep(NA,seqLen)
+  
+    gaplessSeq = gsub("-", "", paramSeq)
+    gaplessSeqLen = nchar(gaplessSeq)
+    gaplessSeqMutabilites = rep(NA,gaplessSeqLen)
+    
+    if(mutabilityModel!=5){
+      pos<- 3:(gaplessSeqLen)
+      subSeq =  substr(rep(gaplessSeq,gaplessSeqLen-2),(pos-2),(pos+2))    
+      gaplessSeqMutabilites[pos] =      
+        tapply( c(
+                                        getMutability( substr(subSeq,1,3), 3) , 
+                                        getMutability( substr(subSeq,2,4), 2), 
+                                        getMutability( substr(subSeq,3,5), 1) 
+                                        ),rep(1:(gaplessSeqLen-2),3),mean,na.rm=TRUE
+                                      )
+      #Pos 1
+      subSeq =  substr(gaplessSeq,1,3)
+      gaplessSeqMutabilites[1] =  getMutability(subSeq , 1)
+      #Pos 2
+      subSeq =  substr(gaplessSeq,1,4)
+      gaplessSeqMutabilites[2] =  mean( c(
+                                            getMutability( substr(subSeq,1,3), 2) , 
+                                            getMutability( substr(subSeq,2,4), 1) 
+                                          ),na.rm=T
+                                      ) 
+      seqMutabilites[which(s2c(paramSeq)!="-")]<- gaplessSeqMutabilites
+      return(seqMutabilites)
+    }else{
+      
+      pos<- 3:(gaplessSeqLen)
+      subSeq =  substr(rep(gaplessSeq,gaplessSeqLen-2),(pos-2),(pos+2))    
+      gaplessSeqMutabilites[pos] = sapply(subSeq,function(x){ getMutability5(x) }, simplify=T)
+      seqMutabilites[which(s2c(paramSeq)!="-")]<- gaplessSeqMutabilites
+      return(seqMutabilites)
+    }
+
+  }
+
+  # Returns the mutability of a triplet at a given position
+  getMutability <- function(codon, pos=1:3){
+    triplets <- rownames(mutability)
+    mutability[  match(codon,triplets) ,pos]
+  }
+
+  getMutability5 <- function(fivemer){
+    return(mutability[fivemer])
+  }
+
+  # Returns the substitution probabilty
+  getTransistionProb <- function(nuc){
+    substitution[nuc,]
+  }
+
+  getTransistionProb5 <- function(fivemer){    
+    if(any(which(fivemer==colnames(substitution)))){
+      return(substitution[,fivemer])
+    }else{
+      return(array(NA,4))
+    }
+  }
+
+  # Given a nuc, returns the other 3 nucs it can mutate to
+  canMutateTo <- function(nuc){
+    NUCLEOTIDES[- which(NUCLEOTIDES==nuc)]
+  }
+  
+  # Given a nucleotide, returns the probabilty of other nucleotide it can mutate to 
+  canMutateToProb <- function(nuc){
+    substitution[nuc,canMutateTo(nuc)]
+  }
+
+  # Compute targeting, based on precomputed mutatbility & substitution  
+  computeTargeting <- function(param_strSeq,param_vecMutabilities){
+
+    if(substitutionModel!=5){
+      vecSeq = s2c(param_strSeq)
+      matTargeting = sapply( 1:length(vecSeq), function(x) { param_vecMutabilities[x] * getTransistionProb(vecSeq[x]) } )  
+      #matTargeting = apply( rbind(vecSeq,param_vecMutabilities),2, function(x) { as.vector(as.numeric(x[2]) * getTransistionProb(x[1])) } )
+      dimnames( matTargeting ) =  list(NUCLEOTIDES,1:(length(vecSeq))) 
+      return (matTargeting)
+    }else{
+      
+      seqLen = nchar(param_strSeq)
+      seqsubstitution = matrix(NA,ncol=seqLen,nrow=4)
+      paramSeq <- param_strSeq
+      gaplessSeq = gsub("-", "", paramSeq)
+      gaplessSeqLen = nchar(gaplessSeq)
+      gaplessSeqSubstitution  = matrix(NA,ncol=gaplessSeqLen,nrow=4) 
+      
+      pos<- 3:(gaplessSeqLen)
+      subSeq =  substr(rep(gaplessSeq,gaplessSeqLen-2),(pos-2),(pos+2))    
+      gaplessSeqSubstitution[,pos] = sapply(subSeq,function(x){ getTransistionProb5(x) }, simplify=T)
+      seqsubstitution[,which(s2c(paramSeq)!="-")]<- gaplessSeqSubstitution
+      #matTargeting <- param_vecMutabilities  %*% seqsubstitution
+      matTargeting <- sweep(seqsubstitution,2,param_vecMutabilities,`*`)
+      dimnames( matTargeting ) =  list(NUCLEOTIDES,1:(seqLen)) 
+      return (matTargeting)      
+    }
+  }  
+
+  # Compute the mutations types   
+  computeMutationTypes <- function(param_strSeq){
+  #cat(param_strSeq,"\n")
+    #vecSeq = trimToLastCodon(param_strSeq)
+    lenSeq = nchar(param_strSeq)
+    vecCodons = sapply({1:(lenSeq/3)}*3-2,function(x){substr(param_strSeq,x,x+2)})
+    matMutationTypes = matrix( unlist(CODON_TABLE[,vecCodons]) ,ncol=lenSeq,nrow=4, byrow=F)
+    dimnames( matMutationTypes ) =  list(NUCLEOTIDES,1:(ncol(matMutationTypes)))
+    return(matMutationTypes)   
+  }  
+  computeMutationTypesFast <- function(param_strSeq){
+    matMutationTypes = matrix( CODON_TABLE[,param_strSeq] ,ncol=3,nrow=4, byrow=F)
+    #dimnames( matMutationTypes ) =  list(NUCLEOTIDES,1:(length(vecSeq)))
+    return(matMutationTypes)   
+  }  
+  mutationTypeOptimized <- function( matOfCodons ){
+   apply( matOfCodons,1,function(x){ mutationType(x[2],x[1]) } ) 
+  }  
+
+  # Returns a vector of codons 1 mutation away from the given codon
+  permutateAllCodon <- function(codon){
+    cCodon = s2c(codon)
+    matCodons = t(array(cCodon,dim=c(3,12)))
+    matCodons[1:4,1] = NUCLEOTIDES
+    matCodons[5:8,2] = NUCLEOTIDES
+    matCodons[9:12,3] = NUCLEOTIDES
+    apply(matCodons,1,c2s)
+  }
+
+  # Given two codons, tells you if the mutation is R or S (based on your definition)
+  mutationType <- function(codonFrom,codonTo){
+    if(testID==4){
+      if( is.na(codonFrom) | is.na(codonTo) | is.na(translateCodonToAminoAcid(codonFrom)) | is.na(translateCodonToAminoAcid(codonTo)) ){
+        return(NA)
+      }else{
+        mutationType = "S"
+        if( translateAminoAcidToTraitChange(translateCodonToAminoAcid(codonFrom)) != translateAminoAcidToTraitChange(translateCodonToAminoAcid(codonTo)) ){
+          mutationType = "R"                                                              
+        }
+        if(translateCodonToAminoAcid(codonTo)=="*" | translateCodonToAminoAcid(codonFrom)=="*"){
+          mutationType = "Stop"
+        }
+        return(mutationType)
+      }  
+    }else if(testID==5){  
+      if( is.na(codonFrom) | is.na(codonTo) | is.na(translateCodonToAminoAcid(codonFrom)) | is.na(translateCodonToAminoAcid(codonTo)) ){
+        return(NA)
+      }else{
+        if(codonFrom==codonTo){
+          mutationType = "S"
+        }else{
+          codonFrom = s2c(codonFrom)
+          codonTo = s2c(codonTo)  
+          mutationType = "Stop"
+          nucOfI = codonFrom[which(codonTo!=codonFrom)]
+          if(nucOfI=="C"){
+            mutationType = "R"  
+          }else if(nucOfI=="G"){
+            mutationType = "S"
+          }
+        }
+        return(mutationType)
+      }
+    }else{
+      if( is.na(codonFrom) | is.na(codonTo) | is.na(translateCodonToAminoAcid(codonFrom)) | is.na(translateCodonToAminoAcid(codonTo)) ){
+        return(NA)
+      }else{
+        mutationType = "S"
+        if( translateCodonToAminoAcid(codonFrom) != translateCodonToAminoAcid(codonTo) ){
+          mutationType = "R"                                                              
+        }
+        if(translateCodonToAminoAcid(codonTo)=="*" | translateCodonToAminoAcid(codonFrom)=="*"){
+          mutationType = "Stop"
+        }
+        return(mutationType)
+      }  
+    }    
+  }
+
+  
+  #given a mat of targeting & it's corresponding mutationtypes returns 
+  #a vector of Exp_RCDR,Exp_SCDR,Exp_RFWR,Exp_RFWR
+  computeExpected <- function(paramTargeting,paramMutationTypes){
+    # Replacements
+    RPos = which(paramMutationTypes=="R")  
+      #FWR
+      Exp_R_FWR = sum(paramTargeting[ RPos[which(FWR_Nuc_Mat[RPos]==T)] ],na.rm=T)
+      #CDR
+      Exp_R_CDR = sum(paramTargeting[ RPos[which(CDR_Nuc_Mat[RPos]==T)] ],na.rm=T)
+    # Silents
+    SPos = which(paramMutationTypes=="S")  
+      #FWR
+      Exp_S_FWR = sum(paramTargeting[ SPos[which(FWR_Nuc_Mat[SPos]==T)] ],na.rm=T)
+      #CDR
+      Exp_S_CDR = sum(paramTargeting[ SPos[which(CDR_Nuc_Mat[SPos]==T)] ],na.rm=T)
+  
+      return(c(Exp_R_CDR,Exp_S_CDR,Exp_R_FWR,Exp_S_FWR))
+  }
+  
+  # Count the mutations in a sequence
+  # each mutation is treated independently 
+  analyzeMutations2NucUri_website <- function( rev_in_matrix ){
+    paramGL = rev_in_matrix[2,]
+    paramSeq = rev_in_matrix[1,]  
+    
+    #Fill seq with GL seq if gapped
+    #if( any(paramSeq=="-") ){
+    #  gapPos_Seq =  which(paramSeq=="-")
+    #  gapPos_Seq_ToReplace = gapPos_Seq[paramGL[gapPos_Seq] != "-"]
+    #  paramSeq[gapPos_Seq_ToReplace] =  paramGL[gapPos_Seq_ToReplace]
+    #}
+  
+  
+    #if( any(paramSeq=="N") ){
+    #  gapPos_Seq =  which(paramSeq=="N")
+    #  gapPos_Seq_ToReplace = gapPos_Seq[paramGL[gapPos_Seq] != "N"]
+    #  paramSeq[gapPos_Seq_ToReplace] =  paramGL[gapPos_Seq_ToReplace]
+    #}  
+      
+    analyzeMutations2NucUri(  matrix(c( paramGL, paramSeq  ),2,length(paramGL),byrow=T)  )
+    
+  }
+
+  #1 = GL 
+  #2 = Seq
+  analyzeMutations2NucUri <- function( in_matrix=matrix(c(c("A","A","A","C","C","C"),c("A","G","G","C","C","A")),2,6,byrow=T) ){
+    paramGL = in_matrix[2,]
+    paramSeq = in_matrix[1,]
+    paramSeqUri = paramGL
+    #mutations = apply(rbind(paramGL,paramSeq), 2, function(x){!x[1]==x[2]})
+    mutations_val = paramGL != paramSeq   
+    if(any(mutations_val)){
+      mutationPos = {1:length(mutations_val)}[mutations_val]  
+      mutationPos = mutationPos[sapply(mutationPos, function(x){!any(paramSeq[getCodonPos(x)]=="N")})]
+      length_mutations =length(mutationPos)
+      mutationInfo = rep(NA,length_mutations)
+      if(any(mutationPos)){  
+
+        pos<- mutationPos
+        pos_array<-array(sapply(pos,getCodonPos))
+        codonGL =  paramGL[pos_array]
+        
+        codonSeq = sapply(pos,function(x){
+                                  seqP = paramGL[getCodonPos(x)]
+                                  muCodonPos = {x-1}%%3+1 
+                                  seqP[muCodonPos] = paramSeq[x]
+                                  return(seqP)
+                                })      
+        GLcodons =  apply(matrix(codonGL,length_mutations,3,byrow=TRUE),1,c2s)
+        Seqcodons =   apply(codonSeq,2,c2s)
+        mutationInfo = apply(rbind(GLcodons , Seqcodons),2,function(x){mutationType(c2s(x[1]),c2s(x[2]))})     
+        names(mutationInfo) = mutationPos
+    }
+    if(any(!is.na(mutationInfo))){
+      return(mutationInfo[!is.na(mutationInfo)])    
+    }else{
+      return(NA)
+    }
+    
+    
+    }else{
+      return (NA)
+    }
+  }
+  
+  processNucMutations2 <- function(mu){
+    if(!is.na(mu)){
+      #R
+      if(any(mu=="R")){
+        Rs = mu[mu=="R"]
+        nucNumbs = as.numeric(names(Rs))
+        R_CDR = sum(as.integer(CDR_Nuc[nucNumbs]),na.rm=T)
+        R_FWR = sum(as.integer(FWR_Nuc[nucNumbs]),na.rm=T)      
+      }else{
+        R_CDR = 0
+        R_FWR = 0
+      }    
+      
+      #S
+      if(any(mu=="S")){
+        Ss = mu[mu=="S"]
+        nucNumbs = as.numeric(names(Ss))
+        S_CDR = sum(as.integer(CDR_Nuc[nucNumbs]),na.rm=T)
+        S_FWR = sum(as.integer(FWR_Nuc[nucNumbs]),na.rm=T)      
+      }else{
+        S_CDR = 0
+        S_FWR = 0
+      }    
+      
+      
+      retVec = c(R_CDR,S_CDR,R_FWR,S_FWR)
+      retVec[is.na(retVec)]=0
+      return(retVec)
+    }else{
+      return(rep(0,4))
+    }
+  }        
+  
+  
+  ## Z-score Test
+  computeZScore <- function(mat, test="Focused"){
+    matRes <- matrix(NA,ncol=2,nrow=(nrow(mat)))
+    if(test=="Focused"){
+      #Z_Focused_CDR
+      #P_Denom = sum( mat[1,c(5,6,8)], na.rm=T )
+      P = apply(mat[,c(5,6,8)],1,function(x){(x[1]/sum(x))})
+      R_mean = apply(cbind(mat[,c(1,2,4)],P),1,function(x){x[4]*(sum(x[1:3]))})
+      R_sd=sqrt(R_mean*(1-P))
+      matRes[,1] = (mat[,1]-R_mean)/R_sd
+    
+      #Z_Focused_FWR
+      #P_Denom = sum( mat[1,c(7,6,8)], na.rm=T )
+      P = apply(mat[,c(7,6,8)],1,function(x){(x[1]/sum(x))})
+      R_mean = apply(cbind(mat[,c(3,2,4)],P),1,function(x){x[4]*(sum(x[1:3]))})
+      R_sd=sqrt(R_mean*(1-P))
+      matRes[,2] = (mat[,3]-R_mean)/R_sd
+    }
+  
+    if(test=="Local"){
+      #Z_Focused_CDR
+      #P_Denom = sum( mat[1,c(5,6,8)], na.rm=T )
+      P = apply(mat[,c(5,6)],1,function(x){(x[1]/sum(x))})
+      R_mean = apply(cbind(mat[,c(1,2)],P),1,function(x){x[3]*(sum(x[1:2]))})
+      R_sd=sqrt(R_mean*(1-P))
+      matRes[,1] = (mat[,1]-R_mean)/R_sd
+    
+      #Z_Focused_FWR
+      #P_Denom = sum( mat[1,c(7,6,8)], na.rm=T )
+      P = apply(mat[,c(7,8)],1,function(x){(x[1]/sum(x))})
+      R_mean = apply(cbind(mat[,c(3,4)],P),1,function(x){x[3]*(sum(x[1:2]))})
+      R_sd=sqrt(R_mean*(1-P))
+      matRes[,2] = (mat[,3]-R_mean)/R_sd
+    }
+    
+    if(test=="Imbalanced"){
+      #Z_Focused_CDR
+      #P_Denom = sum( mat[1,c(5,6,8)], na.rm=T )
+      P = apply(mat[,5:8],1,function(x){((x[1]+x[2])/sum(x))})
+      R_mean = apply(cbind(mat[,1:4],P),1,function(x){x[5]*(sum(x[1:4]))})
+      R_sd=sqrt(R_mean*(1-P))
+      matRes[,1] = (mat[,1]-R_mean)/R_sd
+    
+      #Z_Focused_FWR
+      #P_Denom = sum( mat[1,c(7,6,8)], na.rm=T )
+      P = apply(mat[,5:8],1,function(x){((x[3]+x[4])/sum(x))})
+      R_mean = apply(cbind(mat[,1:4],P),1,function(x){x[5]*(sum(x[1:4]))})
+      R_sd=sqrt(R_mean*(1-P))
+      matRes[,2] = (mat[,3]-R_mean)/R_sd
+    }    
+      
+    matRes[is.nan(matRes)] = NA
+    return(matRes)
+  }
+
+  # Return a p-value for a z-score
+  z2p <- function(z){
+    p=NA
+    if( !is.nan(z) && !is.na(z)){   
+      if(z>0){
+        p = (1 - pnorm(z,0,1))
+      } else if(z<0){
+        p = (-1 * pnorm(z,0,1))
+      } else{
+        p = 0.5
+      }
+    }else{
+      p = NA
+    }
+    return(p)
+  }    
+  
+  
+  ## Bayesian  Test
+
+  # Fitted parameter for the bayesian framework
+BAYESIAN_FITTED<-c(0.407277142798302, 0.554007336744485, 0.63777155771234, 0.693989162719009, 0.735450014674917, 0.767972534429806, 0.794557287143399, 0.816906816601605, 0.83606796225341, 0.852729446430296, 0.867370424541641, 0.880339760590323, 0.891900995024999, 0.902259181289864, 0.911577919359,0.919990301665853, 0.927606458124537, 0.934518806350661, 0.940805863754375, 0.946534836475715, 0.951763691199255, 0.95654428191308, 0.960920179487397, 0.964930893680829, 0.968611312149038, 0.971992459313836, 0.975102110004818, 0.977964943023096, 0.980603428208439, 0.983037660179428, 0.985285800977406, 0.987364285326685, 0.989288037855441, 0.991070478823525, 0.992723699729969, 0.994259575477392, 0.995687688867975, 0.997017365051493, 0.998257085153047, 0.999414558305388, 1.00049681357804, 1.00151036237481, 1.00246080204981, 1.00335370751909, 1.0041939329768, 1.0049859393417, 1.00573382091263, 1.00644127217376, 1.00711179729107, 1.00774845526417, 1.00835412715854, 1.00893143010366, 1.00948275846309, 1.01001030293661, 1.01051606798079, 1.01100188771288, 1.01146944044216, 1.01192026195449, 1.01235575766094, 1.01277721370986)
+  CONST_i <- sort(c(((2^(seq(-39,0,length.out=201)))/2)[1:200],(c(0:11,13:99)+0.5)/100,1-(2^(seq(-39,0,length.out=201)))/2))
+  
+  # Given x, M & p, returns a pdf 
+  calculate_bayes <- function ( x=3, N=10, p=0.33,
+                                i=CONST_i,
+                                max_sigma=20,length_sigma=4001
+                              ){
+    if(!0%in%N){
+      G <- max(length(x),length(N),length(p))
+      x=array(x,dim=G)
+      N=array(N,dim=G)
+      p=array(p,dim=G)
+      sigma_s<-seq(-max_sigma,max_sigma,length.out=length_sigma)
+      sigma_1<-log({i/{1-i}}/{p/{1-p}})
+      index<-min(N,60)
+      y<-dbeta(i,x+BAYESIAN_FITTED[index],N+BAYESIAN_FITTED[index]-x)*(1-p)*p*exp(sigma_1)/({1-p}^2+2*p*{1-p}*exp(sigma_1)+{p^2}*exp(2*sigma_1))
+      if(!sum(is.na(y))){
+        tmp<-approx(sigma_1,y,sigma_s)$y
+        tmp/sum(tmp)/{2*max_sigma/{length_sigma-1}}
+      }else{
+        return(NA)
+      }
+    }else{
+      return(NA)
+    }
+  }  
+  # Given a mat of observed & expected, return a list of CDR & FWR pdf for selection
+  computeBayesianScore <- function(mat, test="Focused", max_sigma=20,length_sigma=4001){
+    flagOneSeq = F
+    if(nrow(mat)==1){
+      mat=rbind(mat,mat)
+      flagOneSeq = T
+    }
+    if(test=="Focused"){
+      #CDR
+      P = c(apply(mat[,c(5,6,8)],1,function(x){(x[1]/sum(x))}),0.5)
+      N = c(apply(mat[,c(1,2,4)],1,function(x){(sum(x))}),0)
+      X = c(mat[,1],0)
+      bayesCDR = apply(cbind(X,N,P),1,function(x){calculate_bayes(x=x[1],N=x[2],p=x[3],max_sigma=max_sigma,length_sigma=length_sigma)})    
+      bayesCDR = bayesCDR[-length(bayesCDR)]
+  
+      #FWR
+      P = c(apply(mat[,c(7,6,8)],1,function(x){(x[1]/sum(x))}),0.5)
+      N = c(apply(mat[,c(3,2,4)],1,function(x){(sum(x))}),0)
+      X = c(mat[,3],0)
+      bayesFWR = apply(cbind(X,N,P),1,function(x){calculate_bayes(x=x[1],N=x[2],p=x[3],max_sigma=max_sigma,length_sigma=length_sigma)})    
+      bayesFWR = bayesFWR[-length(bayesFWR)]     
+    }
+    
+    if(test=="Local"){
+      #CDR
+      P = c(apply(mat[,c(5,6)],1,function(x){(x[1]/sum(x))}),0.5)
+      N = c(apply(mat[,c(1,2)],1,function(x){(sum(x))}),0)
+      X = c(mat[,1],0)
+      bayesCDR = apply(cbind(X,N,P),1,function(x){calculate_bayes(x=x[1],N=x[2],p=x[3],max_sigma=max_sigma,length_sigma=length_sigma)})    
+      bayesCDR = bayesCDR[-length(bayesCDR)]
+  
+      #FWR
+      P = c(apply(mat[,c(7,8)],1,function(x){(x[1]/sum(x))}),0.5)
+      N = c(apply(mat[,c(3,4)],1,function(x){(sum(x))}),0)
+      X = c(mat[,3],0)
+      bayesFWR = apply(cbind(X,N,P),1,function(x){calculate_bayes(x=x[1],N=x[2],p=x[3],max_sigma=max_sigma,length_sigma=length_sigma)})    
+      bayesFWR = bayesFWR[-length(bayesFWR)]     
+    } 
+     
+    if(test=="Imbalanced"){
+      #CDR
+      P = c(apply(mat[,c(5:8)],1,function(x){((x[1]+x[2])/sum(x))}),0.5)
+      N = c(apply(mat[,c(1:4)],1,function(x){(sum(x))}),0)
+      X = c(apply(mat[,c(1:2)],1,function(x){(sum(x))}),0)
+      bayesCDR = apply(cbind(X,N,P),1,function(x){calculate_bayes(x=x[1],N=x[2],p=x[3],max_sigma=max_sigma,length_sigma=length_sigma)})    
+      bayesCDR = bayesCDR[-length(bayesCDR)]
+  
+      #FWR
+      P = c(apply(mat[,c(5:8)],1,function(x){((x[3]+x[4])/sum(x))}),0.5)
+      N = c(apply(mat[,c(1:4)],1,function(x){(sum(x))}),0)
+      X = c(apply(mat[,c(3:4)],1,function(x){(sum(x))}),0)
+      bayesFWR = apply(cbind(X,N,P),1,function(x){calculate_bayes(x=x[1],N=x[2],p=x[3],max_sigma=max_sigma,length_sigma=length_sigma)})    
+      bayesFWR = bayesFWR[-length(bayesFWR)]     
+    }
+
+    if(test=="ImbalancedSilent"){
+      #CDR
+      P = c(apply(mat[,c(6,8)],1,function(x){((x[1])/sum(x))}),0.5)
+      N = c(apply(mat[,c(2,4)],1,function(x){(sum(x))}),0)
+      X = c(apply(mat[,c(2,4)],1,function(x){(x[1])}),0)
+      bayesCDR = apply(cbind(X,N,P),1,function(x){calculate_bayes(x=x[1],N=x[2],p=x[3],max_sigma=max_sigma,length_sigma=length_sigma)})    
+      bayesCDR = bayesCDR[-length(bayesCDR)]
+  
+      #FWR
+      P = c(apply(mat[,c(6,8)],1,function(x){((x[2])/sum(x))}),0.5)
+      N = c(apply(mat[,c(2,4)],1,function(x){(sum(x))}),0)
+      X = c(apply(mat[,c(2,4)],1,function(x){(x[2])}),0)
+      bayesFWR = apply(cbind(X,N,P),1,function(x){calculate_bayes(x=x[1],N=x[2],p=x[3],max_sigma=max_sigma,length_sigma=length_sigma)})    
+      bayesFWR = bayesFWR[-length(bayesFWR)]     
+    }
+        
+    if(flagOneSeq==T){
+      bayesCDR = bayesCDR[1]  
+      bayesFWR = bayesFWR[1]
+    }
+    return( list("CDR"=bayesCDR, "FWR"=bayesFWR) )
+  }
+  
+  ##Covolution
+  break2chunks<-function(G=1000){
+  base<-2^round(log(sqrt(G),2),0)
+  return(c(rep(base,floor(G/base)-1),base+G-(floor(G/base)*base)))
+  }  
+  
+  PowersOfTwo <- function(G=100){
+    exponents <- array()
+    i = 0
+    while(G > 0){
+      i=i+1
+      exponents[i] <- floor( log2(G) )
+      G <- G-2^exponents[i]
+    }
+    return(exponents)
+  }
+  
+  convolutionPowersOfTwo <- function( cons, length_sigma=4001 ){
+    G = ncol(cons)
+    if(G>1){
+      for(gen in log(G,2):1){
+        ll<-seq(from=2,to=2^gen,by=2)
+        sapply(ll,function(l){cons[,l/2]<<-weighted_conv(cons[,l],cons[,l-1],length_sigma=length_sigma)})
+      }
+    }
+    return( cons[,1] )
+  }
+  
+  convolutionPowersOfTwoByTwos <- function( cons, length_sigma=4001,G=1 ){
+    if(length(ncol(cons))) G<-ncol(cons)
+    groups <- PowersOfTwo(G)
+    matG <- matrix(NA, ncol=length(groups), nrow=length(cons)/G )
+    startIndex = 1
+    for( i in 1:length(groups) ){
+      stopIndex <- 2^groups[i] + startIndex - 1
+      if(stopIndex!=startIndex){
+        matG[,i] <- convolutionPowersOfTwo( cons[,startIndex:stopIndex], length_sigma=length_sigma )
+        startIndex = stopIndex + 1
+      }
+      else {
+        if(G>1) matG[,i] <- cons[,startIndex:stopIndex]
+        else matG[,i] <- cons
+        #startIndex = stopIndex + 1
+      }
+    }
+    return( list( matG, groups ) )
+  }
+  
+  weighted_conv<-function(x,y,w=1,m=100,length_sigma=4001){
+    lx<-length(x)
+    ly<-length(y)
+    if({lx<m}| {{lx*w}<m}| {{ly}<m}| {{ly*w}<m}){
+      if(w<1){
+        y1<-approx(1:ly,y,seq(1,ly,length.out=m))$y
+        x1<-approx(1:lx,x,seq(1,lx,length.out=m/w))$y
+        lx<-length(x1)
+        ly<-length(y1)
+      }
+      else {
+        y1<-approx(1:ly,y,seq(1,ly,length.out=m*w))$y
+        x1<-approx(1:lx,x,seq(1,lx,length.out=m))$y
+        lx<-length(x1)
+        ly<-length(y1)
+      }
+    }
+    else{
+      x1<-x
+      y1<-approx(1:ly,y,seq(1,ly,length.out=floor(lx*w)))$y
+      ly<-length(y1)
+    }
+    tmp<-approx(x=1:(lx+ly-1),y=convolve(x1,rev(y1),type="open"),xout=seq(1,lx+ly-1,length.out=length_sigma))$y
+    tmp[tmp<=0] = 0
+    return(tmp/sum(tmp))
+  }
+  
+  calculate_bayesGHelper <- function( listMatG,length_sigma=4001 ){
+    matG <- listMatG[[1]]
+    groups <- listMatG[[2]]
+    i = 1
+    resConv <- matG[,i]
+    denom <- 2^groups[i]
+    if(length(groups)>1){
+      while( i<length(groups) ){
+        i = i + 1
+        resConv <- weighted_conv(resConv, matG[,i], w= {{2^groups[i]}/denom} ,length_sigma=length_sigma)
+        #cat({{2^groups[i]}/denom},"\n")
+        denom <- denom + 2^groups[i]
+      }
+    }
+    return(resConv)
+  }
+  
+  # Given a list of PDFs, returns a convoluted PDF    
+  groupPosteriors <- function( listPosteriors, max_sigma=20, length_sigma=4001 ,Threshold=2 ){  
+    listPosteriors = listPosteriors[ !is.na(listPosteriors) ]
+    Length_Postrior<-length(listPosteriors)
+    if(Length_Postrior>1 & Length_Postrior<=Threshold){
+      cons = matrix(unlist(listPosteriors),length(listPosteriors[[1]]),length(listPosteriors))
+      listMatG <- convolutionPowersOfTwoByTwos(cons,length_sigma=length_sigma)
+      y<-calculate_bayesGHelper(listMatG,length_sigma=length_sigma)
+      return( y/sum(y)/(2*max_sigma/(length_sigma-1)) )
+    }else if(Length_Postrior==1) return(listPosteriors[[1]])
+    else  if(Length_Postrior==0) return(NA)
+    else {
+      cons = matrix(unlist(listPosteriors),length(listPosteriors[[1]]),length(listPosteriors))
+      y = fastConv(cons,max_sigma=max_sigma, length_sigma=length_sigma )
+      return( y/sum(y)/(2*max_sigma/(length_sigma-1)) )
+    }
+  }
+
+  fastConv<-function(cons, max_sigma=20, length_sigma=4001){
+    chunks<-break2chunks(G=ncol(cons))
+    if(ncol(cons)==3) chunks<-2:1
+    index_chunks_end <- cumsum(chunks)
+    index_chunks_start <- c(1,index_chunks_end[-length(index_chunks_end)]+1)
+    index_chunks <- cbind(index_chunks_start,index_chunks_end)
+    
+    case <- sum(chunks!=chunks[1])
+    if(case==1) End <- max(1,((length(index_chunks)/2)-1))
+    else End <- max(1,((length(index_chunks)/2)))
+    
+    firsts <- sapply(1:End,function(i){
+          	    indexes<-index_chunks[i,1]:index_chunks[i,2]
+          	    convolutionPowersOfTwoByTwos(cons[ ,indexes])[[1]]
+          	  })
+    if(case==0){
+    	result<-calculate_bayesGHelper( convolutionPowersOfTwoByTwos(firsts) )
+    }else if(case==1){
+      last<-list(calculate_bayesGHelper(
+      convolutionPowersOfTwoByTwos( cons[ ,index_chunks[length(index_chunks)/2,1]:index_chunks[length(index_chunks)/2,2]] )
+                                      ),0)
+      result_first<-calculate_bayesGHelper(convolutionPowersOfTwoByTwos(firsts))
+      result<-calculate_bayesGHelper(
+        list(
+          cbind(
+          result_first,last[[1]]),
+          c(log(index_chunks_end[length(index_chunks)/2-1],2),log(index_chunks[length(index_chunks)/2,2]-index_chunks[length(index_chunks)/2,1]+1,2))
+        )
+      )
+    }
+    return(as.vector(result))
+  }
+    
+  # Computes the 95% CI for a pdf
+  calcBayesCI <- function(Pdf,low=0.025,up=0.975,max_sigma=20, length_sigma=4001){
+    if(length(Pdf)!=length_sigma) return(NA)
+    sigma_s=seq(-max_sigma,max_sigma,length.out=length_sigma)
+    cdf = cumsum(Pdf)
+    cdf = cdf/cdf[length(cdf)]  
+    return( c(sigma_s[findInterval(low,cdf)-1] , sigma_s[findInterval(up,cdf)]) ) 
+  }
+  
+  # Computes a mean for a pdf
+  calcBayesMean <- function(Pdf,max_sigma=20,length_sigma=4001){
+    if(length(Pdf)!=length_sigma) return(NA)
+    sigma_s=seq(-max_sigma,max_sigma,length.out=length_sigma)
+    norm = {length_sigma-1}/2/max_sigma
+    return( (Pdf%*%sigma_s/norm)  ) 
+  }
+  
+  # Returns the mean, and the 95% CI for a pdf
+  calcBayesOutputInfo <- function(Pdf,low=0.025,up=0.975,max_sigma=20, length_sigma=4001){
+    if(is.na(Pdf)) 
+     return(rep(NA,3))  
+    bCI = calcBayesCI(Pdf=Pdf,low=low,up=up,max_sigma=max_sigma,length_sigma=length_sigma)
+    bMean = calcBayesMean(Pdf=Pdf,max_sigma=max_sigma,length_sigma=length_sigma)
+    return(c(bMean, bCI))
+  }   
+
+  # Computes the p-value of a pdf
+  computeSigmaP <- function(Pdf, length_sigma=4001, max_sigma=20){
+    if(length(Pdf)>1){
+      norm = {length_sigma-1}/2/max_sigma
+      pVal = {sum(Pdf[1:{{length_sigma-1}/2}]) + Pdf[{{length_sigma+1}/2}]/2}/norm
+      if(pVal>0.5){
+        pVal = pVal-1
+      }
+      return(pVal)
+    }else{
+      return(NA)
+    }
+  }    
+  
+  # Compute p-value of two distributions
+  compareTwoDistsFaster <-function(sigma_S=seq(-20,20,length.out=4001), N=10000, dens1=runif(4001,0,1), dens2=runif(4001,0,1)){
+  #print(c(length(dens1),length(dens2)))
+  if(length(dens1)>1 & length(dens2)>1 ){
+    dens1<-dens1/sum(dens1)
+    dens2<-dens2/sum(dens2)
+    cum2 <- cumsum(dens2)-dens2/2
+    tmp<- sum(sapply(1:length(dens1),function(i)return(dens1[i]*cum2[i])))
+    #print(tmp)
+    if(tmp>0.5)tmp<-tmp-1
+    return( tmp )
+    }
+    else {
+    return(NA)
+    }
+    #return (sum(sapply(1:N,function(i)(sample(sigma_S,1,prob=dens1)>sample(sigma_S,1,prob=dens2))))/N)
+  }  
+  
+  # get number of seqeunces contributing to the sigma (i.e. seqeunces with mutations)
+  numberOfSeqsWithMutations <- function(matMutations,test=1){
+    if(test==4)test=2
+    cdrSeqs <- 0
+    fwrSeqs <- 0    
+    if(test==1){#focused
+      cdrMutations <- apply(matMutations, 1, function(x){ sum(x[c(1,2,4)]) })
+      fwrMutations <- apply(matMutations, 1, function(x){ sum(x[c(3,4,2)]) })
+      if( any(which(cdrMutations>0)) ) cdrSeqs <- sum(cdrMutations>0)
+      if( any(which(fwrMutations>0)) ) fwrSeqs <- sum(fwrMutations>0) 
+    }
+    if(test==2){#local
+      cdrMutations <- apply(matMutations, 1, function(x){ sum(x[c(1,2)]) })
+      fwrMutations <- apply(matMutations, 1, function(x){ sum(x[c(3,4)]) })
+      if( any(which(cdrMutations>0)) ) cdrSeqs <- sum(cdrMutations>0)
+      if( any(which(fwrMutations>0)) ) fwrSeqs <- sum(fwrMutations>0) 
+    }
+  return(c("CDR"=cdrSeqs, "FWR"=fwrSeqs))
+}  
+
+
+
+shadeColor <- function(sigmaVal=NA,pVal=NA){
+  if(is.na(sigmaVal) & is.na(pVal)) return(NA)
+  if(is.na(sigmaVal) & !is.na(pVal)) sigmaVal=sign(pVal)
+  if(is.na(pVal) || pVal==1 || pVal==0){
+    returnColor = "#FFFFFF";
+  }else{
+    colVal=abs(pVal);
+    
+    if(sigmaVal<0){      
+        if(colVal>0.1)
+          returnColor = "#CCFFCC";
+        if(colVal<=0.1)
+          returnColor = "#99FF99";
+        if(colVal<=0.050)
+          returnColor = "#66FF66";
+        if(colVal<=0.010)
+          returnColor = "#33FF33";
+        if(colVal<=0.005)
+          returnColor = "#00FF00";
+      
+    }else{
+      if(colVal>0.1)
+        returnColor = "#FFCCCC";
+      if(colVal<=0.1)
+        returnColor = "#FF9999";
+      if(colVal<=0.05)
+        returnColor = "#FF6666";
+      if(colVal<=0.01)
+        returnColor = "#FF3333";
+      if(colVal<0.005)
+        returnColor = "#FF0000";
+    }
+  }
+  
+  return(returnColor)
+}
+
+
+
+plotHelp <- function(xfrac=0.05,yfrac=0.05,log=FALSE){
+  if(!log){
+    x = par()$usr[1]-(par()$usr[2]-par()$usr[1])*xfrac
+    y = par()$usr[4]+(par()$usr[4]-par()$usr[3])*yfrac
+  }else {
+    if(log==2){
+      x = par()$usr[1]-(par()$usr[2]-par()$usr[1])*xfrac
+      y = 10^((par()$usr[4])+((par()$usr[4])-(par()$usr[3]))*yfrac)
+    }
+    if(log==1){
+      x = 10^((par()$usr[1])-((par()$usr[2])-(par()$usr[1]))*xfrac)
+      y = par()$usr[4]+(par()$usr[4]-par()$usr[3])*yfrac
+    }
+    if(log==3){
+      x = 10^((par()$usr[1])-((par()$usr[2])-(par()$usr[1]))*xfrac)
+      y = 10^((par()$usr[4])+((par()$usr[4])-(par()$usr[3]))*yfrac)
+    }
+  }
+  return(c("x"=x,"y"=y))
+}
+
+# SHMulation
+
+  # Based on targeting, introduce a single mutation & then update the targeting 
+  oneMutation <- function(){
+    # Pick a postion + mutation
+    posMutation = sample(1:(seqGermlineLen*4),1,replace=F,prob=as.vector(seqTargeting))
+    posNucNumb = ceiling(posMutation/4)                    # Nucleotide number
+    posNucKind = 4 - ( (posNucNumb*4) - posMutation )   # Nuc the position mutates to
+  
+    #mutate the simulation sequence
+    seqSimVec <-  s2c(seqSim)
+    seqSimVec[posNucNumb] <- NUCLEOTIDES[posNucKind]
+    seqSim <<-  c2s(seqSimVec)
+    
+    #update Mutability, Targeting & MutationsTypes
+    updateMutabilityNTargeting(posNucNumb)
+  
+    #return(c(posNucNumb,NUCLEOTIDES[posNucKind])) 
+    return(posNucNumb)
+  }  
+  
+  updateMutabilityNTargeting <- function(position){
+    min_i<-max((position-2),1)
+    max_i<-min((position+2),nchar(seqSim))
+    min_ii<-min(min_i,3)
+    
+    #mutability - update locally
+    seqMutability[(min_i):(max_i)] <<- computeMutabilities(substr(seqSim,position-4,position+4))[(min_ii):(max_i-min_i+min_ii)]
+    
+    
+    #targeting - compute locally
+    seqTargeting[,min_i:max_i] <<- computeTargeting(substr(seqSim,min_i,max_i),seqMutability[min_i:max_i])                 
+    seqTargeting[is.na(seqTargeting)] <<- 0
+    #mutCodonPos = getCodonPos(position) 
+    mutCodonPos = seq(getCodonPos(min_i)[1],getCodonPos(max_i)[3])
+    #cat(mutCodonPos,"\n")                                                  
+    mutTypeCodon = getCodonPos(position)
+    seqMutationTypes[,mutTypeCodon] <<- computeMutationTypesFast( substr(seqSim,mutTypeCodon[1],mutTypeCodon[3]) ) 
+    # Stop = 0
+    if(any(seqMutationTypes[,mutCodonPos]=="Stop",na.rm=T )){
+      seqTargeting[,mutCodonPos][seqMutationTypes[,mutCodonPos]=="Stop"] <<- 0
+    }
+    
+  
+    #Selection
+    selectedPos = (min_i*4-4)+(which(seqMutationTypes[,min_i:max_i]=="R"))  
+    # CDR
+    selectedCDR = selectedPos[which(matCDR[selectedPos]==T)]
+    seqTargeting[selectedCDR] <<-  seqTargeting[selectedCDR] *  exp(selCDR)
+    seqTargeting[selectedCDR] <<- seqTargeting[selectedCDR]/baseLineCDR_K
+        
+    # FWR
+    selectedFWR = selectedPos[which(matFWR[selectedPos]==T)]
+    seqTargeting[selectedFWR] <<-  seqTargeting[selectedFWR] *  exp(selFWR)
+    seqTargeting[selectedFWR] <<- seqTargeting[selectedFWR]/baseLineFWR_K      
+    
+  }  
+  
+
+
+  # Validate the mutation: if the mutation has not been sampled before validate it, else discard it.   
+  validateMutation <- function(){  
+    if( !(mutatedPos%in%mutatedPositions) ){ # if it's a new mutation
+      uniqueMutationsIntroduced <<- uniqueMutationsIntroduced + 1
+      mutatedPositions[uniqueMutationsIntroduced] <<-  mutatedPos  
+    }else{
+      if(substr(seqSim,mutatedPos,mutatedPos)==substr(seqGermline,mutatedPos,mutatedPos)){ # back to germline mutation
+        mutatedPositions <<-  mutatedPositions[-which(mutatedPositions==mutatedPos)]
+        uniqueMutationsIntroduced <<-  uniqueMutationsIntroduced - 1
+      }      
+    }
+  }  
+  
+  
+  
+  # Places text (labels) at normalized coordinates 
+  myaxis <- function(xfrac=0.05,yfrac=0.05,log=FALSE,w="text",cex=1,adj=1,thecol="black"){
+    par(xpd=TRUE)
+    if(!log)
+      text(par()$usr[1]-(par()$usr[2]-par()$usr[1])*xfrac,par()$usr[4]+(par()$usr[4]-par()$usr[3])*yfrac,w,cex=cex,adj=adj,col=thecol)
+    else {
+    if(log==2)
+    text(
+      par()$usr[1]-(par()$usr[2]-par()$usr[1])*xfrac,
+      10^((par()$usr[4])+((par()$usr[4])-(par()$usr[3]))*yfrac),
+      w,cex=cex,adj=adj,col=thecol)
+    if(log==1)
+      text(
+      10^((par()$usr[1])-((par()$usr[2])-(par()$usr[1]))*xfrac),
+      par()$usr[4]+(par()$usr[4]-par()$usr[3])*yfrac,
+      w,cex=cex,adj=adj,col=thecol)
+    if(log==3)
+      text(
+      10^((par()$usr[1])-((par()$usr[2])-(par()$usr[1]))*xfrac),
+      10^((par()$usr[4])+((par()$usr[4])-(par()$usr[3]))*yfrac),
+      w,cex=cex,adj=adj,col=thecol)
+    }
+    par(xpd=FALSE)
+  }
+  
+  
+  
+  # Count the mutations in a sequence
+  analyzeMutations <- function( inputMatrixIndex, model = 0 , multipleMutation=0, seqWithStops=0){
+
+    paramGL = s2c(matInput[inputMatrixIndex,2])
+    paramSeq = s2c(matInput[inputMatrixIndex,1])            
+    
+    #if( any(paramSeq=="N") ){
+    #  gapPos_Seq =  which(paramSeq=="N")
+    #  gapPos_Seq_ToReplace = gapPos_Seq[paramGL[gapPos_Seq] != "N"]
+    #  paramSeq[gapPos_Seq_ToReplace] =  paramGL[gapPos_Seq_ToReplace]
+    #}        
+    mutations_val = paramGL != paramSeq   
+    
+    if(any(mutations_val)){
+      mutationPos = which(mutations_val)#{1:length(mutations_val)}[mutations_val]  
+      length_mutations =length(mutationPos)
+      mutationInfo = rep(NA,length_mutations)
+                          
+      pos<- mutationPos
+      pos_array<-array(sapply(pos,getCodonPos))
+      codonGL =  paramGL[pos_array]
+      codonSeqWhole =  paramSeq[pos_array]
+      codonSeq = sapply(pos,function(x){
+                                seqP = paramGL[getCodonPos(x)]
+                                muCodonPos = {x-1}%%3+1 
+                                seqP[muCodonPos] = paramSeq[x]
+                                return(seqP)
+                              })
+      GLcodons =  apply(matrix(codonGL,length_mutations,3,byrow=TRUE),1,c2s)
+      SeqcodonsWhole =  apply(matrix(codonSeqWhole,length_mutations,3,byrow=TRUE),1,c2s)      
+      Seqcodons =   apply(codonSeq,2,c2s)
+      
+      mutationInfo = apply(rbind(GLcodons , Seqcodons),2,function(x){mutationType(c2s(x[1]),c2s(x[2]))})     
+      names(mutationInfo) = mutationPos     
+      
+      mutationInfoWhole = apply(rbind(GLcodons , SeqcodonsWhole),2,function(x){mutationType(c2s(x[1]),c2s(x[2]))})           
+      names(mutationInfoWhole) = mutationPos
+
+      mutationInfo <- mutationInfo[!is.na(mutationInfo)]
+      mutationInfoWhole <- mutationInfoWhole[!is.na(mutationInfoWhole)]
+      
+      if(any(!is.na(mutationInfo))){       
+  
+        #Filter based on Stop (at the codon level)
+        if(seqWithStops==1){
+          nucleotidesAtStopCodons = names(mutationInfoWhole[mutationInfoWhole!="Stop"])
+          mutationInfo = mutationInfo[nucleotidesAtStopCodons]
+          mutationInfoWhole = mutationInfo[nucleotidesAtStopCodons]
+        }else{
+          countStops = sum(mutationInfoWhole=="Stop")
+          if(seqWithStops==2 & countStops==0) mutationInfo = NA
+          if(seqWithStops==3 & countStops>0) mutationInfo = NA
+        }         
+        
+        if(any(!is.na(mutationInfo))){
+          #Filter mutations based on multipleMutation
+          if(multipleMutation==1 & !is.na(mutationInfo)){
+            mutationCodons = getCodonNumb(as.numeric(names(mutationInfoWhole)))
+            tableMutationCodons <- table(mutationCodons)
+            codonsWithMultipleMutations <- as.numeric(names(tableMutationCodons[tableMutationCodons>1]))
+            if(any(codonsWithMultipleMutations)){
+              #remove the nucleotide mutations in the codons with multiple mutations
+              mutationInfo <- mutationInfo[!(mutationCodons %in% codonsWithMultipleMutations)]
+              #replace those codons with Ns in the input sequence
+              paramSeq[unlist(lapply(codonsWithMultipleMutations, getCodonNucs))] = "N"
+              matInput[inputMatrixIndex,1] <<- c2s(paramSeq)
+            }
+          }
+
+          #Filter mutations based on the model
+          if(any(mutationInfo)==T | is.na(any(mutationInfo))){        
+            
+            if(model==1 & !is.na(mutationInfo)){
+              mutationInfo <- mutationInfo[mutationInfo=="S"]
+            }  
+            if(any(mutationInfo)==T | is.na(any(mutationInfo))) return(mutationInfo)
+            else return(NA)
+          }else{
+            return(NA)
+          }
+        }else{
+          return(NA)
+        }
+        
+        
+      }else{
+        return(NA)
+      }
+    
+    
+    }else{
+      return (NA)
+    }    
+  }  
+
+   analyzeMutationsFixed <- function( inputArray, model = 0 , multipleMutation=0, seqWithStops=0){
+
+    paramGL = s2c(inputArray[2])
+    paramSeq = s2c(inputArray[1])            
+    inputSeq <- inputArray[1]
+    #if( any(paramSeq=="N") ){
+    #  gapPos_Seq =  which(paramSeq=="N")
+    #  gapPos_Seq_ToReplace = gapPos_Seq[paramGL[gapPos_Seq] != "N"]
+    #  paramSeq[gapPos_Seq_ToReplace] =  paramGL[gapPos_Seq_ToReplace]
+    #}        
+    mutations_val = paramGL != paramSeq   
+    
+    if(any(mutations_val)){
+      mutationPos = which(mutations_val)#{1:length(mutations_val)}[mutations_val]  
+      length_mutations =length(mutationPos)
+      mutationInfo = rep(NA,length_mutations)
+                          
+      pos<- mutationPos
+      pos_array<-array(sapply(pos,getCodonPos))
+      codonGL =  paramGL[pos_array]
+      codonSeqWhole =  paramSeq[pos_array]
+      codonSeq = sapply(pos,function(x){
+                                seqP = paramGL[getCodonPos(x)]
+                                muCodonPos = {x-1}%%3+1 
+                                seqP[muCodonPos] = paramSeq[x]
+                                return(seqP)
+                              })
+      GLcodons =  apply(matrix(codonGL,length_mutations,3,byrow=TRUE),1,c2s)
+      SeqcodonsWhole =  apply(matrix(codonSeqWhole,length_mutations,3,byrow=TRUE),1,c2s)      
+      Seqcodons =   apply(codonSeq,2,c2s)
+      
+      mutationInfo = apply(rbind(GLcodons , Seqcodons),2,function(x){mutationType(c2s(x[1]),c2s(x[2]))})     
+      names(mutationInfo) = mutationPos     
+      
+      mutationInfoWhole = apply(rbind(GLcodons , SeqcodonsWhole),2,function(x){mutationType(c2s(x[1]),c2s(x[2]))})           
+      names(mutationInfoWhole) = mutationPos
+
+      mutationInfo <- mutationInfo[!is.na(mutationInfo)]
+      mutationInfoWhole <- mutationInfoWhole[!is.na(mutationInfoWhole)]
+      
+      if(any(!is.na(mutationInfo))){       
+  
+        #Filter based on Stop (at the codon level)
+        if(seqWithStops==1){
+          nucleotidesAtStopCodons = names(mutationInfoWhole[mutationInfoWhole!="Stop"])
+          mutationInfo = mutationInfo[nucleotidesAtStopCodons]
+          mutationInfoWhole = mutationInfo[nucleotidesAtStopCodons]
+        }else{
+          countStops = sum(mutationInfoWhole=="Stop")
+          if(seqWithStops==2 & countStops==0) mutationInfo = NA
+          if(seqWithStops==3 & countStops>0) mutationInfo = NA
+        }         
+        
+        if(any(!is.na(mutationInfo))){
+          #Filter mutations based on multipleMutation
+          if(multipleMutation==1 & !is.na(mutationInfo)){
+            mutationCodons = getCodonNumb(as.numeric(names(mutationInfoWhole)))
+            tableMutationCodons <- table(mutationCodons)
+            codonsWithMultipleMutations <- as.numeric(names(tableMutationCodons[tableMutationCodons>1]))
+            if(any(codonsWithMultipleMutations)){
+              #remove the nucleotide mutations in the codons with multiple mutations
+              mutationInfo <- mutationInfo[!(mutationCodons %in% codonsWithMultipleMutations)]
+              #replace those codons with Ns in the input sequence
+              paramSeq[unlist(lapply(codonsWithMultipleMutations, getCodonNucs))] = "N"
+              #matInput[inputMatrixIndex,1] <<- c2s(paramSeq)
+              inputSeq <- c2s(paramSeq)
+            }
+          }
+          
+          #Filter mutations based on the model
+          if(any(mutationInfo)==T | is.na(any(mutationInfo))){        
+            
+            if(model==1 & !is.na(mutationInfo)){
+              mutationInfo <- mutationInfo[mutationInfo=="S"]
+            }  
+            if(any(mutationInfo)==T | is.na(any(mutationInfo))) return(list(mutationInfo,inputSeq))
+            else return(list(NA,inputSeq))
+          }else{
+            return(list(NA,inputSeq))
+          }
+        }else{
+          return(list(NA,inputSeq))
+        }
+        
+        
+      }else{
+        return(list(NA,inputSeq))
+      }
+    
+    
+    }else{
+      return (list(NA,inputSeq))
+    }    
+  }  
+ 
+  # triMutability Background Count
+  buildMutabilityModel <- function( inputMatrixIndex, model=0 , multipleMutation=0, seqWithStops=0, stopMutations=0){
+    
+    #rowOrigMatInput = matInput[inputMatrixIndex,]    
+    seqGL =  gsub("-", "", matInput[inputMatrixIndex,2])
+    seqInput = gsub("-", "", matInput[inputMatrixIndex,1])    
+    #matInput[inputMatrixIndex,] <<- cbind(seqInput,seqGL)
+    tempInput <- cbind(seqInput,seqGL)
+    seqLength = nchar(seqGL)      
+    list_analyzeMutationsFixed<- analyzeMutationsFixed(tempInput, model, multipleMutation, seqWithStops)
+    mutationCount <- list_analyzeMutationsFixed[[1]]
+    seqInput <- list_analyzeMutationsFixed[[2]]
+    BackgroundMatrix = mutabilityMatrix
+    MutationMatrix = mutabilityMatrix    
+    MutationCountMatrix = mutabilityMatrix    
+    if(!is.na(mutationCount)){
+      if((stopMutations==0 & model==0) | (stopMutations==1 & (sum(mutationCount=="Stop")<length(mutationCount))) | (model==1 & (sum(mutationCount=="S")>0)) ){ 
+                  
+        fivermerStartPos = 1:(seqLength-4)
+        fivemerLength <- length(fivermerStartPos)
+        fivemerGL <- substr(rep(seqGL,length(fivermerStartPos)),(fivermerStartPos),(fivermerStartPos+4))
+        fivemerSeq <- substr(rep(seqInput,length(fivermerStartPos)),(fivermerStartPos),(fivermerStartPos+4))
+    
+        #Background
+        for(fivemerIndex in 1:fivemerLength){
+          fivemer = fivemerGL[fivemerIndex]
+          if(!any(grep("N",fivemer))){
+            fivemerCodonPos = fivemerCodon(fivemerIndex)
+            fivemerReadingFrameCodon = substr(fivemer,fivemerCodonPos[1],fivemerCodonPos[3]) 
+            fivemerReadingFrameCodonInputSeq = substr(fivemerSeq[fivemerIndex],fivemerCodonPos[1],fivemerCodonPos[3])          
+            
+            # All mutations model
+            #if(!any(grep("N",fivemerReadingFrameCodon))){
+              if(model==0){
+                if(stopMutations==0){
+                  if(!any(grep("N",fivemerReadingFrameCodonInputSeq)))
+                    BackgroundMatrix[fivemer] <- (BackgroundMatrix[fivemer] + 1)              
+                }else{
+                  if( !any(grep("N",fivemerReadingFrameCodonInputSeq)) & translateCodonToAminoAcid(fivemerReadingFrameCodon)!="*" ){
+                    positionWithinCodon = which(fivemerCodonPos==3)#positionsWithinCodon[(fivemerCodonPos[1]%%3)+1]
+                    BackgroundMatrix[fivemer] <- (BackgroundMatrix[fivemer] + probNonStopMutations[fivemerReadingFrameCodon,positionWithinCodon])
+                  }
+                }
+              }else{ # Only silent mutations
+                if( !any(grep("N",fivemerReadingFrameCodonInputSeq)) & translateCodonToAminoAcid(fivemerReadingFrameCodon)!="*" & translateCodonToAminoAcid(fivemerReadingFrameCodonInputSeq)==translateCodonToAminoAcid(fivemerReadingFrameCodon)){
+                  positionWithinCodon = which(fivemerCodonPos==3)
+                  BackgroundMatrix[fivemer] <- (BackgroundMatrix[fivemer] + probSMutations[fivemerReadingFrameCodon,positionWithinCodon])
+                }
+              }
+            #}
+          }
+        }
+        
+        #Mutations
+        if(stopMutations==1) mutationCount = mutationCount[mutationCount!="Stop"]
+        if(model==1) mutationCount = mutationCount[mutationCount=="S"]  
+        mutationPositions = as.numeric(names(mutationCount))
+        mutationCount = mutationCount[mutationPositions>2 & mutationPositions<(seqLength-1)]
+        mutationPositions =  mutationPositions[mutationPositions>2 & mutationPositions<(seqLength-1)]
+        countMutations = 0 
+        for(mutationPosition in mutationPositions){
+          fivemerIndex = mutationPosition-2
+          fivemer = fivemerSeq[fivemerIndex]
+          GLfivemer = fivemerGL[fivemerIndex]
+          fivemerCodonPos = fivemerCodon(fivemerIndex)
+          fivemerReadingFrameCodon = substr(fivemer,fivemerCodonPos[1],fivemerCodonPos[3]) 
+          fivemerReadingFrameCodonGL = substr(GLfivemer,fivemerCodonPos[1],fivemerCodonPos[3])
+          if(!any(grep("N",fivemer)) & !any(grep("N",GLfivemer))){
+            if(model==0){
+                countMutations = countMutations + 1              
+                MutationMatrix[GLfivemer] <- (MutationMatrix[GLfivemer] + 1)
+                MutationCountMatrix[GLfivemer] <- (MutationCountMatrix[GLfivemer] + 1)             
+            }else{
+              if( translateCodonToAminoAcid(fivemerReadingFrameCodonGL)!="*" ){
+                  countMutations = countMutations + 1
+                  positionWithinCodon = which(fivemerCodonPos==3)
+                  glNuc =  substr(fivemerReadingFrameCodonGL,positionWithinCodon,positionWithinCodon)
+                  inputNuc =  substr(fivemerReadingFrameCodon,positionWithinCodon,positionWithinCodon)
+                  MutationMatrix[GLfivemer] <- (MutationMatrix[GLfivemer] + substitution[glNuc,inputNuc])
+                  MutationCountMatrix[GLfivemer] <- (MutationCountMatrix[GLfivemer] + 1)                                    
+              }                
+            }                  
+          }              
+        }
+        
+        seqMutability = MutationMatrix/BackgroundMatrix
+        seqMutability = seqMutability/sum(seqMutability,na.rm=TRUE)
+        #cat(inputMatrixIndex,"\t",countMutations,"\n")
+        return(list("seqMutability"  = seqMutability,"numbMutations" = countMutations,"seqMutabilityCount" = MutationCountMatrix, "BackgroundMatrix"=BackgroundMatrix))      
+        
+      }        
+    }
+  
+  }  
+  
+  #Returns the codon position containing the middle nucleotide
+  fivemerCodon <- function(fivemerIndex){
+    codonPos = list(2:4,1:3,3:5)
+    fivemerType = fivemerIndex%%3
+    return(codonPos[[fivemerType+1]])
+  }
+
+  #returns probability values for one mutation in codons resulting in R, S or Stop
+  probMutations <- function(typeOfMutation){    
+    matMutationProb <- matrix(0,ncol=3,nrow=125,dimnames=list(words(alphabet = c(NUCLEOTIDES,"N"), length=3),c(1:3)))   
+    for(codon in rownames(matMutationProb)){
+        if( !any(grep("N",codon)) ){
+        for(muPos in 1:3){
+          matCodon = matrix(rep(s2c(codon),3),nrow=3,ncol=3,byrow=T)
+          glNuc = matCodon[1,muPos]
+          matCodon[,muPos] = canMutateTo(glNuc) 
+          substitutionRate = substitution[glNuc,matCodon[,muPos]]
+          typeOfMutations = apply(rbind(rep(codon,3),apply(matCodon,1,c2s)),2,function(x){mutationType(c2s(x[1]),c2s(x[2]))})        
+          matMutationProb[codon,muPos] <- sum(substitutionRate[typeOfMutations==typeOfMutation])
+        }
+      }
+    }
+    
+    return(matMutationProb) 
+  }
+  
+  
+  
+  
+#Mapping Trinucleotides to fivemers
+mapTriToFivemer <- function(triMutability=triMutability_Literature_Human){
+  rownames(triMutability) <- triMutability_Names
+  Fivemer<-rep(NA,1024)
+  names(Fivemer)<-words(alphabet=NUCLEOTIDES,length=5)
+  Fivemer<-sapply(names(Fivemer),function(Word)return(sum( c(triMutability[substring(Word,3,5),1],triMutability[substring(Word,2,4),2],triMutability[substring(Word,1,3),3]),na.rm=TRUE)))
+  Fivemer<-Fivemer/sum(Fivemer)
+  return(Fivemer)
+}
+
+collapseFivemerToTri<-function(Fivemer,Weights=MutabilityWeights,position=1,NUC="A"){
+  Indices<-substring(names(Fivemer),3,3)==NUC
+  Factors<-substring(names(Fivemer[Indices]),(4-position),(6-position))
+  tapply(which(Indices),Factors,function(i)weighted.mean(Fivemer[i],Weights[i],na.rm=TRUE))
+}
+
+
+
+CountFivemerToTri<-function(Fivemer,Weights=MutabilityWeights,position=1,NUC="A"){
+  Indices<-substring(names(Fivemer),3,3)==NUC
+  Factors<-substring(names(Fivemer[Indices]),(4-position),(6-position))
+  tapply(which(Indices),Factors,function(i)sum(Weights[i],na.rm=TRUE))
+}
+
+#Uses the real counts of the mutated fivemers
+CountFivemerToTri2<-function(Fivemer,Counts=MutabilityCounts,position=1,NUC="A"){
+  Indices<-substring(names(Fivemer),3,3)==NUC
+  Factors<-substring(names(Fivemer[Indices]),(4-position),(6-position))
+  tapply(which(Indices),Factors,function(i)sum(Counts[i],na.rm=TRUE))
+}
+
+bootstrap<-function(x=c(33,12,21),M=10000,alpha=0.05){
+N<-sum(x)
+if(N){
+p<-x/N
+k<-length(x)-1
+tmp<-rmultinom(M, size = N, prob=p)
+tmp_p<-apply(tmp,2,function(y)y/N)
+(apply(tmp_p,1,function(y)quantile(y,c(alpha/2/k,1-alpha/2/k))))
+}
+else return(matrix(0,2,length(x)))
+}
+
+
+
+
+bootstrap2<-function(x=c(33,12,21),n=10,M=10000,alpha=0.05){
+
+N<-sum(x)
+k<-length(x)
+y<-rep(1:k,x)
+tmp<-sapply(1:M,function(i)sample(y,n))
+if(n>1)tmp_p<-sapply(1:M,function(j)sapply(1:k,function(i)sum(tmp[,j]==i)))/n
+if(n==1)tmp_p<-sapply(1:M,function(j)sapply(1:k,function(i)sum(tmp[j]==i)))/n
+(apply(tmp_p,1,function(z)quantile(z,c(alpha/2/(k-1),1-alpha/2/(k-1)))))
+}
+
+
+
+p_value<-function(x=c(33,12,21),M=100000,x_obs=c(2,5,3)){
+n=sum(x_obs)
+N<-sum(x)
+k<-length(x)
+y<-rep(1:k,x)
+tmp<-sapply(1:M,function(i)sample(y,n))
+if(n>1)tmp_p<-sapply(1:M,function(j)sapply(1:k,function(i)sum(tmp[,j]==i)))
+if(n==1)tmp_p<-sapply(1:M,function(j)sapply(1:k,function(i)sum(tmp[j]==i)))
+tmp<-rbind(sapply(1:3,function(i)sum(tmp_p[i,]>=x_obs[i])/M),
+sapply(1:3,function(i)sum(tmp_p[i,]<=x_obs[i])/M))
+sapply(1:3,function(i){if(tmp[1,i]>=tmp[2,i])return(-tmp[2,i])else return(tmp[1,i])})
+}
+
+#"D:\\Sequences\\IMGT Germlines\\Human_SNPless_IGHJ.FASTA"
+# Remove SNPs from IMGT germline segment alleles
+generateUnambiguousRepertoire <- function(repertoireInFile,repertoireOutFile){
+  repertoireIn <- read.fasta(repertoireInFile, seqtype="DNA",as.string=T,set.attributes=F,forceDNAtolower=F)
+  alleleNames <- sapply(names(repertoireIn),function(x)strsplit(x,"|",fixed=TRUE)[[1]][2])
+  SNPs <- tapply(repertoireIn,sapply(alleleNames,function(x)strsplit(x,"*",fixed=TRUE)[[1]][1]),function(x){
+    Indices<-NULL
+    for(i in 1:length(x)){
+      firstSeq = s2c(x[[1]])
+      iSeq = s2c(x[[i]])
+      Indices<-c(Indices,which(firstSeq[1:320]!=iSeq[1:320] & firstSeq[1:320]!="." & iSeq[1:320]!="."  ))
+    }
+    return(sort(unique(Indices)))
+  })
+ repertoireOut <- repertoireIn
+ repertoireOut <- lapply(names(repertoireOut), function(repertoireName){
+                                        alleleName <- strsplit(repertoireName,"|",fixed=TRUE)[[1]][2]
+                                        geneSegmentName <- strsplit(alleleName,"*",fixed=TRUE)[[1]][1]
+                                        alleleSeq <- s2c(repertoireOut[[repertoireName]])
+                                        alleleSeq[as.numeric(unlist(SNPs[geneSegmentName]))] <- "N"
+                                        alleleSeq <- c2s(alleleSeq)
+                                        repertoireOut[[repertoireName]] <- alleleSeq
+                                      })
+  names(repertoireOut) <- names(repertoireIn)
+  write.fasta(repertoireOut,names(repertoireOut),file.out=repertoireOutFile)                                               
+                                      
+}
+
+
+
+
+
+
+############
+groupBayes2 = function(indexes, param_resultMat){
+  
+  BayesGDist_Focused_CDR = calculate_bayesG( x=param_resultMat[indexes,1], N=apply(param_resultMat[indexes,c(1,2,4)],1,sum,na.rm=T), p=apply(param_resultMat[indexes,5:8],1,function(x){x[1]/(x[1]+x[2]+x[4])}))
+  BayesGDist_Focused_FWR = calculate_bayesG( x=param_resultMat[indexes,3], N=apply(param_resultMat[indexes,c(3,2,4)],1,sum,na.rm=T), p=apply(param_resultMat[indexes,5:8],1,function(x){x[3]/(x[3]+x[2]+x[4])}))
+  #BayesGDist_Local_CDR = calculate_bayesG( x=param_resultMat[indexes,1], N=apply(param_resultMat[indexes,c(1,2)],1,sum,na.rm=T), p=apply(param_resultMat[indexes,5:8],1,function(x){x[1]/(x[1]+x[2])}))
+  #BayesGDist_Local_FWR = calculate_bayesG( x=param_resultMat[indexes,3], N=apply(param_resultMat[indexes,c(3,4)],1,sum,na.rm=T), p=apply(param_resultMat[indexes,5:8],1,function(x){x[3]/(x[3]+x[4])}))
+  #BayesGDist_Global_CDR = calculate_bayesG( x=param_resultMat[indexes,1], N=apply(param_resultMat[indexes,c(1,2,3,4)],1,sum,na.rm=T), p=apply(param_resultMat[indexes,5:8],1,function(x){x[1]/(x[1]+x[2]+x[3]+x[4])}))
+  #BayesGDist_Global_FWR = calculate_bayesG( x=param_resultMat[indexes,3], N=apply(param_resultMat[indexes,c(1,2,3,4)],1,sum,na.rm=T), p=apply(param_resultMat[indexes,5:8],1,function(x){x[3]/(x[1]+x[2]+x[3]+x[4])}))
+  return ( list("BayesGDist_Focused_CDR"=BayesGDist_Focused_CDR,
+                "BayesGDist_Focused_FWR"=BayesGDist_Focused_FWR) )
+                #"BayesGDist_Local_CDR"=BayesGDist_Local_CDR,
+                #"BayesGDist_Local_FWR" = BayesGDist_Local_FWR))
+#                "BayesGDist_Global_CDR" = BayesGDist_Global_CDR,
+#                "BayesGDist_Global_FWR" = BayesGDist_Global_FWR) )
+
+
+}
+
+
+calculate_bayesG <- function( x=array(), N=array(), p=array(), max_sigma=20, length_sigma=4001){
+  G <- max(length(x),length(N),length(p))
+  x=array(x,dim=G)
+  N=array(N,dim=G)
+  p=array(p,dim=G)
+
+  indexOfZero = N>0 & p>0
+  N = N[indexOfZero]
+  x = x[indexOfZero]
+  p = p[indexOfZero]  
+  G <- length(x)
+  
+  if(G){
+    
+    cons<-array( dim=c(length_sigma,G) )
+    if(G==1) {
+    return(calculate_bayes(x=x[G],N=N[G],p=p[G],max_sigma=max_sigma,length_sigma=length_sigma))
+    }
+    else {
+      for(g in 1:G) cons[,g] <- calculate_bayes(x=x[g],N=N[g],p=p[g],max_sigma=max_sigma,length_sigma=length_sigma)
+      listMatG <- convolutionPowersOfTwoByTwos(cons,length_sigma=length_sigma)
+      y<-calculate_bayesGHelper(listMatG,length_sigma=length_sigma)
+      return( y/sum(y)/(2*max_sigma/(length_sigma-1)) )
+    }
+  }else{
+    return(NA)
+  }
+}
+
+
+calculate_bayesGHelper <- function( listMatG,length_sigma=4001 ){
+  matG <- listMatG[[1]]  
+  groups <- listMatG[[2]]
+  i = 1  
+  resConv <- matG[,i]
+  denom <- 2^groups[i]
+  if(length(groups)>1){
+    while( i<length(groups) ){
+      i = i + 1
+      resConv <- weighted_conv(resConv, matG[,i], w= {{2^groups[i]}/denom} ,length_sigma=length_sigma)
+      #cat({{2^groups[i]}/denom},"\n")
+      denom <- denom + 2^groups[i]
+    }
+  }
+  return(resConv)  
+}
+
+weighted_conv<-function(x,y,w=1,m=100,length_sigma=4001){
+lx<-length(x)
+ly<-length(y)
+if({lx<m}| {{lx*w}<m}| {{ly}<m}| {{ly*w}<m}){
+if(w<1){
+y1<-approx(1:ly,y,seq(1,ly,length.out=m))$y
+x1<-approx(1:lx,x,seq(1,lx,length.out=m/w))$y
+lx<-length(x1)
+ly<-length(y1)
+}
+else {
+y1<-approx(1:ly,y,seq(1,ly,length.out=m*w))$y
+x1<-approx(1:lx,x,seq(1,lx,length.out=m))$y
+lx<-length(x1)
+ly<-length(y1)
+}
+}
+else{
+x1<-x
+y1<-approx(1:ly,y,seq(1,ly,length.out=floor(lx*w)))$y
+ly<-length(y1)
+}
+tmp<-approx(x=1:(lx+ly-1),y=convolve(x1,rev(y1),type="open"),xout=seq(1,lx+ly-1,length.out=length_sigma))$y
+tmp[tmp<=0] = 0 
+return(tmp/sum(tmp))
+}
+
+########################
+
+
+
+
+mutabilityMatrixONE<-rep(0,4)
+names(mutabilityMatrixONE)<-NUCLEOTIDES
+
+  # triMutability Background Count
+  buildMutabilityModelONE <- function( inputMatrixIndex, model=0 , multipleMutation=0, seqWithStops=0, stopMutations=0){
+    
+    #rowOrigMatInput = matInput[inputMatrixIndex,]    
+    seqGL =  gsub("-", "", matInput[inputMatrixIndex,2])
+    seqInput = gsub("-", "", matInput[inputMatrixIndex,1])    
+    matInput[inputMatrixIndex,] <<- c(seqInput,seqGL)
+    seqLength = nchar(seqGL)      
+    mutationCount <- analyzeMutations(inputMatrixIndex, model, multipleMutation, seqWithStops)
+    BackgroundMatrix = mutabilityMatrixONE
+    MutationMatrix = mutabilityMatrixONE    
+    MutationCountMatrix = mutabilityMatrixONE    
+    if(!is.na(mutationCount)){
+      if((stopMutations==0 & model==0) | (stopMutations==1 & (sum(mutationCount=="Stop")<length(mutationCount))) | (model==1 & (sum(mutationCount=="S")>0)) ){ 
+                  
+#         ONEmerStartPos = 1:(seqLength)
+#         ONEmerLength <- length(ONEmerStartPos)
+        ONEmerGL <- s2c(seqGL)
+        ONEmerSeq <- s2c(seqInput)
+    
+        #Background
+        for(ONEmerIndex in 1:seqLength){
+          ONEmer = ONEmerGL[ONEmerIndex]
+          if(ONEmer!="N"){
+            ONEmerCodonPos = getCodonPos(ONEmerIndex)
+            ONEmerReadingFrameCodon = c2s(ONEmerGL[ONEmerCodonPos]) 
+            ONEmerReadingFrameCodonInputSeq = c2s(ONEmerSeq[ONEmerCodonPos] )         
+            
+            # All mutations model
+            #if(!any(grep("N",ONEmerReadingFrameCodon))){
+              if(model==0){
+                if(stopMutations==0){
+                  if(!any(grep("N",ONEmerReadingFrameCodonInputSeq)))
+                    BackgroundMatrix[ONEmer] <- (BackgroundMatrix[ONEmer] + 1)              
+                }else{
+                  if( !any(grep("N",ONEmerReadingFrameCodonInputSeq)) & translateCodonToAminoAcid(ONEmerReadingFrameCodonInputSeq)!="*"){
+                    positionWithinCodon = which(ONEmerCodonPos==ONEmerIndex)#positionsWithinCodon[(ONEmerCodonPos[1]%%3)+1]
+                    BackgroundMatrix[ONEmer] <- (BackgroundMatrix[ONEmer] + probNonStopMutations[ONEmerReadingFrameCodon,positionWithinCodon])
+                  }
+                }
+              }else{ # Only silent mutations
+                if( !any(grep("N",ONEmerReadingFrameCodonInputSeq)) & translateCodonToAminoAcid(ONEmerReadingFrameCodonInputSeq)!="*" & translateCodonToAminoAcid(ONEmerReadingFrameCodonInputSeq)==translateCodonToAminoAcid(ONEmerReadingFrameCodon) ){
+                  positionWithinCodon = which(ONEmerCodonPos==ONEmerIndex)
+                  BackgroundMatrix[ONEmer] <- (BackgroundMatrix[ONEmer] + probSMutations[ONEmerReadingFrameCodon,positionWithinCodon])
+                }
+              }
+            }
+          }
+        }
+        
+        #Mutations
+        if(stopMutations==1) mutationCount = mutationCount[mutationCount!="Stop"]
+        if(model==1) mutationCount = mutationCount[mutationCount=="S"]  
+        mutationPositions = as.numeric(names(mutationCount))
+        mutationCount = mutationCount[mutationPositions>2 & mutationPositions<(seqLength-1)]
+        mutationPositions =  mutationPositions[mutationPositions>2 & mutationPositions<(seqLength-1)]
+        countMutations = 0 
+        for(mutationPosition in mutationPositions){
+          ONEmerIndex = mutationPosition
+          ONEmer = ONEmerSeq[ONEmerIndex]
+          GLONEmer = ONEmerGL[ONEmerIndex]
+          ONEmerCodonPos = getCodonPos(ONEmerIndex)
+          ONEmerReadingFrameCodon = c2s(ONEmerSeq[ONEmerCodonPos])  
+          ONEmerReadingFrameCodonGL =c2s(ONEmerGL[ONEmerCodonPos])  
+          if(!any(grep("N",ONEmer)) & !any(grep("N",GLONEmer))){
+            if(model==0){
+                countMutations = countMutations + 1              
+                MutationMatrix[GLONEmer] <- (MutationMatrix[GLONEmer] + 1)
+                MutationCountMatrix[GLONEmer] <- (MutationCountMatrix[GLONEmer] + 1)             
+            }else{
+              if( translateCodonToAminoAcid(ONEmerReadingFrameCodonGL)!="*" ){
+                  countMutations = countMutations + 1
+                  positionWithinCodon = which(ONEmerCodonPos==ONEmerIndex)
+                  glNuc =  substr(ONEmerReadingFrameCodonGL,positionWithinCodon,positionWithinCodon)
+                  inputNuc =  substr(ONEmerReadingFrameCodon,positionWithinCodon,positionWithinCodon)
+                  MutationMatrix[GLONEmer] <- (MutationMatrix[GLONEmer] + substitution[glNuc,inputNuc])
+                  MutationCountMatrix[GLONEmer] <- (MutationCountMatrix[GLONEmer] + 1)                                    
+              }                
+            }                  
+          }              
+        }
+        
+        seqMutability = MutationMatrix/BackgroundMatrix
+        seqMutability = seqMutability/sum(seqMutability,na.rm=TRUE)
+        #cat(inputMatrixIndex,"\t",countMutations,"\n")
+        return(list("seqMutability"  = seqMutability,"numbMutations" = countMutations,"seqMutabilityCount" = MutationCountMatrix, "BackgroundMatrix"=BackgroundMatrix))      
+#         tmp<-list("seqMutability"  = seqMutability,"numbMutations" = countMutations,"seqMutabilityCount" = MutationCountMatrix)
+      }        
+    }
+  
+################
+# $Id: trim.R 989 2006-10-29 15:28:26Z ggorjan $
+
+trim <- function(s, recode.factor=TRUE, ...)
+  UseMethod("trim", s)
+
+trim.default <- function(s, recode.factor=TRUE, ...)
+  s
+
+trim.character <- function(s, recode.factor=TRUE, ...)
+{
+  s <- sub(pattern="^ +", replacement="", x=s)
+  s <- sub(pattern=" +$", replacement="", x=s)
+  s
+}
+
+trim.factor <- function(s, recode.factor=TRUE, ...)
+{
+  levels(s) <- trim(levels(s))
+  if(recode.factor) {
+    dots <- list(x=s, ...)
+    if(is.null(dots$sort)) dots$sort <- sort
+    s <- do.call(what=reorder.factor, args=dots)
+  }
+  s
+}
+
+trim.list <- function(s, recode.factor=TRUE, ...)
+  lapply(s, trim, recode.factor=recode.factor, ...)
+
+trim.data.frame <- function(s, recode.factor=TRUE, ...)
+{
+  s[] <- trim.list(s, recode.factor=recode.factor, ...)
+  s
+}
+#######################################
+# Compute the expected for each sequence-germline pair by codon 
+getExpectedIndividualByCodon <- function(matInput){    
+if( any(grep("multicore",search())) ){  
+  facGL <- factor(matInput[,2])
+  facLevels = levels(facGL)
+  LisGLs_MutabilityU = mclapply(1:length(facLevels),  function(x){
+    computeMutabilities(facLevels[x])
+  })
+  facIndex = match(facGL,facLevels)
+  
+  LisGLs_Mutability = mclapply(1:nrow(matInput),  function(x){
+    cInput = rep(NA,nchar(matInput[x,1]))
+    cInput[s2c(matInput[x,1])!="N"] = 1
+    LisGLs_MutabilityU[[facIndex[x]]] * cInput                                                   
+  })
+  
+  LisGLs_Targeting =  mclapply(1:dim(matInput)[1],  function(x){
+    computeTargeting(matInput[x,2],LisGLs_Mutability[[x]])
+  })
+  
+  LisGLs_MutationTypes  = mclapply(1:length(matInput[,2]),function(x){
+    #print(x)
+    computeMutationTypes(matInput[x,2])
+  })
+  
+  LisGLs_R_Exp = mclapply(1:nrow(matInput),  function(x){
+    Exp_R <-  rollapply(as.zoo(1:readEnd),width=3,by=3,
+                        function(codonNucs){                                                      
+                          RPos = which(LisGLs_MutationTypes[[x]][,codonNucs]=="R") 
+                          sum( LisGLs_Targeting[[x]][,codonNucs][RPos], na.rm=T ) 
+                        }
+    )                                                   
+  })
+  
+  LisGLs_S_Exp = mclapply(1:nrow(matInput),  function(x){
+    Exp_S <-  rollapply(as.zoo(1:readEnd),width=3,by=3,
+                        function(codonNucs){                                                      
+                          SPos = which(LisGLs_MutationTypes[[x]][,codonNucs]=="S")   
+                          sum( LisGLs_Targeting[[x]][,codonNucs][SPos], na.rm=T )
+                        }
+    )                                                 
+  })                                                
+  
+  Exp_R = matrix(unlist(LisGLs_R_Exp),nrow=nrow(matInput),ncol=readEnd/3,T)  
+  Exp_S = matrix(unlist(LisGLs_S_Exp),nrow=nrow(matInput),ncol=readEnd/3,T)  
+  return( list( "Expected_R"=Exp_R, "Expected_S"=Exp_S) )
+  }else{
+    facGL <- factor(matInput[,2])
+    facLevels = levels(facGL)
+    LisGLs_MutabilityU = lapply(1:length(facLevels),  function(x){
+      computeMutabilities(facLevels[x])
+    })
+    facIndex = match(facGL,facLevels)
+    
+    LisGLs_Mutability = lapply(1:nrow(matInput),  function(x){
+      cInput = rep(NA,nchar(matInput[x,1]))
+      cInput[s2c(matInput[x,1])!="N"] = 1
+      LisGLs_MutabilityU[[facIndex[x]]] * cInput                                                   
+    })
+    
+    LisGLs_Targeting =  lapply(1:dim(matInput)[1],  function(x){
+      computeTargeting(matInput[x,2],LisGLs_Mutability[[x]])
+    })
+    
+    LisGLs_MutationTypes  = lapply(1:length(matInput[,2]),function(x){
+      #print(x)
+      computeMutationTypes(matInput[x,2])
+    })
+    
+    LisGLs_R_Exp = lapply(1:nrow(matInput),  function(x){
+      Exp_R <-  rollapply(as.zoo(1:readEnd),width=3,by=3,
+                          function(codonNucs){                                                      
+                            RPos = which(LisGLs_MutationTypes[[x]][,codonNucs]=="R") 
+                            sum( LisGLs_Targeting[[x]][,codonNucs][RPos], na.rm=T ) 
+                          }
+      )                                                   
+    })
+    
+    LisGLs_S_Exp = lapply(1:nrow(matInput),  function(x){
+      Exp_S <-  rollapply(as.zoo(1:readEnd),width=3,by=3,
+                          function(codonNucs){                                                      
+                            SPos = which(LisGLs_MutationTypes[[x]][,codonNucs]=="S")   
+                            sum( LisGLs_Targeting[[x]][,codonNucs][SPos], na.rm=T )
+                          }
+      )                                                 
+    })                                                
+    
+    Exp_R = matrix(unlist(LisGLs_R_Exp),nrow=nrow(matInput),ncol=readEnd/3,T)  
+    Exp_S = matrix(unlist(LisGLs_S_Exp),nrow=nrow(matInput),ncol=readEnd/3,T)  
+    return( list( "Expected_R"=Exp_R, "Expected_S"=Exp_S) )    
+  }
+}
+
+# getObservedMutationsByCodon <- function(listMutations){
+#   numbSeqs <- length(listMutations) 
+#   obsMu_R <- matrix(0,nrow=numbSeqs,ncol=readEnd/3,dimnames=list(c(1:numbSeqs),c(1:(readEnd/3))))
+#   obsMu_S <- obsMu_R
+#   temp <- mclapply(1:length(listMutations), function(i){
+#     arrMutations = listMutations[[i]]
+#     RPos = as.numeric(names(arrMutations)[arrMutations=="R"])
+#     RPos <- sapply(RPos,getCodonNumb)                                                                    
+#     if(any(RPos)){
+#       tabR <- table(RPos)
+#       obsMu_R[i,as.numeric(names(tabR))] <<- tabR
+#     }                                    
+#     
+#     SPos = as.numeric(names(arrMutations)[arrMutations=="S"])
+#     SPos <- sapply(SPos,getCodonNumb)
+#     if(any(SPos)){
+#       tabS <- table(SPos)
+#       obsMu_S[i,names(tabS)] <<- tabS
+#     }                                          
+#   }
+#   )
+#   return( list( "Observed_R"=obsMu_R, "Observed_S"=obsMu_S) ) 
+# }
+
+getObservedMutationsByCodon <- function(listMutations){
+  numbSeqs <- length(listMutations) 
+  obsMu_R <- matrix(0,nrow=numbSeqs,ncol=readEnd/3,dimnames=list(c(1:numbSeqs),c(1:(readEnd/3))))
+  obsMu_S <- obsMu_R
+  temp <- lapply(1:length(listMutations), function(i){
+    arrMutations = listMutations[[i]]
+    RPos = as.numeric(names(arrMutations)[arrMutations=="R"])
+    RPos <- sapply(RPos,getCodonNumb)                                                                    
+    if(any(RPos)){
+      tabR <- table(RPos)
+      obsMu_R[i,as.numeric(names(tabR))] <<- tabR
+    }                                    
+    
+    SPos = as.numeric(names(arrMutations)[arrMutations=="S"])
+    SPos <- sapply(SPos,getCodonNumb)
+    if(any(SPos)){
+      tabS <- table(SPos)
+      obsMu_S[i,names(tabS)] <<- tabS
+    }                                          
+  }
+  )
+  return( list( "Observed_R"=obsMu_R, "Observed_S"=obsMu_S) ) 
+}
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/baseline/Baseline_Main.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,388 @@
+#########################################################################################
+# License Agreement
+# 
+# THIS WORK IS PROVIDED UNDER THE TERMS OF THIS CREATIVE COMMONS PUBLIC LICENSE 
+# ("CCPL" OR "LICENSE"). THE WORK IS PROTECTED BY COPYRIGHT AND/OR OTHER 
+# APPLICABLE LAW. ANY USE OF THE WORK OTHER THAN AS AUTHORIZED UNDER THIS LICENSE 
+# OR COPYRIGHT LAW IS PROHIBITED.
+# 
+# BY EXERCISING ANY RIGHTS TO THE WORK PROVIDED HERE, YOU ACCEPT AND AGREE TO BE 
+# BOUND BY THE TERMS OF THIS LICENSE. TO THE EXTENT THIS LICENSE MAY BE CONSIDERED 
+# TO BE A CONTRACT, THE LICENSOR GRANTS YOU THE RIGHTS CONTAINED HERE IN 
+# CONSIDERATION OF YOUR ACCEPTANCE OF SUCH TERMS AND CONDITIONS.
+#
+# BASELIne: Bayesian Estimation of Antigen-Driven Selection in Immunoglobulin Sequences
+# Coded by: Mohamed Uduman & Gur Yaari
+# Copyright 2012 Kleinstein Lab
+# Version: 1.3 (01/23/2014)
+#########################################################################################
+
+op <- options();
+options(showWarnCalls=FALSE, showErrorCalls=FALSE, warn=-1)
+library('seqinr')
+if( F & Sys.info()[1]=="Linux"){
+  library("multicore")
+}
+
+# Load functions and initialize global variables
+source("Baseline_Functions.r")
+
+# Initialize parameters with user provided arguments
+  arg <- commandArgs(TRUE)                       
+  #arg = c(2,1,5,5,0,1,"1:26:38:55:65:104:116", "test.fasta","","sample")
+  #arg = c(1,1,5,5,0,1,"1:38:55:65:104:116:200", "test.fasta","","sample")
+  #arg = c(1,1,5,5,1,1,"1:26:38:55:65:104:116", "/home/mu37/Wu/Wu_Cloned_gapped_sequences_D-masked.fasta","/home/mu37/Wu/","Wu")
+  testID <- as.numeric(arg[1])                    # 1 = Focused, 2 = Local
+  species <- as.numeric(arg[2])                   # 1 = Human. 2 = Mouse
+  substitutionModel <- as.numeric(arg[3])         # 0 = Uniform substitution, 1 = Smith DS et al. 1996, 5 = FiveS
+  mutabilityModel <- as.numeric(arg[4])           # 0 = Uniform mutablity, 1 = Tri-nucleotide (Shapiro GS et al. 2002)  , 5 = FiveS
+  clonal <- as.numeric(arg[5])                    # 0 = Independent sequences, 1 = Clonally related, 2 = Clonally related & only non-terminal mutations
+  fixIndels <- as.numeric(arg[6])                 # 0 = Do nothing, 1 = Try and fix Indels
+  region <- as.numeric(strsplit(arg[7],":")[[1]]) # StartPos:LastNucleotideF1:C1:F2:C2:F3:C3
+  inputFilePath <- arg[8]                         # Full path to input file
+  outputPath <- arg[9]                            # Full path to location of output files
+  outputID <- arg[10]                             # ID for session output  
+  
+
+  if(testID==5){
+    traitChangeModel <- 1
+    if( !is.na(any(arg[11])) ) traitChangeModel <- as.numeric(arg[11])    # 1 <- Chothia 1998
+    initializeTraitChange(traitChangeModel)    
+  }
+  
+# Initialize other parameters/variables
+    
+  # Initialzie the codon table ( definitions of R/S )
+  computeCodonTable(testID) 
+
+  # Initialize   
+  # Test Name
+  testName<-"Focused"
+  if(testID==2) testName<-"Local"
+  if(testID==3) testName<-"Imbalanced"    
+  if(testID==4) testName<-"ImbalancedSilent"    
+    
+  # Indel placeholders initialization
+  indelPos <- NULL
+  delPos <- NULL
+  insPos <- NULL
+
+  # Initialize in Tranistion & Mutability matrixes
+  substitution <- initializeSubstitutionMatrix(substitutionModel,species)
+  mutability <- initializeMutabilityMatrix(mutabilityModel,species)
+  
+  # FWR/CDR boundaries
+  flagTrim <- F
+  if( is.na(region[7])){
+    flagTrim <- T
+    region[7]<-region[6]
+  }
+  readStart = min(region,na.rm=T)
+  readEnd = max(region,na.rm=T)
+  if(readStart>1){
+    region = region - (readStart - 1)
+  }
+  region_Nuc = c( (region[1]*3-2) , (region[2:7]*3) )
+  region_Cod = region
+  
+  readStart = (readStart*3)-2
+  readEnd = (readEnd*3)
+    
+    FWR_Nuc <- c( rep(TRUE,(region_Nuc[2])),
+                  rep(FALSE,(region_Nuc[3]-region_Nuc[2])),
+                  rep(TRUE,(region_Nuc[4]-region_Nuc[3])),
+                  rep(FALSE,(region_Nuc[5]-region_Nuc[4])),
+                  rep(TRUE,(region_Nuc[6]-region_Nuc[5])),
+                  rep(FALSE,(region_Nuc[7]-region_Nuc[6]))
+                )
+    CDR_Nuc <- (1-FWR_Nuc)
+    CDR_Nuc <- as.logical(CDR_Nuc)
+    FWR_Nuc_Mat <- matrix( rep(FWR_Nuc,4), ncol=length(FWR_Nuc), nrow=4, byrow=T)
+    CDR_Nuc_Mat <- matrix( rep(CDR_Nuc,4), ncol=length(CDR_Nuc), nrow=4, byrow=T)
+    
+    FWR_Codon <- c( rep(TRUE,(region[2])),
+                  rep(FALSE,(region[3]-region[2])),
+                  rep(TRUE,(region[4]-region[3])),
+                  rep(FALSE,(region[5]-region[4])),
+                  rep(TRUE,(region[6]-region[5])),
+                  rep(FALSE,(region[7]-region[6]))
+                )
+    CDR_Codon <- (1-FWR_Codon)
+    CDR_Codon <- as.logical(CDR_Codon)
+
+
+# Read input FASTA file
+  tryCatch(
+    inputFASTA <- baseline.read.fasta(inputFilePath, seqtype="DNA",as.string=T,set.attributes=F,forceDNAtolower=F)
+    , error = function(ex){
+      cat("Error|Error reading input. Please enter or upload a valid FASTA file.\n")
+      q()
+    }
+  )
+  
+  if (length(inputFASTA)==1) {
+    cat("Error|Error reading input. Please enter or upload a valid FASTA file.\n")
+    q()
+  }
+
+  # Process sequence IDs/names
+  names(inputFASTA) <- sapply(names(inputFASTA),function(x){trim(x)})
+  
+  # Convert non nucleotide characters to N
+  inputFASTA[length(inputFASTA)] = gsub("\t","",inputFASTA[length(inputFASTA)])
+  inputFASTA <- lapply(inputFASTA,replaceNonFASTAChars)
+
+  # Process the FASTA file and conver to Matrix[inputSequence, germlineSequence]
+  processedInput <- processInputAdvanced(inputFASTA)
+  matInput <- processedInput[[1]]
+  germlines <- processedInput[[2]]
+  lenGermlines = length(unique(germlines))
+  groups <- processedInput[[3]]
+  lenGroups = length(unique(groups))
+  rm(processedInput)
+  rm(inputFASTA)
+
+#   # remove clones with less than 2 seqeunces
+#   tableGL <- table(germlines)
+#   singletons <- which(tableGL<8)
+#   rowsToRemove <- match(singletons,germlines)
+#   if(any(rowsToRemove)){    
+#     matInput <- matInput[-rowsToRemove,]
+#     germlines <- germlines[-rowsToRemove]    
+#     groups <- groups[-rowsToRemove]
+#   }
+# 
+#   # remove unproductive seqs
+#   nonFuctionalSeqs <- sapply(rownames(matInput),function(x){any(grep("unproductive",x))})
+#   if(any(nonFuctionalSeqs)){
+#     if(sum(nonFuctionalSeqs)==length(germlines)){
+#       write.table("Unproductive",file=paste(outputPath,outputID,".txt",sep=""),quote=F,sep="\t",row.names=F,col.names=T)
+#       q()      
+#     }
+#     matInput <- matInput[-which(nonFuctionalSeqs),]
+#     germlines <- germlines[-which(nonFuctionalSeqs)]
+#     germlines[1:length(germlines)] <- 1:length(germlines)
+#     groups <- groups[-which(nonFuctionalSeqs)]
+#   }
+# 
+#   if(class(matInput)=="character"){
+#     write.table("All unproductive seqs",file=paste(outputPath,outputID,".txt",sep=""),quote=F,sep="\t",row.names=F,col.names=T)
+#     q()    
+#   }
+#   
+#   if(nrow(matInput)<10 | is.null(nrow(matInput))){
+#     write.table(paste(nrow(matInput), "seqs only",sep=""),file=paste(outputPath,outputID,".txt",sep=""),quote=F,sep="\t",row.names=F,col.names=T)
+#     q()
+#   }
+
+# replace leading & trailing "-" with "N:
+  matInput <- t(apply(matInput,1,replaceLeadingTrailingDashes,readEnd))
+    
+  # Trim (nucleotide) input sequences to the last codon
+  #matInput[,1] <- apply(matrix(matInput[,1]),1,trimToLastCodon) 
+
+#   # Check for Indels
+#   if(fixIndels){
+#     delPos <- fixDeletions(matInput)
+#     insPos <- fixInsertions(matInput)
+#   }else{
+#     # Check for indels
+#     indelPos <- checkForInDels(matInput)
+#     indelPos <- apply(cbind(indelPos[[1]],indelPos[[2]]),1,function(x){(x[1]==T & x[2]==T)})
+#   }
+  
+  # If indels are present, remove mutations in the seqeunce & throw warning at end
+  #matInput[indelPos,] <- apply(matrix(matInput[indelPos,],nrow=sum(indelPos),ncol=2),1,function(x){x[1]=x[2]; return(x) })
+  
+  colnames(matInput)=c("Input","Germline")
+
+  # If seqeunces are clonal, create effective sequence for each clone & modify germline/group definitions
+  germlinesOriginal = NULL
+  if(clonal){
+    germlinesOriginal <- germlines
+    collapseCloneResults <- tapply(1:nrow(matInput),germlines,function(i){
+                                                                collapseClone(matInput[i,1],matInput[i[1],2],readEnd,nonTerminalOnly=(clonal-1))
+                                                              })
+    matInput = t(sapply(collapseCloneResults,function(x){return(x[[1]])}))
+    names_groups = tapply(groups,germlines,function(x){names(x[1])})  
+    groups = tapply(groups,germlines,function(x){array(x[1],dimnames=names(x[1]))})  
+    names(groups) = names_groups
+  
+    names_germlines =  tapply(germlines,germlines,function(x){names(x[1])})  
+    germlines = tapply(   germlines,germlines,function(x){array(x[1],dimnames=names(x[1]))}   )
+    names(germlines) = names_germlines
+    matInputErrors = sapply(collapseCloneResults,function(x){return(x[[2]])})  
+  }
+
+
+# Selection Analysis
+
+  
+#  if (length(germlines)>sequenceLimit) {
+#    # Code to parallelize processing goes here
+#    stop( paste("Error: Cannot process more than ", Upper_limit," sequences",sep="") )
+#  }
+
+#  if (length(germlines)<sequenceLimit) {}
+  
+    # Compute expected mutation frequencies
+    matExpected <- getExpectedIndividual(matInput)
+    
+    # Count observed number of mutations in the different regions
+    mutations <- lapply( 1:nrow(matInput),  function(i){
+                                              #cat(i,"\n")
+                                              seqI = s2c(matInput[i,1])
+                                              seqG = s2c(matInput[i,2])
+                                              matIGL = matrix(c(seqI,seqG),ncol=length(seqI),nrow=2,byrow=T)    
+                                              retVal <- NA
+                                              tryCatch(
+                                                retVal <- analyzeMutations2NucUri(matIGL)
+                                                , error = function(ex){
+                                                  retVal <- NA
+                                                }
+                                              )                                              
+                                              
+                                              
+                                              return( retVal )
+                                            })
+
+    matObserved <- t(sapply( mutations, processNucMutations2 ))
+    numberOfSeqsWithMutations <- numberOfSeqsWithMutations(matObserved, testID)
+
+    #if(sum(numberOfSeqsWithMutations)==0){
+    #  write.table("No mutated sequences",file=paste(outputPath,outputID,".txt",sep=""),quote=F,sep="\t",row.names=F,col.names=T)
+    #  q()      
+    #}
+    
+    matMutationInfo <- cbind(matObserved,matExpected)
+    rm(matObserved,matExpected)
+    
+     
+    #Bayesian  PDFs
+    bayes_pdf = computeBayesianScore(matMutationInfo, test=testName, max_sigma=20,length_sigma=4001)
+    bayesPDF_cdr = bayes_pdf[[1]]
+    bayesPDF_fwr = bayes_pdf[[2]]    
+    rm(bayes_pdf)
+
+    bayesPDF_germlines_cdr = tapply(bayesPDF_cdr,germlines,function(x) groupPosteriors(x,length_sigma=4001))
+    bayesPDF_germlines_fwr = tapply(bayesPDF_fwr,germlines,function(x) groupPosteriors(x,length_sigma=4001))
+    
+    bayesPDF_groups_cdr = tapply(bayesPDF_cdr,groups,function(x) groupPosteriors(x,length_sigma=4001))
+    bayesPDF_groups_fwr = tapply(bayesPDF_fwr,groups,function(x) groupPosteriors(x,length_sigma=4001))
+    
+    if(lenGroups>1){
+      groups <- c(groups,lenGroups+1)
+      names(groups)[length(groups)] = "All sequences combined"
+      bayesPDF_groups_cdr[[lenGroups+1]] =   groupPosteriors(bayesPDF_groups_cdr,length_sigma=4001)
+      bayesPDF_groups_fwr[[lenGroups+1]] =   groupPosteriors(bayesPDF_groups_fwr,length_sigma=4001)
+    }
+    
+    #Bayesian  Outputs
+    bayes_cdr =  t(sapply(bayesPDF_cdr,calcBayesOutputInfo))
+    bayes_fwr =  t(sapply(bayesPDF_fwr,calcBayesOutputInfo))
+    bayes_germlines_cdr =  t(sapply(bayesPDF_germlines_cdr,calcBayesOutputInfo))
+    bayes_germlines_fwr =  t(sapply(bayesPDF_germlines_fwr,calcBayesOutputInfo))
+    bayes_groups_cdr =  t(sapply(bayesPDF_groups_cdr,calcBayesOutputInfo))
+    bayes_groups_fwr =  t(sapply(bayesPDF_groups_fwr,calcBayesOutputInfo))
+    
+    #P-values
+    simgaP_cdr = sapply(bayesPDF_cdr,computeSigmaP)
+    simgaP_fwr = sapply(bayesPDF_fwr,computeSigmaP)
+    
+    simgaP_germlines_cdr = sapply(bayesPDF_germlines_cdr,computeSigmaP)
+    simgaP_germlines_fwr = sapply(bayesPDF_germlines_fwr,computeSigmaP)
+    
+    simgaP_groups_cdr = sapply(bayesPDF_groups_cdr,computeSigmaP)
+    simgaP_groups_fwr = sapply(bayesPDF_groups_fwr,computeSigmaP)
+    
+    
+    #Format output
+    
+    # Round expected mutation frequencies to 3 decimal places
+    matMutationInfo[germlinesOriginal[indelPos],] = NA
+    if(nrow(matMutationInfo)==1){
+      matMutationInfo[5:8] = round(matMutationInfo[,5:8]/sum(matMutationInfo[,5:8],na.rm=T),3)
+    }else{
+      matMutationInfo[,5:8] = t(round(apply(matMutationInfo[,5:8],1,function(x){ return(x/sum(x,na.rm=T)) }),3))
+    }
+    
+    listPDFs = list()
+    nRows = length(unique(groups)) + length(unique(germlines)) + length(groups)
+    
+    matOutput = matrix(NA,ncol=18,nrow=nRows)
+    rowNumb = 1
+    for(G in unique(groups)){
+      #print(G)
+      matOutput[rowNumb,c(1,2,11:18)] = c("Group",names(groups)[groups==G][1],bayes_groups_cdr[G,],bayes_groups_fwr[G,],simgaP_groups_cdr[G],simgaP_groups_fwr[G])
+      listPDFs[[rowNumb]] = list("CDR"=bayesPDF_groups_cdr[[G]],"FWR"=bayesPDF_groups_fwr[[G]])
+      names(listPDFs)[rowNumb] = names(groups[groups==paste(G)])[1]
+      #if(names(groups)[which(groups==G)[1]]!="All sequences combined"){
+      gs = unique(germlines[groups==G])
+      rowNumb = rowNumb+1
+      if( !is.na(gs) ){
+        for( g in gs ){
+          matOutput[rowNumb,c(1,2,11:18)] = c("Germline",names(germlines)[germlines==g][1],bayes_germlines_cdr[g,],bayes_germlines_fwr[g,],simgaP_germlines_cdr[g],simgaP_germlines_fwr[g])
+          listPDFs[[rowNumb]] = list("CDR"=bayesPDF_germlines_cdr[[g]],"FWR"=bayesPDF_germlines_fwr[[g]])
+          names(listPDFs)[rowNumb] = names(germlines[germlines==paste(g)])[1]
+          rowNumb = rowNumb+1
+          indexesOfInterest = which(germlines==g)
+          numbSeqsOfInterest =  length(indexesOfInterest)
+          rowNumb = seq(rowNumb,rowNumb+(numbSeqsOfInterest-1))
+          matOutput[rowNumb,] = matrix(   c(  rep("Sequence",numbSeqsOfInterest),
+                                              rownames(matInput)[indexesOfInterest],
+                                              c(matMutationInfo[indexesOfInterest,1:4]),
+                                              c(matMutationInfo[indexesOfInterest,5:8]),
+                                              c(bayes_cdr[indexesOfInterest,]),
+                                              c(bayes_fwr[indexesOfInterest,]),
+                                              c(simgaP_cdr[indexesOfInterest]),
+                                              c(simgaP_fwr[indexesOfInterest])                                              
+          ), ncol=18, nrow=numbSeqsOfInterest,byrow=F)
+          increment=0
+          for( ioi in indexesOfInterest){
+            listPDFs[[min(rowNumb)+increment]] =  list("CDR"=bayesPDF_cdr[[ioi]] , "FWR"=bayesPDF_fwr[[ioi]])
+            names(listPDFs)[min(rowNumb)+increment] = rownames(matInput)[ioi]
+            increment = increment + 1
+          }
+          rowNumb=max(rowNumb)+1
+
+        }
+      }
+    }
+    colsToFormat = 11:18
+    matOutput[,colsToFormat] = formatC(  matrix(as.numeric(matOutput[,colsToFormat]), nrow=nrow(matOutput), ncol=length(colsToFormat)) ,  digits=3)
+    matOutput[matOutput== " NaN"] = NA
+    
+    
+    
+    colnames(matOutput) = c("Type", "ID", "Observed_CDR_R", "Observed_CDR_S", "Observed_FWR_R", "Observed_FWR_S",
+                            "Expected_CDR_R", "Expected_CDR_S", "Expected_FWR_R", "Expected_FWR_S",
+                            paste( rep(testName,6), rep(c("Sigma","CIlower","CIupper"),2),rep(c("CDR","FWR"),each=3), sep="_"),
+                            paste( rep(testName,2), rep("P",2),c("CDR","FWR"), sep="_")
+    )
+    fileName = paste(outputPath,outputID,".txt",sep="")
+    write.table(matOutput,file=fileName,quote=F,sep="\t",row.names=T,col.names=NA)
+    fileName = paste(outputPath,outputID,".RData",sep="")
+    save(listPDFs,file=fileName)
+
+indelWarning = FALSE
+if(sum(indelPos)>0){
+  indelWarning = "<P>Warning: The following sequences have either gaps and/or deletions, and have been ommited from the analysis.";
+  indelWarning = paste( indelWarning , "<UL>", sep="" )
+  for(indels in names(indelPos)[indelPos]){
+    indelWarning = paste( indelWarning , "<LI>", indels, "</LI>", sep="" )
+  }
+  indelWarning = paste( indelWarning , "</UL></P>", sep="" )
+}
+
+cloneWarning = FALSE
+if(clonal==1){
+  if(sum(matInputErrors)>0){
+    cloneWarning = "<P>Warning: The following clones have sequences of unequal length.";
+    cloneWarning = paste( cloneWarning , "<UL>", sep="" )
+    for(clone in names(matInputErrors)[matInputErrors]){
+      cloneWarning = paste( cloneWarning , "<LI>", names(germlines)[as.numeric(clone)], "</LI>", sep="" )
+    }
+    cloneWarning = paste( cloneWarning , "</UL></P>", sep="" )
+  }
+}
+cat(paste("Success",outputID,indelWarning,cloneWarning,sep="|"))
Binary file baseline/FiveS_Mutability.RData has changed
Binary file baseline/FiveS_Substitution.RData has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/baseline/IMGT-reference-seqs-IGHV-2015-11-05.fa	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,703 @@
+>IGHV1-18*01
+caggttcagctggtgcagtctggagct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacaccttt............accagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttac......aatggtaacacaaactatgcacagaagctccag...ggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
+>IGHV1-18*02
+caggttcagctggtgcagtctggagct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacaccttt............accagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttac......aatggtaacacaaactatgcacagaagctccag...ggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctaagatctgacgacacggcc
+>IGHV1-18*03
+caggttcagctggtgcagtctggagct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacaccttt............accagctatggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttac......aatggtaacacaaactatgcacagaagctccag...ggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacatggccgtgtattactgtgcgagaga
+>IGHV1-18*04
+caggttcagctggtgcagtctggagct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggttacaccttt............accagctacggtatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcagcgcttac......aatggtaacacaaactatgcacagaagctccag...ggcagagtcaccatgaccacagacacatccacgagcacagcctacatggagctgaggagcctgagatctgacgacacggccgtgtattactgtgcgagaga
+>IGHV1-2*01
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttc............accggctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggacggatcaaccctaac......agtggtggcacaaactatgcacagaagtttcag...ggcagggtcaccagtaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggtcgtgtattactgtgcgagaga
+>IGHV1-2*02
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttc............accggctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaaccctaac......agtggtggcacaaactatgcacagaagtttcag...ggcagggtcaccatgaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggccgtgtattactgtgcgagaga
+>IGHV1-2*03
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcttggggcctcagtgaaggtctcctgcaaggcttctggatacaccttc............accggctactatatgcactgggtgcnacaggcccctggacaagggcttgagtggatgggatggatcaaccctaac......agtggtggcacaaactatgcacagaagtttcag...ggcagggtcaccatgaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggccgtgtattactgtgcgagaga
+>IGHV1-2*04
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttc............accggctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaaccctaac......agtggtggcacaaactatgcacagaagtttcag...ggctgggtcaccatgaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggccgtgtattactgtgcgagaga
+>IGHV1-2*05
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttc............accggctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggacggatcaaccctaac......agtggtggcacaaactatgcacagaagtttcag...ggcagggtcaccatgaccagggacacgtccatcagcacagcctacatggagctgagcaggctgagatctgacgacacggtcgtgtattactgtgcgagaga
+>IGHV1-24*01
+caggtccagctggtacagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggtttccggatacaccctc............actgaattatccatgcactgggtgcgacaggctcctggaaaagggcttgagtggatgggaggttttgatcctgaa......gatggtgaaacaatctacgcacagaagttccag...ggcagagtcaccatgaccgaggacacatctacagacacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcaacaga
+>IGHV1-3*01
+caggtccagcttgtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtttcctgcaaggcttctggatacaccttc............actagctatgctatgcattgggtgcgccaggcccccggacaaaggcttgagtggatgggatggatcaacgctggc......aatggtaacacaaaatattcacagaagttccag...ggcagagtcaccattaccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaagacacggctgtgtattactgtgcgagaga
+>IGHV1-3*02
+caggttcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtttcctgcaaggcttctggatacaccttc............actagctatgctatgcattgggtgcgccaggcccccggacaaaggcttgagtggatgggatggagcaacgctggc......aatggtaacacaaaatattcacaggagttccag...ggcagagtcaccattaccagggacacatccgcgagcacagcctacatggagctgagcagcctgagatctgaggacatggctgtgtattactgtgcgagaga
+>IGHV1-38-4*01
+caggtccagctggtgcagtcttgggct...gaggtgaggaagtctggggcctcagtgaaagtctcctgtagtttttctgggtttaccatc............accagctacggtatacattgggtgcaacagtcccctggacaagggcttgagtggatgggatggatcaaccctggc......aatggtagcccaagctatgccaagaagtttcag...ggcagattcaccatgaccagggacatgtccacaaccacagcctacacagacctgagcagcctgacatctgaggacatggctgtgtattactatgcaagaca
+>IGHV1-45*01
+cagatgcagctggtgcagtctggggct...gaggtgaagaagactgggtcctcagtgaaggtttcctgcaaggcttccggatacaccttc............acctaccgctacctgcactgggtgcgacaggcccccggacaagcgcttgagtggatgggatggatcacacctttc......aatggtaacaccaactacgcacagaaattccag...gacagagtcaccattactagggacaggtctatgagcacagcctacatggagctgagcagcctgagatctgaggacacagccatgtattactgtgcaagana
+>IGHV1-45*02
+cagatgcagctggtgcagtctggggct...gaggtgaagaagactgggtcctcagtgaaggtttcctgcaaggcttccggatacaccttc............acctaccgctacctgcactgggtgcgacaggcccccggacaagcgcttgagtggatgggatggatcacacctttc......aatggtaacaccaactacgcacagaaattccag...gacagagtcaccattaccagggacaggtctatgagcacagcctacatggagctgagcagcctgagatctgaggacacagccatgtattactgtgcaagata
+>IGHV1-45*03
+.....................................agaagactgggtcctcagtgaaggtttcctgcaaggcttccggatacaccttc............acctaccgctacctgcactgggtgcgacaggcccccagacaagcgcttgagtggatgggatggatcacacctttc......aatggtaacaccaactacgcacagaaattccag...gacagagtcaccattaccagggacaggtctatgagcacagcctacatggagctgagcagcctgagatctgaggacacagccatgtattactgtgcaaga
+>IGHV1-46*01
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtttcctgcaaggcatctggatacaccttc............accagctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggaataatcaaccctagt......ggtggtagcacaagctacgcacagaagttccag...ggcagagtcaccatgaccagggacacgtccacgagcacagtctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-46*02
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtttcctgcaaggcatctggatacaccttc............aacagctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggaataatcaaccctagt......ggtggtagcacaagctacgcacagaagttccag...ggcagagtcaccatgaccagggacacgtccacgagcacagtctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-46*03
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtttcctgcaaggcatctggatacaccttc............accagctactatatgcactgggtgcgacaggcccctggacaagggcttgagtggatgggaataatcaaccctagt......ggtggtagcacaagctacgcacagaagttccag...ggcagagtcaccatgaccagggacacgtccacgagcacagtctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgctagaga
+>IGHV1-58*01
+caaatgcagctggtgcagtctgggcct...gaggtgaagaagcctgggacctcagtgaaggtctcctgcaaggcttctggattcaccttt............actagctctgctgtgcagtgggtgcgacaggctcgtggacaacgccttgagtggataggatggatcgtcgttggc......agtggtaacacaaactacgcacagaagttccag...gaaagagtcaccattaccagggacatgtccacaagcacagcctacatggagctgagcagcctgagatccgaggacacggccgtgtattactgtgcggcaga
+>IGHV1-58*02
+caaatgcagctggtgcagtctgggcct...gaggtgaagaagcctgggacctcagtgaaggtctcctgcaaggcttctggattcaccttt............actagctctgctatgcagtgggtgcgacaggctcgtggacaacgccttgagtggataggatggatcgtcgttggc......agtggtaacacaaactacgcacagaagttccag...gaaagagtcaccattaccagggacatgtccacaagcacagcctacatggagctgagcagcctgagatccgaggacacggccgtgtattactgtgcggcaga
+>IGHV1-68*01
+caggtgcagctggggcagtctgaggct...gaggtaaagaagcctggggcctcagtgaaggtctcctgcaaggcttccggatacaccttc............acttgctgctccttgcactggttgcaacaggcccctggacaagggcttgaaaggatgagatggatcacactttac......aatggtaacaccaactatgcaaagaagttccag...ggcagagtcaccattaccagggacatgtccctgaggacagcctacatagagctgagcagcctgagatctgaggactcggctgtgtattactgggcaagata
+>IGHV1-69*01
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc......tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*02
+caggtccagctggtgcaatctggggct...gaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatactatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatc......cttggtatagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgaga
+>IGHV1-69*03
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc......tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgatgacacggc
+>IGHV1-69*04
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatc......cttggtatagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*05
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc......tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccacggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgaga
+>IGHV1-69*06
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc......tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*07
+.....................................agaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatc......tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgag
+>IGHV1-69*08
+caggtccagctggtgcaatctggggct...gaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatactatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatc......cttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*09
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatc......cttggtatagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*10
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcagtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc......cttggtatagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*11
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggaaggatcatccctatc......cttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*12
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc......tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*13
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcagtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc......tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69*14
+caggtccagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc......tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacaaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-69-2*01
+gaggtccagctggtacagtctggggct...gaggtgaagaagcctggggctacagtgaaaatctcctgcaaggtttctggatacaccttc............accgactactacatgcactgggtgcaacaggcccctggaaaagggcttgagtggatgggacttgttgatcctgaa......gatggtgaaacaatatacgcagagaagttccag...ggcagagtcaccataaccgcggacacgtctacagacacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcaacaga
+>IGHV1-69-2*02
+.....................................agaagcctggggctacagtgaaaatctcctgcaaggtttctggatacaccttc............accgactactacatgcactgggtgcaacaggcccctggaaaagggcttgagtggatgggacttgttgatcctgaa......gatggtgaaacaatatatgcagagaagttccag...ggcagagtcaccataaccgcggacacgtctacagacacagcctacatggagctgagcagcctgagatctgag
+>IGHV1-69D*01
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctgggtcctcggtgaaggtctcctgcaaggcttctggaggcaccttc............agcagctatgctatcagctgggtgcgacaggcccctggacaagggcttgagtggatgggagggatcatccctatc......tttggtacagcaaactacgcacagaagttccag...ggcagagtcacgattaccgcggacgaatccacgagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1-8*01
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttc............accagttatgatatcaactgggtgcgacaggccactggacaagggcttgagtggatgggatggatgaaccctaac......agtggtaacacaggctatgcacagaagttccag...ggcagagtcaccatgaccaggaacacctccataagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagagg
+>IGHV1-8*02
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttc............accagctatgatatcaactgggtgcgacaggccactggacaagggcttgagtggatgggatggatgaaccctaac......agtggtaacacaggctatgcacagaagttccag...ggcagagtcaccatgaccaggaacacctccataagcacagcctacatggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagagg
+>IGHV1-NL1*01
+caggttcagctgttgcagcctggggtc...caggtgaagaagcctgggtcctcagtgaaggtctcctgctaggcttccagatacaccttc............accaaatactttacacggtgggtgtgacaaagccctggacaagggcatnagtggatgggatgaatcaacccttac......aacgataacacacactacgcacagacgttctgg...ggcagagtcaccattaccagtgacaggtccatgagcacagcctacatggagctgagcngcctgagatccgaagacatggtcgtgtattactgtgtgagaga
+>IGHV1/OR15-1*01
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacatcttc............accgactactatatgcactgggtgcgacaggcccctggacaagagcttgggtggatgggacggatcaaccctaac......agtggtggcacaaactatgcacagaagtttcag...ggcagagtcaccatgaccagggacacgtccatcagcacagcctacacggagctgagcagcctgagatctgaggacacggccacgtattactgtgcgaga
+>IGHV1/OR15-1*02
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacatcttc............accgactactatatgcactgggtgcgacaggcccctggacaagagcttgggtggatgggacggatcaaccctaac......agtggtggcacaaactatgcacagaagtttcag...ggcagagtcaccatgaccagggacacgtccatcagcacagcctgcacggagctgagcagcctgagatctgaggacacggccacgtattactgtgcgagaga
+>IGHV1/OR15-1*03
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacatcttc............accgactactatatgcactgggtgcgacaggcccctggacaagagcttgggtggatgggacggatcaaccctaac......agtggtggcacaaactatgcacagaagtttcag...ggcagagtcaccatgaccagggacacgtccatcagcacagcctacacggagctgagcagcctgagatctgaggacacagccacgtattactgtgcgagaga
+>IGHV1/OR15-1*04
+caggtgcagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacatcttc............accgactactatatgcactgggtgcgacaggcccctggacaagagcttgggtggatgggacggatcaaccctaac......agtggtggcacaaactatgcacagaagtttcag...ggcagagtcaccatgaccagggacacgtccatcagcacagcctacatggagctgagcagcctgagatctgaggacacggccacgtattactgtgcgagaga
+>IGHV1/OR15-2*01
+caggtgcagctggtgcagtctggagct...gaggtgaagaagcctagagcctcagtgaaggtctcctgcaaggcttctggttacaccttt............accagctactatatgcactgggtgtgacaggcccctgaacaagggcttgagtggatgggatggatcaacacttac......aatggtaacacaaactacccacagaagctccag...ggcagagtcaccatgaccagagacacatccacgagcacagcctacatggagctgagcaggctgagatctgacgacatggccgtgtattactgtgcgagaga
+>IGHV1/OR15-2*02
+caggtgcagctggtgcagtctggagct...gaggtgaagaagcctggagcctcagtgaaggtctcctgcaaggcttctggttacaccttt............accagctactatatgcactgggtgtgacaggcccctgaacaagggcttgagtggatgggatggatcaacacttac......aatggtaacacaaactacccacagaagctccag...ggcagagtcaccatgaccagagacacatccacgagcacagcctacatggagctgagcagcctgagatctgacgacatggccgtgtattactgtgcgagaga
+>IGHV1/OR15-2*03
+caggtgcagctggtgcagtctggagct...gaggtgaagaagcctagagcctcagtgaaggtctcctgcaaggcttctggttacaccttt............accagctactatatgcactgggtgtgacaggcccctgaacaagggcttgagtggatgggatggatcaacacttac......aatggtaacacaaactacccacagaagctccag...ggcagagtcaccatgaccagagacacatccacgagcacagcctacatggagctgagcagcctgagatctgacgacatggccgtgtattactgtgcgagaga
+>IGHV1/OR15-3*01
+caggtccaactggtgtagtctggagct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttc............accgactactttatgaactggatgcgccaggcccctggacaaaggcttgagtggatgggatggatcaacgctggc......aatggtaacacaaaatattcacagaagctccag...ggcagagtcaccattaccagggacacatcttcgagcacagcctacatgcagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgaga
+>IGHV1/OR15-3*02
+caggtccaactggtgtagtctggagct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttc............accgactactttatgaactggatgcgccaggcccctggacaaaggcttgagtggatgggatggatcaacgctggc......aatggtaacacaaaatattcacagaagctccag...ggcagagtcaccattaccagggacacatctgcgagcacagcctacatgcagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgagaga
+>IGHV1/OR15-3*03
+caggtccaactggtgtagtctggagct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttc............accagctactatatgaactggatgcgccaggcccctggacaaggcttcgagtggatgggatggatcaacgctggc......aatggtaacacaaagtattcacagaagctccag...ggcagagtcaccattaccagggacacatctgcgagcacagcctacatgcagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgaga
+>IGHV1/OR15-4*01
+caggaccagttggtgcagtctggggct...gaggtgaagaagcctctgtcctcagtgaaggtctccttcaaggcttctggatacaccttc............accaacaactttatgcactgggtgtgacaggcccctggacaaggacttgagtggatgggatggatcaatgctggc......aatggtaacacaacatatgcacagaagttccag...ggcagagtcaccataaccagggacacgtccatgagcacagcctacacggagctgagcagcctgagatctgaggacacggccgtgtattactgtgcgaga
+>IGHV1/OR15-5*01
+.....................................agaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttc............accagctactgtatgcactgggtgcaccaggtccatgcacaagggcttgagtggatgggattggtgtgccctagt......gatggcagcacaagctatgcacagaagttccag...gccagagtcaccataaccagggacacatccatgagcacagcctacatggagctaagcagtctgagatctgaggacacggccatgtattactgtgtgaga
+>IGHV1/OR15-5*02
+caggtacagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccttc............accaactactgtatgcactgggtgcgccaggtccatgcacaagggcttgagtggatgggattggtgtgccctagt......gatggcagcacaagctatgcacaaaagttccag...gccagagtcaccataaccagggacacatccatgagcacagcctacatggagctaagcagtctgagatctgaggacacggccatgtattactgtgtgaga
+>IGHV1/OR15-9*01
+caggtacagctgatgcagtctggggct...gaggtgaagaagcctggggcctcagtgaggatctcctgcaaggcttctggatacaccttc............accagctactgtatgcactgggtgtgccaggcccatgcacaagggcttgagtggatgggattggtgtgccctagt......gatggcagcacaagctatgcacagaagttccag...ggcagagtcaccataaccagggacacatccatgggcacagcctacatggagctaagcagcctgagatctgaggacacggccatgtattactgtgtgagaga
+>IGHV1/OR21-1*01
+caggtacagctggtgcagtctggggct...gaggtgaagaagcctggggcctcagtgaaggtctcctgcaaggcttctggatacaccatc............accagctactgtatgcactgggtgcaccaggtccatgcacaagggcttgagtggatgggattggtgtgccctagt......gatggcagcacaagctatgcacagaagttccag...gccagagtcaccataaccagggacacatccatgagcacagcctacatggagctaagcagtctgagatctgaggacacggccatgtattactgtgtgagaga
+>IGHV2-10*01
+caggtcaccttgaaggagtctggtcct...gcactggtgaaacccacacagaccctcatgctgacctgcaccttctctgggttctcactcagc......acttctggaatgggtgtgggttagatctgtcagccctcagcaaaggccctggagtggcttgcacacatttattagaat.........gataataaatactacagcccatctctgaag...agtaggctcattatctccaaggacacctccaagaatgaagtggttctaacagtgatcaacatggacattgtggacacagccacacattactgtgcaaggagac
+>IGHV2-26*01
+caggtcaccttgaaggagtctggtcct...gtgctggtgaaacccacagagaccctcacgctgacctgcaccgtctctgggttctcactcagc......aatgctagaatgggtgtgagctggatccgtcagcccccagggaaggccctggagtggcttgcacacattttttcgaat.........gacgaaaaatcctacagcacatctctgaag...agcaggctcaccatctccaaggacacctccaaaagccaggtggtccttaccatgaccaacatggaccctgtggacacagccacatattactgtgcacggatac
+>IGHV2-5*01
+cagatcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacgctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggctggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattggaat.........gatgataagcgctacagcccatctctgaag...agcaggctcaccatcaccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacatattactgtgcacacagac
+>IGHV2-5*02
+cagatcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacgctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggctggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattgggat.........gatgataagcgctacagcccatctctgaag...agcaggctcaccatcaccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacatattactgtgcacacagac
+>IGHV2-5*03
+................................gctggtgaaacccacacagaccctcacgctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggctggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattgggat.........gatgataagcgctacagcccatctctgaag...agcaggctcaccattaccaaggacacctccaaaaaccaggt
+>IGHV2-5*04|
+cagatcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacgctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggctggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattggaat.........gatgataagcgctacagcccatctctgaag...agcaggctcaccatcaccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacaggcacatattactgtgtac
+>IGHV2-5*05
+cagatcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacgctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggctggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattgggat.........gatgataagcgctacggcccatctctgaag...agcaggctcaccatcaccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacatattactgtgcacacagac
+>IGHV2-5*06
+cagatcaccttgaaggagtctggtcct...acgctggtaaaacccacacagaccctcacgctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggctggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattgggat.........gatgataagcgctacggcccatctctgaag...agcaggctcaccatcaccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacatattactgtgcacacaga
+>IGHV2-5*08
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagctggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattgggat.........gatgataagcgctacagcccatctctgaag...agcaggctcaccatcaccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacatattactgtgcacacagac
+>IGHV2-5*09
+caggtcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacgctgacctgcaccttctctgggttctcactcagc......actagtggagtgggtgtgggctggatccgtcagcccccaggaaaggccctggagtggcttgcactcatttattgggat.........gatgataagcgctacggcccatctctgaag...agcaggctcaccatcaccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacatattactgtgcacacagac
+>IGHV2-70*01
+caggtcaccttgagggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagctggatccgtcagcccccagggaaggccctggagtggcttgcactcattgattgggat.........gatgataaatactacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacgtattactgtgcacggatac
+>IGHV2-70*02
+caggtcaccttgagggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagctggatccgtcagcccccagggaaggccctggagtggcttgcactcattgattgggat.........gatgataaatactacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacggccgtgtattactg
+>IGHV2-70*03
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagctggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat.........gatgataaattctacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacggccgtgtattactg
+>IGHV2-70*04
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagctggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat.........gatgataaattctacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacgtattac
+>IGHV2-70*05
+..........................t...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgcgagctggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat.........gatgataaattctacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatgga
+>IGHV2-70*06
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagctggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat.........gatgataaattctacagcacatccctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacggccgtgtattactg
+>IGHV2-70*07
+caggtcaccttgagggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagctggatccgtcagcccccggggaaggccctggagtggcttgcactcattgattgggat.........gatgataaatactacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacggccgtgtattactg
+>IGHV2-70*08
+caggtcaccttgagggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcgccttctctgggttctcactcagc......actagtggaatgtgtgtgagctggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat.........gatgataaatactacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacggccgtgtattactg
+>IGHV2-70*09
+cagatcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacgctgacccgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagctggatccgtcagcccccagggaaggccctggagtggcttgcactcattgattgggat.........gatgataaatactacagcacatctctgaac...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacaggcacatattactgtgtacgg
+>IGHV2-70*10
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagctggatccgtcagcccccagggaaggccctggagtggattgcacgcattgattgggat.........gatgataaatactacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacgtattactgtgcacggatac
+>IGHV2-70*11
+cgggtcaccttgagggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagctggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat.........gatgataaatactacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacgtattactgtgcacggatac
+>IGHV2-70*12
+cagatcaccttgaaggagtctggtcct...acgctggtgaaacccacacagaccctcacgctgacctgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagctggatccgtcagcccccagggaaggccctggagtggcttgcactcattgattgggat.........gatgataaatactacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacatattactgtgcacacagac
+>IGHV2-70*13
+caggtcaccttgagggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgtgtgtgagctggatccgtcagcccccagggaaggccctggagtggcttgcactcattgattgggat.........gatgataaatactacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacgtattattgtgcacggatac
+>IGHV2-70D*04
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagctggatccgtcagcccccagggaaggccctggagtggcttgcacgcattgattgggat.........gatgataaattctacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacgtattactgtgcacggatac
+>IGHV2-70D*14
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacacagaccctcacactgacctgcaccttctctgggttctcactcagc......actagtggaatgcgtgtgagctggatccgtcagcccccaggtaaggccctggagtggcttgcacgcattgattgggat.........gatgataaattctacagcacatctctgaag...accaggctcaccatctccaaggacacctccaaaaaccaggtggtccttacaatgaccaacatggaccctgtggacacagccacgtattactgtgcacggatac
+>IGHV2/OR16-5*01
+caggtcaccttgaaggagtctggtcct...gcgctggtgaaacccacagagaccctcacgctgacctgcactctctctgggttctcactcagc......acttctggaatgggtatgagctggatccgtcagcccccagggaaggccctggagtggcttgctcacatttttttgaat.........gacaaaaaatcctacagcacgtctctgaag...aacaggctcatcatctccaaggacacctccaaaagccaggtggtccttaccatgaccaacatggaccctgtggacacagccacgtattactgtgcatggagag
+>IGHV3-11*01
+caggtgcagctggtggagtctggggga...ggcttggtcaagcctggagggtccctgagactctcctgtgcagcctctggattcaccttc............agtgactactacatgagctggatccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt......ggtagtaccatatactacgcagactctgtgaag...ggccgattcaccatctccagggacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgcgagaga
+>IGHV3-11*03
+caggtgcagctgttggagtctggggga...ggcttggtcaagcctggagggtccctgagactctcctgtgcagcctctggattcaccttc............agtgactactacatgagctggatccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt......agtagttacacaaactacgcagactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgcgaga
+>IGHV3-11*04
+caggtgcagctggtggagtctggggga...ggcttggtcaagcctggagggtccctgagactctcctgtgcagcctctggattcaccttc............agtgactactacatgagctggatccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt......ggtagtaccatatactacgcagactctgtgaag...ggccgattcaccatctccagggacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-11*05
+caggtgcagctggtggagtctggggga...ggcttggtcaagcctggagggtccctgagactctcctgtgcagcctctggattcaccttc............agtgactactacatgagctggatccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt......agtagttacacaaactacgcagactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgcgagaga
+>IGHV3-11*06
+caggtgcagctggtggagtctggggga...ggcttggtcaagcctggagggtccctgagactctcctgtgcagcctctggattcaccttc............agtgactactacatgagctggatccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt......agtagttacacaaactacgcagactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-13*01
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctacgacatgcactgggtccgccaagctacaggaaaaggtctggagtgggtctcagctattggtactgct.........ggtgacacatactatccaggctccgtgaag...ggccgattcaccatctccagagaaaatgccaagaactccttgtatcttcaaatgaacagcctgagagccggggacacggctgtgtattactgtgcaagaga
+>IGHV3-13*02
+gaggtgcatctggtggagtctggggga...ggcttggtacagcctgggggggccctgagactctcctgtgcagcctctggattcaccttc............agtaactacgacatgcactgggtccgccaagctacaggaaaaggtctggagtgggtctcagccaatggtactgct.........ggtgacacatactatccaggctccgtgaag...gggcgattcaccatctccagagaaaatgccaagaactccttgtatcttcaaatgaacagcctgagagccggggacacggctgtgtattactgtgcaagaga
+>IGHV3-13*03
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctgtggattcaccttc............agtagctacgacatgcactgggtccgccaagctacaggaaaaggtctggagtgggtctcagctattggtactgct.........ggtgacacatactatccaggctccgtgaag...ggccaattcaccatctccagagaaaatgccaagaactccttgtatcttcaaatgaacagcctgagagccggggacacggctgtgtattactgtgcaaga
+>IGHV3-13*04
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctacgacatgcactgggtccgccaagctacaggaaaaggtctggaatgggtctcagctattggtactgct.........ggtgacacatactatccaggctccgtgaag...ggccgattcaccatctccagagaaaatgccaagaactccttgtatcttcaaatgaacagcctgagagccggggacacggctgtgtattactgtgcaagaga
+>IGHV3-13*05
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctacgacatgcactgggtccgccaagctacaggaaaaggtctggagtgggtctcagctattggtactgct.........ggtgacccatactatccaggctccgtgaag...ggccgattcaccatctccagagaaaatgccaagaactccttgtatcttcaaatgaacagcctgagagccggggacacggctgtgtattactgtgcaagaga
+>IGHV3-15*01
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtcccttagactctcctgtgcagcctctggattcactttc............agtaacgcctggatgagctgggtccgccaggctccagggaaggggctggagtgggttggccgtattaaaagcaaaactgatggtgggacaacagactacgctgcacccgtgaaa...ggcagattcaccatctcaagagatgattcaaaaaacacgctgtatctgcaaatgaacagcctgaaaaccgaggacacagccgtgtattactgtaccacaga
+>IGHV3-15*02
+gaggtgcagctggtggagtctggggga...gccttggtaaagcctggggggtcccttagactctcctgtgcagcctctggattcactttc............agtaacgcctggatgagctgggtccgccaggctccagggaaggggctggagtgggttggccgtattaaaagcaaaactgatggtgggacaacagactacgctgcacccgtgaaa...ggcagattcaccatctcaagagatgattcaaaaaacacgctgtatctgcaaatgaacagcctgaaaaccgaggacacagccgtgtattactgtaccacaga
+>IGHV3-15*03
+gaggtgcagctggtggagtctgccgga...gccttggtacagcctggggggtcccttagactctcctgtgcagcctctggattcacttgc............agtaacgcctggatgagctgggtccgccaggctccagggaaggggctggagtgggttggccgtattaaaagcaaagctaatggtgggacaacagactacgctgcacctgtgaaa...ggcagattcaccatctcaagagttgattcaaaaaacacgctgtatctgcaaatgaacagcctgaaaaccgaggacacagccgtgtattactgtaccacaga
+>IGHV3-15*04
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtcccttagactctcctgtgcagcctctggattcactttc............agtaacgcctggatgagctgggtccgccaggctccagggaaggggctggagtgggttggccgtattgaaagcaaaactgatggtgggacaacagactacgctgcacccgtgaaa...ggcagattcaccatctcaagagatgattcaaaaaacacgctgtatctgcaaatgaacagcctgaaaaccgaggacacagccgtgtattactgtaccacaga
+>IGHV3-15*05
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtcccttagactctcctgtgcagcctctggattcactttc............agtaacgcctggatgagctgggtccgccaggctccagggaaggggctggagtgggttggccgtattaaaagcaaaactgatggtgggacaacagactacgctgcacccgtgaaa...ggcagattcaccatctcaagagatgattcaaaaaacacgctgtatctgcaaatgaacagtctgaaaaccgaggacacagccgtgtattactgtaccacaga
+>IGHV3-15*06
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtcccttagactctcctgtgcagcctctggattcactttc............agtaacgcctggatgagctgggtccgccaggctccagggaaggggctggagtgggtcggccgtattaaaagcaaaactgatggtgggacaacaaactacgctgcacccgtgaaa...ggcagattcaccatctcaagagatgattcaaaaaacacgctgtatctgcaaatgaacagcctgaaaaccgaggacacagccgtgtattactgtaccacaga
+>IGHV3-15*07
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtcccttagactctcctgtgcagcctctggtttcactttc............agtaacgcctggatgaactgggtccgccaggctccagggaaggggctggagtgggtcggccgtattaaaagcaaaactgatggtgggacaacagactacgctgcacccgtgaaa...ggcagattcaccatctcaagagatgattcaaaaaacacgctgtatctgcaaatgaacagcctgaaaaccgaggacacagccgtgtattactgtaccacaga
+>IGHV3-15*08
+gaggtgcagctggtggagtctgcggga...ggcttggtacagcctggggggtcccttagactctcctgtgcagcctctggattcacttgc............agtaacgcctggatgagctgggtccgccaggctccagggaaggggctggagtgggttggctgtattaaaagcaaagctaatggtgggacaacagactacgctgcacctgtgaaa...ggcagattcaccatctcaagagatgattcaaaaaacacgctgtatctgcaaatgatcagcctgaaaaccgaggacacggccgtgtattactgtaccacagg
+>IGHV3-16*01
+gaggtacaactggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtaacagtgacatgaactgggcccgcaaggctccaggaaaggggctggagtgggtatcgggtgttagttggaat......ggcagtaggacgcactatgtggactccgtgaag...cgccgattcatcatctccagagacaattccaggaactccctgtatctgcaaaagaacagacggagagccgaggacatggctgtgtattactgtgtgagaaa
+>IGHV3-16*02
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtaacagtgacatgaactgggcccgcaaggctccaggaaaggggctggagtgggtatcgggtgttagttggaat......ggcagtaggacgcactatgtggactccgtgaag...cgccgattcatcatctccagagacaattccaggaactccctgtatctgcaaaagaacagacggagagccgaggacatggctgtgtattactgtgtgagaaa
+>IGHV3-19*01
+acagtgcagctggtggagtctggggga...ggcttggtagagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtaacagtgacatgaactgggtccgccaggctccaggaaaggggctggagtgggtatcgggtgttagttggaat......ggcagtaggacgcactatgcagactctgtgaag...ggccgattcatcatctccagagacaattccaggaacttcctgtatcagcaaatgaacagcctgaggcccgaggacatggctgtgtattactgtgtgagaaa
+>IGHV3-20*01
+gaggtgcagctggtggagtctggggga...ggtgtggtacggcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............gatgattatggcatgagctgggtccgccaagctccagggaaggggctggagtgggtctctggtattaattggaat......ggtggtagcacaggttatgcagactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagccgaggacacggccttgtatcactgtgcgagaga
+>IGHV3-20*02
+gaggtgcagctggtggagtctggggga...ggtgtggtacggcctggggggtccctgagactctcctttgcagcctctggattcaccttt............gatgattatggcatgagctgggtccgccaagctccagggaaggggctggagtgggtctctggtattaattggaat......ggtggtagcacaggttatgcagactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagccgaggacacggccttgtatcactgtgcgagaga
+>IGHV3-21*01
+gaggtgcagctggtggagtctggggga...ggcctggtcaagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatagcatgaactgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagt......agtagttacatatactacgcagactcagtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-21*02
+gaggtgcaactggtggagtctggggga...ggcctggtcaagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatagcatgaactgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagt......agtagttacatatactacgcagactcagtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-21*03
+gaggtgcagctggtggagtctggggga...ggcctggtcaagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatagcatgaactgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagt......agtagttacatatactacgcagactcagtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacagctgtgtattactgtgcgagaga
+>IGHV3-21*04
+gaggtgcagctggtggagtctggggga...ggcctggtcaagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatagcatgaactgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagt......agtagttacatatactacgcagactcagtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgcgagaga
+>IGHV3-22*01
+gaggtgcatctggtggagtctggggga...gccttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agttactactacatgagcggggtccgccaggctcccgggaaggggctggaatgggtaggtttcattagaaacaaagctaatggtgggacaacagaatagaccacgtctgtgaaa...ggcagattcacaatctcaagagatgattccaaaagcatcacctatctgcaaatgaagagcctgaaaaccgaggacacggccgtgtattactgttccagaga
+>IGHV3-22*02
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agttactactacatgagcggggtccgccaggctcccgggaaggggctggaatgggtaggtttcattagaaacaaagctaatggtgggacaacagaatagaccacgtctgtgaaa...ggcagattcacaatctcaagagatgattccaaaagcatcacctatctgcaaatgaagagcctgaaaaccgaggacacggccgtgtattactgttccagaga
+>IGHV3-23*01
+gaggtgcagctgttggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............agcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagt......ggtggtagcacatactacgcagactccgtgaag...ggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgaaaga
+>IGHV3-23*02
+gaggtgcagctgttggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............agcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagt......ggtggtagcacatactacggagactccgtgaag...ggccggttcaccatctcaagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgaaaga
+>IGHV3-23*03
+gaggtgcagctgttggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............agcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt......ggtagtagcacatactatgcagactccgtgaag...ggccggttcaccatctccagagataattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgaaaga
+>IGHV3-23*04
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............agcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagt......ggtggtagcacatactacgcagactccgtgaag...ggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgaaaga
+>IGHV3-23*05
+gaggtgcagctgttggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............agcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctatttatagcagt......ggtagtagcacatactatgcagactccgtgaag...ggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgaaa
+>IGHV3-23D*01
+gaggtgcagctgttggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............agcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagt......ggtggtagcacatactacgcagactccgtgaag...ggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgaaaga
+>IGHV3-23D*02
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............agcagctatgccatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagctattagtggtagt......ggtggtagcacatactacgcagactccgtgaag...ggccggttcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggccgtatattactgtgcgaaaga
+>IGHV3-25*01
+gagatgcagctggtggagtctggggga...ggcttgcaaaagcctgcgtggtccccgagactctcctgtgcagcctctcaattcaccttc............agtagctactacatgaactgtgtccgccaggctccagggaatgggctggagttggtttgacaagttaatcctaat......gggggtagcacatacctcatagactccggtaag...gaccgattcaatacctccagagataacgccaagaacacacttcatctgcaaatgaacagcctgaaaaccgaggacacggccctctattagtgtaccagaga
+>IGHV3-25*02
+gagatgcagctggtggagtctggggga...ggcttggcaaagcctgcgtggtccccgagactctcctgtgcagcctctcaattcaccttc............agtagctactacatgaactgtgtccgccaggctccagggaatgggctggagttggtttgacaagttaatcctaat......gggggtagcacatacctcatagactccggtaag...gaccgattcaatacctccagagataacgccaagaacacacttcatctgcaaatgaacagcctgaaaaccgaggacacggccctctattagtgtaccagaga
+>IGHV3-25*03
+gagatgcagctggtggagtctggggga...ggcttggcaaagcctgcgtggtccccgagactctcctgtgcagcctctcaattcaccttc............agtagctactacatgaactgtgtccgccaggctccagggaatgggctggagttggttggacaagttaatcctaat......gggggtagcacatacctcatagactccggtaag...gaccgattcaatacctccagagataacgccaagaacacacttcatctgcaaatgaacagcctgaaaaccgaggacacggccctgtattagtgtaccaga
+>IGHV3-25*04
+gagacgcagctggtggagtctggggga...ggcttggcaaagcctgggcggtccccgagactctcctgtgcagcctctcaattcaccttc............agtagctactacatgaactgtgtccgccaggctccagggaatgggctggagttggttggacaagttaatcctaat......gggggtagcacatacctcatagactccggtaag...gaccgattcaatacctccagagataacgccaagaacacacttcatctgcaaatgaacagcctgaaaaccgaggacacggccctgtattactgtaccagaga
+>IGHV3-25*05
+gagatgcagctggtggagtctggggga...ggcttggcaaagcctgcgtggtccccgagactctcctgtgcagcctctcaattcaccttc............agtagctactacatgaactgtgtccgccaggctccagggaatgggctggagttggttggacaagttaatcctaat......gggggtagcacatacctcatagactccggtaag...gaccgattcaatacctccagagataacgccaagaacacacttcatctgcaaatgaacagcctgaaaaccgaggacacggccctctattagtgtaccagaga
+>IGHV3-29*01
+gaggtggagctgatagagcccacagag...gacctgagacaacctgggaagttcctgagactctcctgtgtagcctctagattcgccttc............agtagcttctgaatgagcccagttcaccagtctgcaggcaaggggctggagtgagtaatagatataaaagatgat......ggaagtcagatacaccatgcagactctgtgaag...ggcagattctccatctccaaagacaatgctaagaactctctgtatctgcaaatgaacagtcagagaactgaggacatggctgtgtatggctgtacataaggtt
+>IGHV3-30*01
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*02
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctggggggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcatttatacggtatgat......ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgaaaga
+>IGHV3-30*03
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat......ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*04
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*05
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgagggcacggctgtgtattactgtgcgagaga
+>IGHV3-30*06
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*07
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*08
+caggtgcagctggtggactctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctgcattcaccttc............agtagctatgctatgcactgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgaga
+>IGHV3-30*09
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcgccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*10
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat......ggaagtaataaatactacacagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*11
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*12
+caggtgcagctggtggagtctgggggg...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*13
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacaggctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*14
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*15
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgagcagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*16
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggccccaggcaaggggctagagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*17
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccgggcaaggggctagagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30*18
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat......ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgaaaga
+>IGHV3-30*19
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30-2*01
+gaggtacagctcgtggagtccggagag...gacccaagacaacctgggggatccctgagactctcctgtgcagactctggattaaccttc............agtagctactgaaggaactcggtttcccaggctccagggaaggggctggagtgagtagtagatatacagtgtgat......ggaagtcagatatgttatgcataatctttgaag...agcaaattcaccatctccaaagaaaatgccaagaactcactgtatttgctaatgaacagtctgagagcagcgggcacagctgtgtgttactgtatgtgaggca
+>IGHV3-30-22*01
+gaggtggagctgatagagtccatagag...gacctgagacaacctgggaagttcctgagactctcctgtgtagcctctagattcgccttc............agtagcttctgaatgagccgagttcaccagtctccaggcaaggggctggagtgagtaatagatataaaagatgat......ggaagtcagatacaccatgcagactctgtgaag...ggcagattctccatctccaaagacaatgctaagaactctctgtatctgcaaatgaacagtcagagagctgaggacatggacgtgtatggctgtacataaggtc
+>IGHV3-30-3*01
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat......ggaagcaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30-3*02
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat......ggaagcaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgaaaga
+>IGHV3-30-3*03
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat......ggaagtaataaatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-30-33*01
+gaggtacagctcgtggagtccggagag...gacccaagacaacctgggggatccctgagactctcctgtgcagactctggattaaccttc............agtagctactgaaggagctcggtttcccaggctccagggaaggggctggagtgagtagtagatatacagtgtgat......ggaagtcagatatgttatgcataatctttgaag...agcaaattcaccatctccaaagaaaatgccaagaactcactgtatttgctaatgaacagtctgagagcagagggcacagctgtgtgttactgtatgtgagg
+>IGHV3-30-42*01
+gaggtggagctgatagagcccacagag...gacctgagacaacctgggaagttcctgagactctcctgtgtagcctctagattcgccttc............agtagcttctgaatgagcccagttcaccagtctgcaggcaaggggctggagtgagtaatagatataaaagatgat......ggaagtcagatacaccatgcagactctgtgaag...ggcagattctccatctccaaagacaatgctaagaactctctgtatctgcaaatgaacagtcagagaactgaggacatggctgtgtatggctgtacataaggtt
+>IGHV3-30-5*01
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat......ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgaaaga
+>IGHV3-30-5*02
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctggggggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcatttatacggtatgat......ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgaaaga
+>IGHV3-30-52*01
+gaggtacagctcgtggagtccggagag...gacccaagacaacctgggggatccctgagactctcctgtgcagactctggattaaccttc............agtagctactgaaggaactcggtttcccaggctccagggaaggggctggagtgagtagtagatatacagtgtgat......ggaagtcagatatgttatgcataatctttgaag...agcaaattcaccatctccaaagaaaatgccaagaactcactgtatttgctaatgaacagtctgagagcagcgggcacagctgtgtgttactgtatgtgagg
+>IGHV3-32*01
+gaggtggagctgatagagtccatagag...gacctgagacaacctgggaagttcctgagactctcctgtgtagcctctagattcgccttc............agtagcttctgaatgagccgagttcaccagtctccaggcaaggggctggagtgagtaatagatataaaagatgat......ggaagtcagatacaccatgcagactctgtgaag...ggcagattctccatctccaaagacaatgctaagaactctctgtatctgcaaatgaacactcagagagctgaggacgtggccgtgtatggctatacataaggtc
+>AIGHV3-33*01
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatggtatgat......ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-33*02
+caggtacagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatggtatgat......ggaagtaataaatactatgcagactccgcgaag...ggccgattcaccatctccagagacaattccacgaacacgctgtttctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-33*03
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatggtatgat......ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccagagacaactccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgaaaga
+>IGHV3-33*04
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctagagtgggtggcagttatatggtatgac......ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-33*05
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatcatatgat......ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-33*06
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctgggaggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtggcagttatatggtatgat......ggaagtaataaatactatgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgaaaga
+>IGHV3-33-2*01
+gaggtacagctcgtggagtccggagag...gacccaagacaacctgggggatccttgagactctcctgtgcagactctggattaaccttc............agtagctactgaatgagctcggtttcccaggctccagggaaggggctggagtgagtagtagatatacagtgtgat......ggaagtcagatatgttatgcccaatctgtgaag...agcaaattcaccatctccaaagaaaatgccaagaactcactgtatttgcaaatgaacagtctgagagcagagggcacagctgtgtgttactgtatgtgaggca
+>IGHV3-35*01
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctgggggatccctgagactctcctgtgcagcctctggattcaccttc............agtaacagtgacatgaactgggtccatcaggctccaggaaaggggctggagtgggtatcgggtgttagttggaat......ggcagtaggacgcactatgcagactctgtgaag...ggccgattcatcatctccagagacaattccaggaacaccctgtatctgcaaacgaatagcctgagggccgaggacacggctgtgtattactgtgtgagaaa
+>IGHV3-38*01|
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctagggggtccctgagactctcctgtgcagcctctggattcaccgtc............agtagcaatgagatgagctggatccgccaggctccagggaaggggctggagtgggtctcatccattagtggt............ggtagcacatactacgcagactccaggaag...ggcagattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgaacaacctgagagctgagggcacggccgcgtattactgtgccagatata
+>IGHV3-38*02
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctagggggtccctgagactctcctgtgcagcctctggattcaccgtc............agtagcaatgagatgagctggatccgccaggctccagggaaggggctggagtgggtctcatccattagtggt............ggtagcacatactacgcagactccaggaag...ggcagattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgaacaacctgagagctgagggcacggccgtgtattactgtgccagatata
+>IGHV3-38*03
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctagggggtccctgagactctcctgtgcagcctctggattcaccgtc............agtagcaatgagatgagctggatccgccaggctccagggaagggtctggagtgggtctcatccattagtggt............ggtagcacatactacgcagactccaggaag...ggcagattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgaacaacctgagagctgagggcacggccgtgtattactgtgccagatata
+>IGHV3-38-3*01
+gaggtgcagctggtggagtctcgggga...gtcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccgtc............agtagcaatgagatgagctgggtccgccaggctccagggaagggtctggagtgggtctcatccattagtggt............ggtagcacatactacgcagactccaggaag...ggcagattcaccatctccagagacaattccaagaacacgctgcatcttcaaatgaacagcctgagagctgaggacacggctgtgtattactgtaagaaaga
+>IGHV3-43*01
+gaagtgcagctggtggagtctggggga...gtcgtggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............gatgattataccatgcactgggtccgtcaagctccggggaagggtctggagtgggtctctcttattagttgggat......ggtggtagcacatactatgcagactctgtgaag...ggccgattcaccatctccagagacaacagcaaaaactccctgtatctgcaaatgaacagtctgagaactgaggacaccgccttgtattactgtgcaaaagata
+>IGHV3-43*02
+gaagtgcagctggtggagtctggggga...ggcgtggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............gatgattatgccatgcactgggtccgtcaagctccagggaagggtctggagtgggtctctcttattagtggggat......ggtggtagcacatactatgcagactctgtgaag...ggccgattcaccatctccagagacaacagcaaaaactccctgtatctgcaaatgaacagtctgagaactgaggacaccgccttgtattactgtgcaaaagata
+>IGHV3-43D*01
+gaagtgcagctggtggagtctggggga...gtcgtggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............gatgattatgccatgcactgggtccgtcaagctccggggaagggtctggagtgggtctctcttattagttgggat......ggtggtagcacctactatgcagactctgtgaag...ggtcgattcaccatctccagagacaacagcaaaaactccctgtatctgcaaatgaacagtctgagagctgaggacaccgccttgtattactgtgcaaaagata
+>IGHV3-47*01
+gaggatcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgcgaccctcctgtgcagcctctggattcgccttc............agtagctatgctctgcactgggttcgccgggctccagggaagggtctggagtgggtatcagctattggtactggt.........ggtgatacatactatgcagactccgtgatg...ggccgattcaccatctccagagacaacgccaagaagtccttgtatcttcatatgaacagcctgatagctgaggacatggctgtgtattattgtgcaaga
+>IGHV3-47*02
+gaggatcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagaccctcctgtgcagcctctggattcgccttc............agtagctatgttctgcactgggttcgccgggctccagggaagggtccggagtgggtatcagctattggtactggt.........ggtgatacatactatgcagactccgtgatg...ggccgattcaccatctccagagacaacgccaagaagtccttgtatcttcaaatgaacagcctgatagctgaggacatggctgtgtattattgtgcaagaga
+>IGHV3-48*01
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatagcatgaactgggtccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt......agtagtaccatatactacgcagactctgtgaag...ggccgattcaccatctccagagacaatgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-48*02
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatagcatgaactgggtccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt......agtagtaccatatactacgcagactctgtgaag...ggccgattcaccatctccagagacaatgccaagaactcactgtatctgcaaatgaacagcctgagagacgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-48*03
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggagggtccctgagactctcctgtgcagcctctggattcaccttc............agtagttatgaaatgaactgggtccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt......ggtagtaccatatactacgcagactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtttattactgtgcgagaga
+>IGHV3-48*04
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatagcatgaactgggtccgccaggctccagggaaggggctggagtgggtttcatacattagtagtagt......agtagtaccatatactacgcagactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-49*01
+gaggtgcagctggtggagtctggggga...ggcttggtacagccagggcggtccctgagactctcctgtacagcttctggattcaccttt............ggtgattatgctatgagctggttccgccaggctccagggaaggggctggagtgggtaggtttcattagaagcaaagcttatggtgggacaacagaatacaccgcgtctgtgaaa...ggcagattcaccatctcaagagatggttccaaaagcatcgcctatctgcaaatgaacagcctgaaaaccgaggacacagccgtgtattactgtactagaga
+>IGHV3-49*02
+gaggtgcagctggtggagtctggggga...ggcttggtacagccagggccgtccctgagactctcctgtacagcttctggattcaccttt............gggtattatcctatgagctgggtccgccaggctccagggaaggggctggagtgggtaggtttcattagaagcaaagcttatggtgggacaacagaatacgccgcgtctgtgaaa...ggcagattcaccatctcaagagatgattccaaaagcatcgcctatctgcaaatgaacagcctgaaaaccgaggacacagccgtgtattactgtactagaga
+>IGHV3-49*03
+gaggtgcagctggtggagtctggggga...ggcttggtacagccagggcggtccctgagactctcctgtacagcttctggattcaccttt............ggtgattatgctatgagctggttccgccaggctccagggaaggggctggagtgggtaggtttcattagaagcaaagcttatggtgggacaacagaatacgccgcgtctgtgaaa...ggcagattcaccatctcaagagatgattccaaaagcatcgcctatctgcaaatgaacagcctgaaaaccgaggacacagccgtgtattactgtactagaga
+>IGHV3-49*04
+gaggtgcagctggtggagtctggggga...ggcttggtacagccagggcggtccctgagactctcctgtacagcttctggattcaccttt............ggtgattatgctatgagctgggtccgccaggctccagggaaggggctggagtgggtaggtttcattagaagcaaagcttatggtgggacaacagaatacgccgcgtctgtgaaa...ggcagattcaccatctcaagagatgattccaaaagcatcgcctatctgcaaatgaacagcctgaaaaccgaggacacagccgtgtattactgtactagaga
+>IGHV3-49*05
+gaggtgcagctggtggagtctggggga...ggcttggtaaagccagggcggtccctgagactctcctgtacagcttctggattcaccttt............ggtgattatgctatgagctggttccgccaggctccagggaaggggctggagtgggtaggtttcattagaagcaaagcttatggtgggacaacagaatacgccgcgtctgtgaaa...ggcagattcaccatctcaagagatgattccaaaagcatcgcctatctgcaaatgaacagcctgaaaaccgaggacacagccgtgtattactgtactagaga
+>IGHV3-52*01
+gaggtgcagctggtggagtctgggtga...ggcttggtacagcctggagggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctcctggatgcactgggtctgccaggctccggagaaggggctggagtgggtggccgacataaagtgtgac......ggaagtgagaaatactatgtagactctgtgaag...ggccgattgaccatctccagagacaatgccaagaactccctctatctgcaagtgaacagcctgagagctgaggacatgaccgtgtattactgtgtgagagg
+>IGHV3-52*02
+gaggtgcagctggtggagtctgggtga...ggcttggtacagcctggagggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctcctggatgcactgggtctgccaggctccggagaaggggcaggagtgggtggccgacataaagtgtgac......ggaagtgagaaatactatgtagactctgtgaag...ggccgattgaccatctccagagacaatgccaagaactccctctatctgcaagtgaacagcctgagagctgaggacatgaccgtgtattactgtgtgaga
+>IGHV3-52*03
+gaggtgcagctggtcgagtctgggtga...ggcttggtacagcctggagggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctcctggatgcactgggtctgccaggctccggagaaggggctggagtgggtggccgacataaagtgtgac......ggaagtgagaaatactatgtagactctgtgaag...ggccgattgaccatctccagagacaatgccaagaactccctctatctgcaagtgaacagcctgagagctgaggacatgaccgtgtattactgtgtgaga
+>IGHV3-53*01
+gaggtgcagctggtggagtctggagga...ggcttgatccagcctggggggtccctgagactctcctgtgcagcctctgggttcaccgtc............agtagcaactacatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt.........ggtagcacatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgcgagaga
+>IGHV3-53*02
+gaggtgcagctggtggagactggagga...ggcttgatccagcctggggggtccctgagactctcctgtgcagcctctgggttcaccgtc............agtagcaactacatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt.........ggtagcacatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgcgagaga
+>IGHV3-53*03
+gaggtgcagctggtggagtctggagga...ggcttgatccagcctggggggtccctgagactctcctgtgcagcctctgggttcaccgtc............agtagcaactacatgagctgggtccgccagcctccagggaaggggctggagtgggtctcagttatttatagcggt.........ggtagcacatactacgcagactctgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgctaggga
+>IGHV3-53*04
+gaggtgcagctggtggagtctggagga...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctgggttcaccgtc............agtagcaactacatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt.........ggtagcacatactacgcagactccgtgaag...ggccgattcaccatctccagacacaattccaagaacacgctgtatcttcaaatgaacagcctgagagctgaggacacggccgtgtattactgtgcgagaga
+>IGHV3-54*01
+gaggtacagctggtggagtctgaagaa...aaccaaagacaacttgggggatccctgagactctcctgtgcagactctggattaaccttc............agtagctactgaatgagctcagattcccaagctccagggaaggggctggagtgagtagtagatatatagtaggat......agaagtcagctatgttatgcacaatctgtgaag...agcagattcaccatctccaaagaaaatgccaagaactcactctgtttgcaaatgaacagtctgagagcagagggcacggccgtgtattactgtatgtgagt
+>IGHV3-54*02
+gaggtacagctggtggagtctgaagaa...aaccaaagacaacttgggggatccctgagactctcctgtgcagactctggattaaccttc............agtagctactgaatgagctcagattcccaggctccagggaaggggctggagtgagtagtagatatatagtacgat......agaagtcagatatgttatgcacaatctgtgaag...agcagattcaccatctccaaagaaaatgccaagaactcactccgtttgcaaatgaacagtctgagagcagagggcacggccgtgtattactgtatgtgagg
+>IGHV3-54*04
+gaggtacagctggtggagtctgaagaa...aaccaaagacaacttgggggatccctgagactctcctgtgcagactctggattaaccttc............agtagctactgaatgagctcagattcccaggctccagggaaggggctggagtgagtagtagatatatagtaggat......agaagtcagctatgttatgcacaatctgtgaag...agcagattcaccatctccaaagaaaatgccaagaactcactctgtttgcaaatgaacagtctgagagcagagggcacggccgtgtattactgtatgtgagt
+>IGHV3-62*01
+gaggtgcagctggtggagtctggggaa...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctctgctatgcactgggtccgccaggctccaagaaagggtttgtagtgggtctcagttattagtacaagt......ggtgataccgtactctacacagactctgtgaag...ggccgattcaccatctccagagacaatgcccagaattcactgtctctgcaaatgaacagcctgagagccgagggcacagttgtgtactactgtgtgaaaga
+>IGHV3-63*01
+gaggtggagctgatagagtccatagag...ggcctgagacaacttgggaagttcctgagactctcctgtgtagcctctggattcaccttc............agtagctactgaatgagctgggtcaatgagactctagggaaggggctggagggagtaatagatgtaaaatatgat......ggaagtcagatataccatgcagactctgtgaag...ggcagattcaccatctccaaagacaatgctaagaactcaccgtatctccaaacgaacagtctgagagctgaggacatgaccatgcatggctgtacataaggtt
+>IGHV3-63*02
+gaggtggagctgatagagtccatagag...ggcctgagacaacttgggaagttcctgagactctcctgtgtagcctctggattcaccttc............agtagctactgaatgagctgggtcaatgagactctagggaaggggctggagggagtaatagatgtaaaatatgat......ggaagtcagatataccatgcagactctgtgaag...ggcagattcaccatctccaaagacaatgctaagaactcaccgtatctgcaaacgaacagtctgagagctgaggacatgaccatgcatggctgtacataa
+>IGHV3-64*01
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccagggaagggactggaatatgtttcagctattagtagtaat......gggggtagcacatattatgcaaactctgtgaag...ggcagattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgggcagcctgagagctgaggacatggctgtgtattactgtgcgagaga
+>IGHV3-64*02
+gaggtgcagctggtggagtctggggaa...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccagggaagggactggaatatgtttcagctattagtagtaat......gggggtagcacatattatgcagactctgtgaag...ggcagattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgggcagcctgagagctgaggacatggctgtgtattactgtgcgagaga
+>IGHV3-64*03
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgttcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccagggaagggactggaatatgtttcagctattagtagtaat......gggggtagcacatactacgcagactcagtgaag...ggcagattcaccatctccagagacaattccaagaacacgctgtatgtccaaatgagcagtctgagagctgaggacacggctgtgtattactgtgtgaaaga
+>IGHV3-64*04
+caggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgttcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccagggaagggactggaatatgtttcagctattagtagtaat......gggggtagcacatactacgcagactcagtgaag...ggcagattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-64*05
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgttcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccagggaagggactggaatatgtttcagctattagtagtaat......gggggtagcacatactacgcagactcagtgaag...ggcagattcaccatctccagagacaattccaagaacacgctgtatgttcaaatgagcagtctgagagctgaggacacggctgtgtattactgtgtgaaaga
+>IGHV3-64D*06
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgttcagcctctggattcaccttc............agtagctatgctatgcactgggtccgccaggctccagggaagggactggaatatgtttcagctattagtagtaat......gggggtagcacatactacgcagactccgtgaag...ggcagattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgagcagtctgagagctgaggacacggctgtgtattactgtgtgaaaga
+>IGHV3-66*01
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctggattcaccgtc............agtagcaactacatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt.........ggtagcacatactacgcagactccgtgaag...ggcagattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-66*02
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctggattcaccgtc............agtagcaactacatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt.........ggtagcacatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgaga
+>IGHV3-66*03
+gaggtgcagctggtggagtctggagga...ggcttgatccagcctggggggtccctgagactctcctgtgcagcctctgggttcaccgtc............agtagcaactacatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagctgt.........ggtagcacatactacgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-66*04
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctggattcaccgtc............agtagcaactacatgagctgggtccgccaggctccagggaaggggctggagtgggtctcagttatttatagcggt.........ggtagcacatactacgcagactccgtgaag...ggcagattcaccatctccagagacaattccaagaacacgctgtatcttcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaca
+>IGHV3-69-1*01
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtgactactacatgaactgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagt.........agtaccatatactacgcagactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-69-1*02
+gaggtgcagctggtggagtctggggga...ggcttggtaaagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtgactactacatgaactgggtccgccaggctccagggaaggggctggagtgggtctcatccattagtagtagt.........agtaccatatactacgcagactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtttattactgtgcgagaga
+>IGHV3-7*01
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............agtagctattggatgagctgggtccgccaggctccagggaaggggctggagtgggtggccaacataaagcaagat......ggaagtgagaaatactatgtggactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-7*02
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............agtagctattggatgagctgggtccgccaggctccagggaaagggctggagtgggtggccaacataaagcaagat......ggaagtgagaaatactatgtggactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgaga
+>IGHV3-7*03
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctggattcaccttt............agtagctattggatgagctgggtccgccaggctccagggaaggggctggagtgggtggccaacataaagcaagat......ggaagtgagaaatactatgtggactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgcgagaga
+>IGHV3-71*01
+gaggtgcagctggtggagtccggggga...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtgactactacatgagctgggtccgccaggctcccgggaaggggctggagtgggtaggtttcattagaaacaaagctaatggtgggacaacagaatagaccacgtctgtgaaa...ggcagattcacaatctcaagagatgattccaaaagcatcacctatctgcaaatgaacagcctgagagccgaggacacggccgtgtattactgtgcgagaga
+>IGHV3-71*02
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtgactactacatgagctgggtccgccaggctcccgggaaggggctggagtgggtaggtttcattagaaacaaagctaatggtgggacaacagaatagaccacgtctgtgaaa...ggcagattcacaatctcaagagatgattccaaaagcatcacctatctgcaaatgaacagcctgagagccgaggacatggctgtgtattactgtgcgagaga
+>IGHV3-71*03
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctggtttcaccttc............agtgactactacatgagctgggtccgccaggctcccgggaaggggctggagtgggtaggtttcattagaaacaaagctaatggtgggacaacagaatagaccacgtctgtgaaa...ggcagattcacaatctcaagagatgattccaaaagcatcacctatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgcgagaga
+>IGHV3-72*01
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggagggtccctgagactctcctgtgcagcctctggattcaccttc............agtgaccactacatggactgggtccgccaggctccagggaaggggctggagtgggttggccgtactagaaacaaagctaacagttacaccacagaatacgccgcgtctgtgaaa...ggcagattcaccatctcaagagatgattcaaagaactcactgtatctgcaaatgaacagcctgaaaaccgaggacacggccgtgtattactgtgctagaga
+>IGHV3-72*02
+....................................................................................accttc............agtgaccactacatggactgggtccgccaggctccagggaaggggctggagtgggttggccgtactagaaacaaagctaacagctacaccacagaatacgccgcgtctgtgaaa...ggcagattcaccatctcaagagatgattcaaagaactcactgtat
+>IGHV3-73*01
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgaaactctcctgtgcagcctctgggttcaccttc............agtggctctgctatgcactgggtccgccaggcttccgggaaagggctggagtgggttggccgtattagaagcaaagctaacagttacgcgacagcatatgctgcgtcggtgaaa...ggcaggttcaccatctccagagatgattcaaagaacacggcgtatctgcaaatgaacagcctgaaaaccgaggacacggccgtgtattactgtactagaca
+>IGHV3-73*02
+gaggtgcagctggtggagtccggggga...ggcttggtccagcctggggggtccctgaaactctcctgtgcagcctctgggttcaccttc............agtggctctgctatgcactgggtccgccaggcttccgggaaagggctggagtgggttggccgtattagaagcaaagctaacagttacgcgacagcatatgctgcgtcggtgaaa...ggcaggttcaccatctccagagatgattcaaagaacacggcgtatctgcaaatgaacagcctgaaaaccgaggacacggccgtgtattactgtactagaca
+>IGHV3-74*01
+gaggtgcagctggtggagtccggggga...ggcttagttcagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctactggatgcactgggtccgccaagctccagggaaggggctggtgtgggtctcacgtattaatagtgat......gggagtagcacaagctacgcggactccgtgaag...ggccgattcaccatctccagagacaacgccaagaacacgctgtatctgcaaatgaacagtctgagagccgaggacacggctgtgtattactgtgcaagaga
+>IGHV3-74*02
+gaggtgcagctggtggagtctggggga...ggcttagttcagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctactggatgcactgggtccgccaagctccagggaaggggctggtgtgggtctcacgtattaatagtgat......gggagtagcacaagctacgcggactccgtgaag...ggccgattcaccatctccagagacaacgccaagaacacgctgtatctgcaaatgaacagtctgagagccgaggacacggctgtgtattactgtgcaaga
+>IGHV3-74*03
+gaggtgcagctggtggagtccggggga...ggcttagttcagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctactggatgcactgggtccgccaagctccagggaaggggctggtgtgggtctcacgtattaatagtgat......gggagtagcacaacgtacgcggactccgtgaag...ggccgattcaccatctccagagacaacgccaagaacacgctgtatctgcaaatgaacagtctgagagccgaggacacggctgtgtattactgtgcaagaga
+>IGHV3-9*01
+gaagtgcagctggtggagtctggggga...ggcttggtacagcctggcaggtccctgagactctcctgtgcagcctctggattcaccttt............gatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaat......agtggtagcataggctatgcggactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggccttgtattactgtgcaaaagata
+>IGHV3-9*02
+gaagtgcagctggtggagtctggggga...ggcttggtacagcctggcaggtccctgagactctcctgtgcagcctctggattcacctct............gatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaat......agtggtagcataggctatgcggactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacacggccttgtattactgtgcaaaagata
+>IGHV3-9*03
+gaagtgcagctggtggagtctggggga...ggcttggtacagcctggcaggtccctgagactctcctgtgcagcctctggattcaccttt............gatgattatgccatgcactgggtccggcaagctccagggaagggcctggagtgggtctcaggtattagttggaat......agtggtagcataggctatgcggactctgtgaag...ggccgattcaccatctccagagacaacgccaagaactccctgtatctgcaaatgaacagtctgagagctgaggacatggccttgtattactgtgcaaaagata
+>IGHV3-NL1*01
+caggtgcagctggtggagtctggggga...ggcgtggtccagcctggggggtccctgagactctcctgtgcagcgtctggattcaccttc............agtagctatggcatgcactgggtccgccaggctccaggcaaggggctggagtgggtctcagttatttatagcggt......ggtagtagcacatactatgcagactccgtgaag...ggccgattcaccatctccagagacaattccaagaacacgctgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgcgaaaga
+>IGHV3/OR15-7*01
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctgggggttctctgagactctcatgtgcagcctctggattcaccttc............agtgaccactacatgagctgggtccgccaggctcaagggaaagggctagagttggtaggtttaataagaaacaaagctaacagttacacgacagaatatgctgcgtctgtgaaa...ggcagacttaccatctcaagagaggattcaaagaacacgatgtatctgcaaatgagcaacctgaaaaccgaggacttggccgtgtattactgtgctaga
+>IGHV3/OR15-7*02
+gaggtgcagctgttggagtctggggga...ggcttggtccagcctgggggttctctgagactctcatgtgctgcctctggattcaccttc............agtgaccactacatgagctgggtccgccaggctcaagggaaagggctagagttggtaggtttaataagaaacaaagctaacagttacacgacagaatatgctgcgtctgtgaaa...ggcagacttaccatctcaagagaggattcaaagaacacgctgtatctgcaaatgagcagcctgaaaaccgaggacttggccgtgtattactgtgctaga
+>IGHV3/OR15-7*03
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctgggggttctctgagactctcatgtgcagcctctggattcaccttc............agtgaccactacatgagctgggtccgccaggctcaagggaaagggctagagttggtaggtttaataagaaacaaagctaacagttacacgacagaatatgctgcgtctgtgaaa...ggcagacttaccatctcaagagaggattcaaagaacacgctgtatctgcaaatgagcagcctgaaaaccgaggacttggccgtgtattactgtgctaga
+>IGHV3/OR15-7*05
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctgggggttctctgagactctcatgtgcagcctctggattcaccttc............agtgaccactacatgagctgggtccgccaggctcaagggaaagggctagagttggtaggtttaataagaaacaaagctaacagttacacgacagaatatgctgcgtctgtgaaa...ggcagacttaccatctcaagagaggattcaaagaacacgctgtatctgcaaatgagcaacctgaaaaccgaggacttggccgtgtattactgtgctagaga
+>IGHV3/OR16-10*01
+gaggttcagctggtgcagtctggggga...ggcttggtacatcctggggggtccctgagactctcctgtgcaggctctggattcaccttc............agtagctatgctatgcactgggttcgccaggctccaggaaaaggtctggagtgggtatcagctattggtactggt.........ggtggcacatactatgcagactccgtgaag...ggccgattcaccatctccagagacaatgccaagaactccttgtatcttcaaatgaacagcctgagagccgaggacatggctgtgtattactgtgcaaga
+>IGHV3/OR16-10*02
+gaggttcagctggtgcagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcaggctctggattcaccttc............agtagctatgctatgcactgggttcgccaggctccaggaaaaggtctggagtgggtatcagctattggtactggt.........ggtggcacatactatgcagactccgtgaag...ggccgattcaccatctccagagacaatgccaagaactccttgtatcttcaaatgaacagcctgagagccgaggacatggctgtgtattactgtgcaaga
+>IGHV3/OR16-10*03
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactctcctgtgcaggctctggattcaccttc............agtagctatgctatgcactgggttcgccaggctccaggaaaaggtctggagtgggtatcagctattggtactggt.........ggtggcacatactatgcagactccgtgaag...ggccgattcaccatctccagagacaatgccaagaactccttgtatcttcaaatgaacagcctgagagccgaggacatggctgtgtattactgtgcaagaga
+>IGHV3/OR16-12*01
+gaggtgcagctggtagagtctgggaga...ggcttggcccagcctggggggtacctaaaactctccggtgcagcctctggattcaccgtc............ggtagctggtacatgagctggatccaccaggctccagggaagggtctggagtgggtctcatacattagtagtagt......ggttgtagcacaaactacgcagactctgtgaag...ggcagattcaccatctccacagacaactcaaagaacacgctctacctgcaaatgaacagcctgagagtggaggacacggccgtgtattactgtgcaaga
+>IGHV3/OR16-13*01
+gaggtgcagctggtggagtctggggga...ggcttagtacagcctggagggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctactggatgcactgggtccgccaagctccagggaaggggctggtgtgggtctcacgtattaatagtgat......gggagtagcacaagctacgcagactccatgaag...ggccaattcaccatctccagagacaatgctaagaacacgctgtatctgcaaatgaacagtctgagagctgaggacatggctgtgtattactgtactaga
+>IGHV3/OR16-14*01
+gaggtgcagctggaggagtctggggga...ggcttagtacagcctggagggtccctgagactctcctgtgcagcctctggattcaccttc............agtagctactggatgcactgggtccgccaatctccagggaaggggctggtgtgagtctcacgtattaatagtgat......gggagtagcacaagctacgcagactccttgaag...ggccaattcaccatctccagagacaatgctaagaacacgctgtatctgcaaatgaacagtctgagagctgaggacatggctgtgtattactgtactaga
+>IGHV3/OR16-15*01
+gaagtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagactctcctgtgcagcctctgtattcaccttc............agtaacagtgacataaactgggtcctctaggctccaggaaaggggctggagtgggtctcgggtattagttggaat......ggcggtaagacgcactatgtggactccgtgaag...ggccaattttccatctccagagacaattccagcaagtccctgtatctgcaaaagaacagacagagagccaaggacatggccgtgtattactgtgtgagaaa
+>IGHV3/OR16-15*02
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagacactcctgtgcagcctctggattcaccttc............agtaacagtgacatgaactgggtcctctaggctccaggaaaggggctggagtgggtctcgggtattagttggaat......ggcggtaagacgcactatgtggactccgtgaag...ggccaatttaccatctccagagacaattccagcaagtccctgtatctgcaaaagaacagacagagagccaaagacatggccgtgtattactgtgtgaga
+>IGHV3/OR16-16*01
+gaggtgcagctggtggagtctggggga...ggcttggtccagcctggggggtccctgagacactcctgtgcagcctctggattcaccttc............agtaacagtgacatgaactgggtcctctaggctccaggaaaggggctggagtgggtctcggatattagttggaat......ggcggtaagacgcactatgtggactccgtgaag...ggccaatttaccatctccagagacaattccagcaagtccctgtatctgcaaaagaacagacagagagccaaggacatggccgtgtattactgtgtgaga
+>IGHV3/OR16-6*02
+gaggtgcagctggtggagtctgcggga...ggccttggtacagcctgggggtcccttagactctcctgtgcagcctctggattcacttgc............agtaacgcctggatgagctgggtccgccaggctccagggaaggggctggagtgggttggctgtattaaaagcaaagctaatggtgggacaacagactacgctgcacctgtgaaa...ggcagattcaccatctcaagagatgattcaaaaaacacgctgtatctgcaaatgatcagcctgaaaaccgaggacacggccgtgtattactgtaccacagg
+>IGHV3/OR16-8*01
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactgtcctgtccagcctctggattcaccttc............agtaaccactacatgagctgggtccgccaggctccagggaagggactggagtgggtttcatacattagtggtgat......agtggttacacaaactacgcagactctgtgaag...ggccgattcaccatctccagggacaacgccaataactcaccgtatctgcaaatgaacagcctgagagctgaggacacggctgtgtattactgtgtgaaa
+>IGHV3/OR16-8*02
+gaggtgcagctggtggagtctggggga...ggcttggtacagcctggggggtccctgagactgtcctgtccagactctggattcaccttc............agtaaccactacatgagctgggtccgccaggctccagggaagggactggagtggatttcatacattagtggtgat......agtggttacacaaactacgcagactctgtgaag...ggccgattcaccatctccagggacaacgccaataactcaccgtatctgcaaatgaacagcttgagagctgaggacacggctgtgtattactgtgtgaaaca
+>IGHV3/OR16-9*01
+gaggtgcagctggtggagtctggagga...ggcttggtacagcctggggggtccctgagactctcctgtgcagcctctggattcaccttc............agtaaccactacacgagctgggtccgccaggctccagggaagggactggagtgggtttcatacagtagtggtaat......agtggttacacaaactacgcagactctgtgaaa...ggccgattcaccatctccagggacaacgccaagaactcactgtatctgcaaatgaacagcctgagagccgaggacacggctgtgtattactgtgtgaaa
+>IGHV4-28*01
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtccctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggctggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatgtcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacacggccgtgtattactgtgcgagaaa
+>IGHV4-28*02
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggctggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt.........gggagcatctactacaacccgtccctcaag...agtcgagtcaccatgtcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacacggccgtgtattactgtgcgagaaa
+>IGHV4-28*03
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtccctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggctggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatgtcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacacggccgtgtattactgtgcgagaga
+>IGHV4-28*04
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtccctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggctggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatgtcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacaccggcgtgtattactgtgcgaga
+>IGHV4-28*05
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtccctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggctggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt.........gggagcatctactacaacccgtccctcaag...agtcgagtcaccatgtcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacacggccgtgtattactgtgcgagaaa
+>IGHV4-28*06
+caggtgcagctacaggagtcgggccca...ggactggtgaagccttcggacaccctgtccctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggctggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt.........gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatgtcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccttggacacggccgtgtattactgtgcgagaaa
+>IGHV4-28*07
+caggtacagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtccctcacctgcgctgtctctggttactccatcagc.........agtagtaactggtggggctggatccggcagcccccagggaagggactggagtggattgggtacatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatgtcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacacggccgtgtattactgtgcgagaaa
+>IGHV4-30-2*01
+cagctgcagctgcaggagtccggctca...ggactggtgaagccttcacagaccctgtccctcacctgcgctgtctctggtggctccatcagc......agtggtggttactcctggagctggatccggcagccaccagggaagggcctggagtggattgggtacatctatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagtagacaggtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgccagaga
+>IGHV4-30-2*02
+cagctgcagctgcaggagtccggctca...ggactggtgaagccttcacagaccctgtccctcacctgcgctgtctctggtggctccatcagc......agtggtggttactcctggagctggatccggcagccaccagggaagggcctggagtggattgggtacatctatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagtagacaggtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcg
+>IGHV4-30-2*03
+cagctgcagctgcaggagtccggctca...ggactggtgaagccttcacagaccctgtccctcacctgcgctgtctctggtggctccatcagc......agtggtggttactcctggagctggatccggcagccaccagggaagggcctggagtggattgggagtatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcagacacggctgtgtattactgtgcgagaca
+>IGHV4-30-2*04
+...........................................................................tctggtggctccatcagc......agtggtggttactcctggagctggatccggcagccaccagggaagggcctggagtggattgggtacatctatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggccgtgtattactgtgcgagaga
+>IGHV4-30-2*05
+cagctgcagctgcaggagtccggctca...ggactggtgaagccttcacagaccctgtccctcacctgcgctgtctctggtggctccatcagc......agtggtggttactcctggagctggatccggcagccaccagggaagggcctggagtggattgggtacatctatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcagacacggccgtgtattactgtgccagaga
+>IGHV4-30-2*06
+cagctgcagctgcaggagtccggctca...ggactggtgaagccttcacagaccctgtccctcacctgcgctgtctctggtggctccatcagc......agtggtggttactcctggagctggatccggcagtcaccagggaagggcctggagtggattgggtacatctatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagtagacaggtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgccagaga
+>IGHV4-30-4*01
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtgattactactggagttggatccgccagcccccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcagacacggccgtgtattactgtgccagaga
+>IGHV4-30-4*02
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtgattactactggagttggatccgccagcccccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgactgcagcagacacggccgtgtattactgtgccagaga
+>IGHV4-30-4*03
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtgattactactggagttggatccgccagcccccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactg
+>XIGHV4-30-4*04
+caggtgcagctgcaggactcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtgattactactggagttggatccgccagcccccagggaagggcctggagtggattgggtacttctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcagacacggccgtgtattactg
+>IGHV4-30-4*05
+..........................................................................ctctggtggctccatcagc......agtggtgattactactggagttggatccgccagcncccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcagacacggccgtgtattactgtgccagaga
+>IGHV4-30-4*06
+...........................................................................tctggtggctccatcagc......agtggtgattactactggagttggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcagacacggccgtgtattactgtgccagaga
+>IGHV4-30-4*07
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcgctgtctctggtggctccatcagc......agtggtggttactcctggagctggatccggcagccaccagggaagggactggagtggattgggtatatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgccagaga
+>IGHV4-31*01
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagctggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtctagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-31*02
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgtactgtctctggtggctccatcagc......agtggtggttactactggagctggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-31*03
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagctggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-31*04
+caggtgcggctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagctggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactgtgcg
+>IGHV4-31*05
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagctggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgacc...gcggacgcggccgtgtattactgtgcg
+>IGHV4-31*06
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtagttactactggagctggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactg
+>IGHV4-31*07
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcactgtctctggtggatccatcagc......agtggtggttactactggagctggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactg
+>IGHV4-31*08
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagctggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatccgtagacacgtccaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactg
+>IGHV4-31*09
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagctggatccgccagcacccagggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactg
+>IGHV4-31*10
+caggtgcagctgcaggagtcgggccca...ggactgttgaagccttcacagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtggttactactggagctggatccgccagcacccagggaagggcctggagtggattgggtgcatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacccgtccaagaaccagttctccctgaagccgagctctgtgactgccgcggacacggccgtggattactgtgcgagaga
+>IGHV4-34*01
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttc............agtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt.........ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagg
+>IGHV4-34*02
+caggtgcagctacaacagtggggcgca...ggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttc............agtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt.........ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagg
+>IGHV4-34*03
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttc............agtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt.........ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactg
+>IGHV4-34*04
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttc............agtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt.........ggaagcaccaacaacaacccgtccctcaag...agtcgagccaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagg
+>IGHV4-34*05
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttc............agtggttactactggtgctggatccgccagcccctagggaaggggctggagtggattggggaaatcaatcatagt.........ggaagcaccaacaacaacccgtccctcaag...agtcgagccaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagg
+>IGHV4-34*06
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttc............agtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt.........ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgggctctgtgaccgccgcggacacggccgtgtattactg
+>IGHV4-34*07
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttc............agtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaaccatagt.........ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactg
+>IGHV4-34*08
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggaccttc............agtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt.........ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcg
+>IGHV4-34*09
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcgctgtctatggtgggtccttc............agtggttactactggagctggatccgccagcccccagggaagggactggagtggattggggaaatcaatcatagt.........ggaagcaccaactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-34*10
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttc............agtggttactactggagctggatccgccagcccccagggaagggactggagtggattggggaaatcaatcatagt.........ggaagcaccaactacaacccgtccctcaag...agtcgaatcaccatgtcagtagacacgtccaagaaccagttctacctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagata
+>IGHV4-34*11
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccgtc............agtggttactactggagctggatccggcagcccccagggaaggggctggagtggattgggtatatctattatagt.........gggagcaccaacaacaacccctccctcaag...agtcgagccaccatatcagtagacacgtccaagaaccagttctccctgaacctgagctctgtgaccgccgcggacacggccgtgtattgctgtgcgagaga
+>IGHV4-34*12
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtgggtccttc............agtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcattcatagt.........ggaagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgaga
+>IGHV4-34*13
+...........................................................................tatggtgggtccttc............agtggttactactggagctggatccgccagcccccagggaaggggctggagtggattggggaaatcaatcatagt.........ggaagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggctgtgtattactgtgcgagagg
+>IGHV4-38-2*01
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcgctgtctctggttactccatcagc.........agtggttactactggggctggatccggcagcccccagggaaggggctggagtggattgggagtatctatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggccgtgtattactgtgcgaga
+>IGHV4-38-2*02
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggttactccatcagc.........agtggttactactggggctggatccggcagcccccagggaaggggctggagtggattgggagtatctatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggccgtgtattactgtgcgagaga
+>IGHV4-39*01
+cagctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggctggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggctgtgtattactgtgcgagaca
+>IGHV4-39*02
+cagctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggctggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgtagacacgtccaagaaccacttctccctgaagctgagctctgtgaccgccgcagacacggctgtgtattactgtgcgagaga
+>IGHV4-39*03
+cagctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggctggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggccgtgtattactg
+>IGHV4-39*04
+..................................................................................gctccatcagc......agtagtagttactactggggctggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacac
+>IGHV4-39*05
+cagctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccccgtccctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggctggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggctgtgtattactgtgcg
+>IGHV4-39*06
+cggctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggctggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttccccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-39*07
+cagctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggctggatccgccagcccccagggaaggggctggagtggattgggagtatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-4*01
+caggtgcagctgcaggagtcgggccca...ggactggtgaagcctccggggaccctgtccctcacctgcgctgtctctggtggctccatcagc.........agtagtaactggtggagttgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt.........gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattgctgtgcgagaga
+>IGHV4-4*02
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggggaccctgtccctcacctgcgctgtctctggtggctccatcagc.........agtagtaactggtggagttgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt.........gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-4*03
+caggtgcagctgcaggagtcgggccca...ggactggtgaagcctccggggaccctgtccctcacctgcgctgtctctggtggctccatcagc.........agtagtaactggtggagttgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt.........gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactg
+>IGHV4-4*04
+caggtgcagctgcaggagtcgggccca...ggactggtgaagcctccggggaccctgtccctcacctgcgctatctctggtggctccatcagc.........agtagtaactggtggagttgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt.........gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactg
+>IGHV4-4*05
+caggtgcagctgcaggagttgggccca...ggactggtgaagcctccggggaccctgtccctcacctgcgctgtctctggtggctccatcagc.........agtagtaactggtggagttgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt.........gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactg
+>IGHV4-4*06
+............................................................
+...............tctggtggctccatcagc.........agtagtaactggtggagttgggtccgccagcccccagggannnggctggagtggattggggaaatctatcatagt.........gggagcaccaactacaacccgtccctcaag...agtcgagtcaccatgtcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-4*07
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatc............agtagttactactggagctggatccggcagcccgccgggaagggactggagtggattgggcgtatctataccagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatgtcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-4*08
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatc............agtagttactactggagctggatccggcagcccccagggaagggactggagtggattgggtatatctataccagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatccgtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggccgtgtattactgtgcgagaga
+>IGHV4-55*01
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatctgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtccgtagacacgtccaagaaccagttctacctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagata
+>IGHV4-55*02
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatctgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtcagtagacacgtccaagaaccagttctacctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagata
+>IGHV4-55*03
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatctgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactg
+>IGHV4-55*04
+caggtgcagctgcaggagtcgggccca...ggactggtgaagctttcggagaccctgtccctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatctgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtcagtagacacgtccaagaaccagttctacctgaagctgagctctgtgaccgccgcggacacggccgtgtattactg
+>IGHV4-55*05
+caggtgcagctgcaggagtcgggccca...ggactggtgaagctttcggagaccctgtccctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatctgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtccgtagacacgtccaagaaccagttctacctgaagctgagctctgtgaccgccgcggacacggccgtgtattactg
+>IGHV4-55*06
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatctgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtccgtagacacgtccaagaagcagttctacctgaagctgagctctgtgaccgctgcggacacggccgtgtattactg
+>IGHV4-55*07
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatctgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtccgtagacacgtccaggaaccagttctccctgaagctgagctctgtgaccgccgcagacacggccgtgtattactg
+>IGHV4-55*08
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatctgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtcagtagacacgtccaagaaccagttctacctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-55*09
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcatctgcgctgtctctggtgactccatcagc.........agtggtaactggtgaatctgggtccgccagcccccagggaaggggctggagtggattggggaaatccatcatagt.........gggagcacctactacaacccgtccctcaag...agtcgaatcaccatgtccgtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgtggacacggccgtgtattactgtgcgagaaa
+>IGHV4-59*01
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatc............agtagttactactggagctggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-59*02
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccgtc............agtagttactactggagctggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-59*03
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatc............agtagttactactggagctggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccaattctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcg
+>IGHV4-59*04
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatc............agtagttactactggagctggatccggcagcccccagggaagggactggagtggattgggtatatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatgtcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggctgtgtattactgtgcg
+>IGHV4-59*05
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatc............agtagttactactggagctggatccggcagccgccggggaagggactggagtggattgggcgtatctattatagt.........gggagcacctactacaacccgtccctcaag...agtcgagtcaccatatccgtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggctgtgtattactgtgcg
+>IGHV4-59*06
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtcactggtggctccatc............agtagttactactggagctggatccggcagcccgctgggaagggcctggagtggattgggtacatctattacagt.........gggagcacctactacaacccgtccctcaag...agtcgagttaccatatcagtagacacgtctaagaaccagttctccctgaagctgagctctgtgactgccgcggacacggccgtgtattactgtgcg
+>IGHV4-59*07
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggacaccctgtccctcacctgcactgtctctggtggctccatc............agtagttactactggagctggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcgaga
+>IGHV4-59*08
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatc............agtagttactactggagctggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggccgtgtattactgtgcgagaca
+>IGHV4-59*09
+...........................................................................tctggtggctccatc............agtagttactactggagctggatccggcagcccccaggnannngactggagtggattgggtatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcgagagg
+>IGHV4-59*10
+caggtgcagctacagcagtggggcgca...ggactgttgaagccttcggagaccctgtccctcacctgcgctgtctatggtggctccatc............agtagttactactggagctggatccggcagcccgccgggaaggggctggagtggattgggcgtatctataccagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatgtcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagata
+>IGHV4-61*01
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccgtcagc......agtggtagttactactggagctggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-61*02
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcacagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtggtagttactactggagctggatccggcagcccgccgggaagggactggagtggattgggcgtatctataccagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcagacacggccgtgtattactgtgcgagaga
+>IGHV4-61*03
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccgtcagc......agtggtagttactactggagctggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccacttctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcgagaga
+>IGHV4-61*04
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccgtcagc......agtggtagttactactggagctggatccggcagcccccagggaagggactggagtggattggatatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgct...gacacggccgtgtattactg
+>IGHV4-61*05
+cagctgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccatcagc......agtagtagttactactggggctggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgaga
+>IGHV4-61*06
+...........................................................................tctggtggctccgtcagc......agtggtagttactactggagctggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgccagaga
+>IGHV4-61*07
+...........................................................................tctggtggctccgtcagc......agtggtagttactactggagctggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcgagaca
+>IGHV4-61*08
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcactgtctctggtggctccgtcagc......agtggtggttactactggagctggatccggcagcccccagggaagggactggagtggattgggtatatctattacagt.........gggagcaccaactacaacccctccctcaag...agtcgagtcaccatatcagtagacacgtccaagaaccagttctccctgaagctgagctctgtgaccgctgcggacacggccgtgtattactgtgcgagaga
+>IGHV4/OR15-8*01
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcgttgtctctggtggctccatcagc.........agtagtaactggtggagctgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt.........gggagccccaactacaacccgtccctcaag...agtcgagtcaccatatcagtagacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV4/OR15-8*02
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcgttgtctctggtggctccatcagc.........agtagtaactggtggagctgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt.........gggaaccccaactacaacccgtccctcaag...agtcgagtcaccatatcaatagacaagtccaagaaccaattctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV4/OR15-8*03
+caggtgcagctgcaggagtcgggccca...ggactggtgaagccttcggagaccctgtccctcacctgcgttgtctctggtggctccatcagc.........agtagtaactggtggagctgggtccgccagcccccagggaaggggctggagtggattggggaaatctatcatagt.........gggagccccaactacaacccatccctcaag...agtcgagtcaccatatcagtagacaagtccaagaaccagttctccctgaagctgagctctgtgaccgccgcggacacggccgtgtattactgtgcgagaga
+>IGHV5-10-1*01
+gaagtgcagctggtgcagtctggagca...gaggtgaaaaagcccggggagtctctgaggatctcctgtaagggttctggatacagcttt............accagctactggatcagctgggtgcgccagatgcccgggaaaggcctggagtggatggggaggattgatcctagt......gactcttataccaactacagcccgtccttccaa...ggccacgtcaccatctcagctgacaagtccatcagcactgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgaga
+>IGHV5-10-1*02
+gaagtgcagctggtgcagtctggagca...gaggtgaaaaagcccggggagtctctgaggatctcctgtaagggttctggatacagcttt............accagctactggatcagctgggtgcgccagatgcccgggaaaggcttggagtggatggggaggattgatcctagt......gactcttataccaactacagcccgtccttccaa...ggccacgtcaccatctcagctgacaagtccatcagcactgcctacctgcagtggagcagcctgaaggc.tcggacaccgccatgtattactgtgcgagaca
+>IGHV5-10-1*03
+gaagtgcagctggtgcagtccggagca...gaggtgaaaaagcccggggagtctctgaggatctcctgtaagggttctggatacagcttt............accagctactggatcagctgggtgcgccagatgcccgggaaaggcctggagtggatggggaggattgatcctagt......gactcttataccaactacagcccgtccttccaa...ggccacgtcaccatctcagctgacaagtccatcagcactgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgaga
+>IGHV5-10-1*04
+gaagtgcagctggtgcagtctggagca...gaggtgaaaaagcccggggagtctctgaggatctcctgtaagggttctggatacagcttt............accagctactggatcagctgggtgcgccagatgcccgggaaaggcctggagtggatggggaggattgatcctagt......gactcttataccaactacagcccgtccttccaa...ggccaggtcaccatctcagctgacaagtccatcagcactgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgaga
+>IGHV5-51*01
+gaggtgcagctggtgcagtctggagca...gaggtgaaaaagcccggggagtctctgaagatctcctgtaagggttctggatacagcttt............accagctactggatcggctgggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggt......gactctgataccagatacagcccgtccttccaa...ggccaggtcaccatctcagccgacaagtccatcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgagaca
+>IGHV5-51*02
+gaggtgcagctggtgcagtctggagca...gaggtgaaaaagcccggggagtctctgaagatctcctgtaagggttctggatacagcttt............accagctactggaccggctgggtgcgccagatgcccgggaaaggcttggagtggatggggatcatctatcctggt......gactctgataccagatacagcccgtccttccaa...ggccaggtcaccatctcagccgacaagtccatcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgagaca
+>IGHV5-51*03
+gaggtgcagctggtgcagtctggagca...gaggtgaaaaagccgggggagtctctgaagatctcctgtaagggttctggatacagcttt............accagctactggatcggctgggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggt......gactctgataccagatacagcccgtccttccaa...ggccaggtcaccatctcagccgacaagtccatcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgaga
+>IGHV5-51*04
+gaggtgcagctggtgcagtctggagca...gaggtgaaaaagccgggggagtctctgaagatctcctgtaagggttctggatacagcttt............accagctactggatcggctgggtgcgccagatgcccgggaaaggcctggagtggatggggatcatctatcctggt......gactctgataccagatacagcccgtccttccaa...ggccaggtcaccatctcagccgacaagcccatcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgccatgtattactgtgcgaga
+>IGHV5-51*05
+.....................................aaaagcccggggagtctctgaagatctcctgtaagggttctggatacagcttt............accagctactggatcggctgggtgcgccagatgcccaggaaaggcctggagtggatggggatcatctatcctggt......gactctgataccagatacagcccgtccttccaa...ggccaggtcaccatctcagccgacaagtccatcagcaccgcctacctgcagtggagcagcctgaaggcctcggacaccgccatg
+>IGHV5-78*01
+gaggtgcagctgttgcagtctgcagca...gaggtgaaaagacccggggagtctctgaggatctcctgtaagacttctggatacagcttt............accagctactggatccactgggtgcgccagatgcccgggaaagaactggagtggatggggagcatctatcctggg......aactctgataccagatacagcccatccttccaa...ggccacgtcaccatctcagccgacagctccagcagcaccgcctacctgcagtggagcagcctgaaggcctcggacgccgccatgtattattgtgtgaga
+>IGHV6-1*01
+caggtacagctgcagcagtcaggtcca...ggactggtgaagccctcgcagaccctctcactcacctgtgccatctccggggacagtgtctct......agcaacagtgctgcttggaactggatcaggcagtccccatcgagaggccttgagtggctgggaaggacatactacaggtcc...aagtggtataatgattatgcagtatctgtgaaa...agtcgaataaccatcaacccagacacatccaagaaccagttctccctgcagctgaactctgtgactcccgaggacacggctgtgtattactgtgcaagaga
+>IGHV6-1*02
+caggtacagctgcagcagtcaggtccg...ggactggtgaagccctcgcagaccctctcactcacctgtgccatctccggggacagtgtctct......agcaacagtgctgcttggaactggatcaggcagtccccatcgagaggccttgagtggctgggaaggacatactacaggtcc...aagtggtataatgattatgcagtatctgtgaaa...agtcgaataaccatcaacccagacacatccaagaaccagttctccctgcagctgaactctgtgactcccgaggacacggctgtgtattactgtgcaagaga
+>IGHV7-34-1*01
+...ctgcagctggtgcagtctgggcct...gaggtgaagaagcctggggcctcagtgaaggtctcctataagtcttctggttacaccttc............accatctatggtatgaattgggtatgatagacccctggacagggctttgagtggatgtgatggatcatcacctac......actgggaacccaacgtatacccacggcttcaca...ggatggtttgtcttctccatggacacgtctgtcagcacggcgtgtcttcagatcagcagcctaaaggctgaggacacggccgagtattactgtgcgaagta
+>IGHV7-34-1*02
+...ctgcagctggtgcagtctgggcct...gaggtgaagaagcctggggcctcagtgaaggtctcctataagtcttctggttacaccttc............accatctatggtatgaattgggtatgatagacccctggacagggctttgagtggatgtgatggatcatcacctac......aatgggaacccaacgtatacccacggcttcaca...ggatggtttgtcttctccatggacacgtctgtcagcacggcgtgtcttcagatcagcagcctaaaggctgaggacacggccgagtattactgtgcgaagta
+>IGHV7-4-1*01
+caggtgcagctggtgcaatctgggtct...gagttgaagaagcctggggcctcagtgaaggtttcctgcaaggcttctggatacaccttc............actagctatgctatgaattgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacaccaac......actgggaacccaacgtatgcccagggcttcaca...ggacggtttgtcttctccttggacacctctgtcagcacggcatatctgcagatctgcagcctaaaggctgaggacactgccgtgtattactgtgcgaga
+>IGHV7-4-1*02
+caggtgcagctggtgcaatctgggtct...gagttgaagaagcctggggcctcagtgaaggtttcctgcaaggcttctggatacaccttc............actagctatgctatgaattgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacaccaac......actgggaacccaacgtatgcccagggcttcaca...ggacggtttgtcttctccttggacacctctgtcagcacggcatatctgcagatcagcagcctaaaggctgaggacactgccgtgtattactgtgcgagaga
+>IGHV7-4-1*03
+caggtgcagctggtgcaatctgggtct...gagttgaagaagcctggggcctcagtgaaggtttcctgcaaggcttctggatacaccttc............actagctatgctatgaattgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacaccaac......actgggaacccaacgtatgcccagggcttcaca...ggacggtttgtcttctccttggacacctctgtcagcacggcatatctgcagatcagcacgctaaaggctgaggacactg
+>IGHV7-4-1*04
+caggtgcagctggtgcaatctgggtct...gagttgaagaagcctggggcctcagtgaaggtttcctgcaaggcttctggatacaccttc............actagctatgctatgaattgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacaccaac......actgggaacccaacgtatgcccagggcttcaca...ggacggtttgtcttctccttggacacctctgtcagcatggcatatctgcagatcagcagcctaaaggctgaggacactgccgtgtattactgtgcgagaga
+>IGHV7-4-1*05
+caggtgcagctggtgcaatctgggtct...gagttgaagaagcctggggcctcagtgaaggtttcctgcaaggcttctggatacaccttc............actagctatgctatgaattgggtgcgacaggcccctggacaagggcttgagtggatgggatggatcaacaccaac......actgggaacccaacgtatgcccagggcttcaca...ggacggtttgtcttctccttggacacctctgtcagcatggcatatctgcagatcagcagcctaaaggctgaggacactgccgtgtgttactgtgcgagaga
+>AIGHV7-40*03|
+ttttcaatagaaaagtcaaataatcta...agtgtcaatcagtggatgattagataaaatatgatatatgtaaatcatggaatactatgc............agccagtatggtatgaattcagtgtgaccagcccctggacaagggcttgagtggatgggatggatcatcacctac......actgggaacccaacatataccaacggcttcaca...ggacggtttctattctccatggacacctctgtcagcatggcgtatctgcagatcagcagcctaaaggctgaggacacggccgtgtatgactgtatgagaga
+>IGHV7-81*01
+caggtgcagctggtgcagtctggccat...gaggtgaagcagcctggggcctcagtgaaggtctcctgcaaggcttctggttacagtttc............accacctatggtatgaattgggtgccacaggcccctggacaagggcttgagtggatgggatggttcaacacctac......actgggaacccaacatatgcccagggcttcaca...ggacggtttgtcttctccatggacacctctgccagcacagcatacctgcagatcagcagcctaaaggctgaggacatggccatgtattactgtgcgagata
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/baseline/comparePDFs.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,225 @@
+options("warn"=-1)
+
+#from http://selection.med.yale.edu/baseline/Archive/Baseline%20Version%201.3/Baseline_Functions_Version1.3.r
+# Compute p-value of two distributions
+compareTwoDistsFaster <-function(sigma_S=seq(-20,20,length.out=4001), N=10000, dens1=runif(4001,0,1), dens2=runif(4001,0,1)){
+#print(c(length(dens1),length(dens2)))
+if(length(dens1)>1 & length(dens2)>1 ){
+	dens1<-dens1/sum(dens1)
+	dens2<-dens2/sum(dens2)
+	cum2 <- cumsum(dens2)-dens2/2
+	tmp<- sum(sapply(1:length(dens1),function(i)return(dens1[i]*cum2[i])))
+	#print(tmp)
+	if(tmp>0.5)tmp<-tmp-1
+	return( tmp )
+	}
+	else {
+	return(NA)
+	}
+	#return (sum(sapply(1:N,function(i)(sample(sigma_S,1,prob=dens1)>sample(sigma_S,1,prob=dens2))))/N)
+}  
+
+
+require("grid")
+arg <- commandArgs(TRUE)
+#arg <- c("300143","4","5")
+arg[!arg=="clonal"]
+input <- arg[1]
+output <- arg[2]
+rowIDs <- as.numeric(  sapply(arg[3:(max(3,length(arg)))],function(x){ gsub("chkbx","",x) } )  )
+
+numbSeqs = length(rowIDs)
+
+if ( is.na(rowIDs[1]) | numbSeqs>10 ) {
+  stop( paste("Error: Please select between one and 10 seqeunces to compare.") )
+}
+
+#load( paste("output/",sessionID,".RData",sep="") )
+load( input )
+#input
+
+xMarks = seq(-20,20,length.out=4001)
+
+plot_grid_s<-function(pdf1,pdf2,Sample=100,cex=1,xlim=NULL,xMarks = seq(-20,20,length.out=4001)){
+  yMax = max(c(abs(as.numeric(unlist(listPDFs[pdf1]))),abs(as.numeric(unlist(listPDFs[pdf2]))),0),na.rm=T) * 1.1
+
+  if(length(xlim==2)){
+    xMin=xlim[1]
+    xMax=xlim[2]
+  } else {
+    xMin_CDR = xMarks[listPDFs[pdf1][[1]][["CDR"]]>0.001][1]
+    xMin_FWR = xMarks[listPDFs[pdf1][[1]][["FWR"]]>0.001][1]
+    xMax_CDR = xMarks[listPDFs[pdf1][[1]][["CDR"]]>0.001][length(xMarks[listPDFs[pdf1][[1]][["CDR"]]>0.001])]
+    xMax_FWR = xMarks[listPDFs[pdf1][[1]][["FWR"]]>0.001][length(xMarks[listPDFs[pdf1][[1]][["FWR"]]>0.001])]
+  
+    xMin_CDR2 = xMarks[listPDFs[pdf2][[1]][["CDR"]]>0.001][1]
+    xMin_FWR2 = xMarks[listPDFs[pdf2][[1]][["FWR"]]>0.001][1]
+    xMax_CDR2 = xMarks[listPDFs[pdf2][[1]][["CDR"]]>0.001][length(xMarks[listPDFs[pdf2][[1]][["CDR"]]>0.001])]
+    xMax_FWR2 = xMarks[listPDFs[pdf2][[1]][["FWR"]]>0.001][length(xMarks[listPDFs[pdf2][[1]][["FWR"]]>0.001])]
+  
+    xMin=min(c(xMin_CDR,xMin_FWR,xMin_CDR2,xMin_FWR2,0),na.rm=TRUE)
+    xMax=max(c(xMax_CDR,xMax_FWR,xMax_CDR2,xMax_FWR2,0),na.rm=TRUE)
+  }
+
+  sigma<-approx(xMarks,xout=seq(xMin,xMax,length.out=Sample))$x
+  grid.rect(gp = gpar(col=gray(0.6),fill="white",cex=cex))
+  x <- sigma
+  pushViewport(viewport(x=0.175,y=0.175,width=0.825,height=0.825,just=c("left","bottom"),default.units="npc"))
+  #pushViewport(plotViewport(c(1.8, 1.8, 0.25, 0.25)*cex))
+  pushViewport(dataViewport(x, c(yMax,-yMax),gp = gpar(cex=cex),extension=c(0.05)))
+  grid.polygon(c(0,0,1,1),c(0,0.5,0.5,0),gp=gpar(col=grey(0.95),fill=grey(0.95)),default.units="npc")
+  grid.polygon(c(0,0,1,1),c(1,0.5,0.5,1),gp=gpar(col=grey(0.9),fill=grey(0.9)),default.units="npc")
+  grid.rect()
+  grid.xaxis(gp = gpar(cex=cex/1.1))
+  yticks = pretty(c(-yMax,yMax),8)
+  yticks = yticks[yticks>(-yMax) & yticks<(yMax)]
+  grid.yaxis(at=yticks,label=abs(yticks),gp = gpar(cex=cex/1.1))
+  if(length(listPDFs[pdf1][[1]][["CDR"]])>1){
+    ycdr<-approx(xMarks,listPDFs[pdf1][[1]][["CDR"]],xout=seq(xMin,xMax,length.out=Sample),yleft=0,yright=0)$y
+    grid.lines(unit(x,"native"), unit(ycdr,"native"),gp=gpar(col=2,lwd=2))
+  }
+  if(length(listPDFs[pdf1][[1]][["FWR"]])>1){
+    yfwr<-approx(xMarks,listPDFs[pdf1][[1]][["FWR"]],xout=seq(xMin,xMax,length.out=Sample),yleft=0,yright=0)$y
+    grid.lines(unit(x,"native"), unit(-yfwr,"native"),gp=gpar(col=4,lwd=2))
+   }
+
+  if(length(listPDFs[pdf2][[1]][["CDR"]])>1){
+    ycdr2<-approx(xMarks,listPDFs[pdf2][[1]][["CDR"]],xout=seq(xMin,xMax,length.out=Sample),yleft=0,yright=0)$y
+    grid.lines(unit(x,"native"), unit(ycdr2,"native"),gp=gpar(col=2,lwd=2,lty=2))
+  }
+  if(length(listPDFs[pdf2][[1]][["FWR"]])>1){
+    yfwr2<-approx(xMarks,listPDFs[pdf2][[1]][["FWR"]],xout=seq(xMin,xMax,length.out=Sample),yleft=0,yright=0)$y
+    grid.lines(unit(x,"native"), unit(-yfwr2,"native"),gp=gpar(col=4,lwd=2,lty=2))
+   }
+
+  grid.lines(unit(c(0,1),"npc"), unit(c(0.5,0.5),"npc"),gp=gpar(col=1))
+  grid.lines(unit(c(0,0),"native"), unit(c(0,1),"npc"),gp=gpar(col=1,lwd=1,lty=3))
+
+  grid.text("Density", x = unit(-2.5, "lines"), rot = 90,gp = gpar(cex=cex))
+  grid.text( expression(paste("Selection Strength (", Sigma, ")", sep="")) , y = unit(-2.5, "lines"),gp = gpar(cex=cex))
+  
+  if(pdf1==pdf2 & length(listPDFs[pdf2][[1]][["FWR"]])>1 & length(listPDFs[pdf2][[1]][["CDR"]])>1 ){
+    pCDRFWR = compareTwoDistsFaster(sigma_S=xMarks, N=10000, dens1=listPDFs[[pdf1]][["CDR"]], dens2=listPDFs[[pdf1]][["FWR"]])       
+    pval = formatC(as.numeric(pCDRFWR),digits=3)
+    grid.text( substitute(expression(paste(P[CDR/FWR], "=", x, sep="")),list(x=pval))[[2]] , x = unit(0.02, "npc"),y = unit(0.98, "npc"),just=c("left", "top"),gp = gpar(cex=cex*1.2))
+  }
+  grid.text(paste("CDR"), x = unit(0.98, "npc"),y = unit(0.98, "npc"),just=c("right", "top"),gp = gpar(cex=cex*1.5))
+  grid.text(paste("FWR"), x = unit(0.98, "npc"),y = unit(0.02, "npc"),just=c("right", "bottom"),gp = gpar(cex=cex*1.5))
+  popViewport(2)
+}
+#plot_grid_s(1)
+
+
+p2col<-function(p=0.01){
+  breaks=c(-.51,-0.1,-.05,-0.01,-0.005,0,0.005,0.01,0.05,0.1,0.51)
+  i<-findInterval(p,breaks)
+  cols = c( rgb(0.8,1,0.8), rgb(0.6,1,0.6), rgb(0.4,1,0.4), rgb(0.2,1,0.2) , rgb(0,1,0),
+            rgb(1,0,0), rgb(1,.2,.2), rgb(1,.4,.4), rgb(1,.6,.6) , rgb(1,.8,.8) )
+  return(cols[i])
+}
+
+
+plot_pvals<-function(pdf1,pdf2,cex=1,upper=TRUE){
+  if(upper){
+    pCDR1FWR2 = compareTwoDistsFaster(sigma_S=xMarks, N=10000, dens1=listPDFs[[pdf1]][["CDR"]], dens2=listPDFs[[pdf2]][["FWR"]])       
+    pFWR1FWR2 = compareTwoDistsFaster(sigma_S=xMarks, N=10000, dens1=listPDFs[[pdf1]][["FWR"]], dens2=listPDFs[[pdf2]][["FWR"]])
+    pFWR1CDR2 = compareTwoDistsFaster(sigma_S=xMarks, N=10000, dens2=listPDFs[[pdf2]][["CDR"]], dens1=listPDFs[[pdf1]][["FWR"]])       
+    pCDR1CDR2 = compareTwoDistsFaster(sigma_S=xMarks, N=10000, dens2=listPDFs[[pdf2]][["CDR"]], dens1=listPDFs[[pdf1]][["CDR"]])
+    grid.polygon(c(0.5,0.5,1,1),c(0,0.5,0.5,0),gp=gpar(col=p2col(pFWR1FWR2),fill=p2col(pFWR1FWR2)),default.units="npc")
+    grid.polygon(c(0.5,0.5,1,1),c(1,0.5,0.5,1),gp=gpar(col=p2col(pCDR1FWR2),fill=p2col(pCDR1FWR2)),default.units="npc")
+    grid.polygon(c(0.5,0.5,0,0),c(1,0.5,0.5,1),gp=gpar(col=p2col(pCDR1CDR2),fill=p2col(pCDR1CDR2)),default.units="npc")
+    grid.polygon(c(0.5,0.5,0,0),c(0,0.5,0.5,0),gp=gpar(col=p2col(pFWR1CDR2),fill=p2col(pFWR1CDR2)),default.units="npc")
+         
+    grid.lines(c(0,1),0.5,gp=gpar(lty=2,col=gray(0.925)))
+    grid.lines(0.5,c(0,1),gp=gpar(lty=2,col=gray(0.925)))
+
+    grid.text(formatC(as.numeric(pFWR1FWR2),digits=3), x = unit(0.75, "npc"),y = unit(0.25, "npc"),just=c("center", "center"),gp = gpar(cex=cex))
+    grid.text(formatC(as.numeric(pCDR1FWR2),digits=3), x = unit(0.75, "npc"),y = unit(0.75, "npc"),just=c("center", "center"),gp = gpar(cex=cex))
+    grid.text(formatC(as.numeric(pCDR1CDR2),digits=3), x = unit(0.25, "npc"),y = unit(0.75, "npc"),just=c("center", "center"),gp = gpar(cex=cex))
+    grid.text(formatC(as.numeric(pFWR1CDR2),digits=3), x = unit(0.25, "npc"),y = unit(0.25, "npc"),just=c("center", "center"),gp = gpar(cex=cex))
+    
+           
+ #   grid.text(paste("P = ",formatC(pCDRFWR,digits=3)), x = unit(0.5, "npc"),y = unit(0.98, "npc"),just=c("center", "top"),gp = gpar(cex=cex))
+ #   grid.text(paste("P = ",formatC(pFWRFWR,digits=3)), x = unit(0.5, "npc"),y = unit(0.02, "npc"),just=c("center", "bottom"),gp = gpar(cex=cex))
+  }
+  else{
+  }
+}
+
+
+##################################################################################
+################## The whole OCD's matrix ########################################
+##################################################################################
+
+#pdf(width=4*numbSeqs+1/3,height=4*numbSeqs+1/3)
+pdf( output ,width=4*numbSeqs+1/3,height=4*numbSeqs+1/3) 
+
+pushViewport(viewport(x=0.02,y=0.02,just = c("left", "bottom"),w =0.96,height=0.96,layout = grid.layout(numbSeqs+1,numbSeqs+1,widths=unit.c(unit(rep(1,numbSeqs),"null"),unit(4,"lines")),heights=unit.c(unit(4,"lines"),unit(rep(1,numbSeqs),"null")))))
+
+for( seqOne in 1:numbSeqs+1){
+  pushViewport(viewport(layout.pos.col = seqOne-1, layout.pos.row = 1))
+  if(seqOne>2){ 
+    grid.polygon(c(0,0,0.5,0.5),c(0,0.5,0.5,0),gp=gpar(col=grey(0.5),fill=grey(0.9)),default.units="npc")
+    grid.polygon(c(1,1,0.5,0.5),c(0,0.5,0.5,0),gp=gpar(col=grey(0.5),fill=grey(0.95)),default.units="npc")
+    grid.polygon(c(0,0,1,1),c(1,0.5,0.5,1),gp=gpar(col=grey(0.5)),default.units="npc")
+       
+    grid.text(y=.25,x=0.75,"FWR",gp = gpar(cex=1.5),just="center")
+    grid.text(y=.25,x=0.25,"CDR",gp = gpar(cex=1.5),just="center")
+  }
+  grid.rect(gp = gpar(col=grey(0.9)))
+  grid.text(y=.75,substr(paste(names(listPDFs)[rowIDs[seqOne-1]]),1,16),gp = gpar(cex=2),just="center")
+  popViewport(1)
+}
+
+for( seqOne in 1:numbSeqs+1){
+  pushViewport(viewport(layout.pos.row = seqOne, layout.pos.col = numbSeqs+1))
+  if(seqOne<=numbSeqs){   
+    grid.polygon(c(0,0.5,0.5,0),c(0,0,0.5,0.5),gp=gpar(col=grey(0.5),fill=grey(0.95)),default.units="npc")
+    grid.polygon(c(0,0.5,0.5,0),c(1,1,0.5,0.5),gp=gpar(col=grey(0.5),fill=grey(0.9)),default.units="npc")
+    grid.polygon(c(1,0.5,0.5,1),c(0,0,1,1),gp=gpar(col=grey(0.5)),default.units="npc")
+    grid.text(x=.25,y=0.75,"CDR",gp = gpar(cex=1.5),just="center",rot=270)
+    grid.text(x=.25,y=0.25,"FWR",gp = gpar(cex=1.5),just="center",rot=270)
+  }
+  grid.rect(gp = gpar(col=grey(0.9)))
+  grid.text(x=0.75,substr(paste(names(listPDFs)[rowIDs[seqOne-1]]),1,16),gp = gpar(cex=2),rot=270,just="center")
+  popViewport(1)
+}
+
+for( seqOne in 1:numbSeqs+1){
+  for(seqTwo in 1:numbSeqs+1){
+    pushViewport(viewport(layout.pos.col = seqTwo-1, layout.pos.row = seqOne))
+    if(seqTwo>seqOne){
+      plot_pvals(rowIDs[seqOne-1],rowIDs[seqTwo-1],cex=2)
+      grid.rect()
+    }    
+    popViewport(1)
+  }
+}
+   
+
+xMin=0
+xMax=0.01
+for(pdf1 in rowIDs){
+  xMin_CDR = xMarks[listPDFs[pdf1][[1]][["CDR"]]>0.001][1]
+  xMin_FWR = xMarks[listPDFs[pdf1][[1]][["FWR"]]>0.001][1]
+  xMax_CDR = xMarks[listPDFs[pdf1][[1]][["CDR"]]>0.001][length(xMarks[listPDFs[pdf1][[1]][["CDR"]]>0.001])]
+  xMax_FWR = xMarks[listPDFs[pdf1][[1]][["FWR"]]>0.001][length(xMarks[listPDFs[pdf1][[1]][["FWR"]]>0.001])]
+  xMin=min(c(xMin_CDR,xMin_FWR,xMin),na.rm=TRUE)
+  xMax=max(c(xMax_CDR,xMax_FWR,xMax),na.rm=TRUE)
+}
+
+
+
+for(i in 1:numbSeqs+1){
+  for(j in (i-1):numbSeqs){    
+    pushViewport(viewport(layout.pos.col = i-1, layout.pos.row = j+1))
+    grid.rect()
+    plot_grid_s(rowIDs[i-1],rowIDs[j],cex=1)
+    popViewport(1)
+  }
+}
+
+dev.off() 
+
+cat("Success", paste(rowIDs,collapse="_"),sep=":")
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/baseline/filter.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,35 @@
+arg = commandArgs(TRUE)
+summaryfile = arg[1]
+gappedfile = arg[2]
+selection = arg[3]
+output = arg[4]
+print(paste("selection = ", selection))
+
+
+summarydat = read.table(summaryfile, header=T, sep="\t", fill=T, stringsAsFactors=F)
+gappeddat = read.table(gappedfile, header=T, sep="\t", fill=T, stringsAsFactors=F)
+
+#dat = data.frame(merge(gappeddat, summarydat, by="Sequence.ID", all.x=T))
+
+dat = cbind(gappeddat, summarydat$AA.JUNCTION)
+
+colnames(dat)[length(dat)] = "AA.JUNCTION"
+
+dat$VGene = gsub("^Homsap ", "", dat$V.GENE.and.allele)
+dat$VGene = gsub("[*].*", "", dat$VGene)
+
+dat$DGene = gsub("^Homsap ", "", dat$D.GENE.and.allele)
+dat$DGene = gsub("[*].*", "", dat$DGene)
+
+dat$JGene = gsub("^Homsap ", "", dat$J.GENE.and.allele)
+dat$JGene = gsub("[*].*", "", dat$JGene)
+
+#print(str(dat))
+
+dat$past = do.call(paste, c(dat[unlist(strsplit(selection, ","))], sep = ":"))
+
+dat = dat[!duplicated(dat$past), ]
+
+dat = dat[dat$Functionality != "No results" & dat$Functionality != "unproductive",]
+
+write.table(x=dat, file=output, sep="\t",quote=F,row.names=F,col.names=T)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/baseline/script_imgt.py	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,79 @@
+#import xlrd #avoid dep
+import argparse
+import re
+
+parser = argparse.ArgumentParser()
+parser.add_argument("--input", help="Excel input file containing one or more sheets where column G has the gene annotation, H has the sequence id and J has the sequence")
+parser.add_argument("--ref", help="Reference file")
+parser.add_argument("--output", help="Output file")
+parser.add_argument("--id", help="ID to be used at the '>>>' line in the output")
+
+args = parser.parse_args()
+
+refdic = dict()
+with open(args.ref, 'r') as ref:
+	currentSeq = ""
+	currentId = ""
+	for line in ref:
+		if line[0] is ">":
+			if currentSeq is not "" and currentId is not "":
+				refdic[currentId[1:]] = currentSeq
+			currentId = line.rstrip()
+			currentSeq = ""
+		else:
+			currentSeq += line.rstrip()
+	refdic[currentId[1:]] = currentSeq
+	
+
+vPattern = [r"(IGHV[0-9]-[0-9ab]+-?[0-9]?D?\*\d{1,2})"]#,
+#						r"(TRBV[0-9]{1,2}-?[0-9]?-?[123]?)",
+#						r"(IGKV[0-3]D?-[0-9]{1,2})",
+#						r"(IGLV[0-9]-[0-9]{1,2})",
+#						r"(TRAV[0-9]{1,2}(-[1-46])?(/DV[45678])?)",
+#						r"(TRGV[234589])",
+#						r"(TRDV[1-3])"]
+
+#vPattern = re.compile(r"|".join(vPattern))
+vPattern = re.compile("|".join(vPattern))
+
+def filterGene(s, pattern):
+    if type(s) is not str:
+        return None
+    res = pattern.search(s)
+    if res:
+        return res.group(0)
+    return None
+
+
+
+currentSeq = ""
+currentId = ""
+first=True
+with open(args.input, 'r') as i:
+	with open(args.output, 'a') as o:
+		o.write(">>>" + args.id + "\n")
+		outputdic = dict()
+		for line in i:
+			if first:
+				first = False
+				continue
+			linesplt = line.split("\t")
+			ref = filterGene(linesplt[1], vPattern)
+			if not ref or not linesplt[2].rstrip():
+				continue
+			if ref in outputdic:
+				outputdic[ref] += [(linesplt[0].replace(">", ""), linesplt[2].replace(">", "").rstrip())]
+			else:
+				outputdic[ref] = [(linesplt[0].replace(">", ""), linesplt[2].replace(">", "").rstrip())]
+		#print outputdic
+		
+		for k in outputdic.keys():
+			if k in refdic:
+				o.write(">>" + k + "\n")
+				o.write(refdic[k] + "\n")
+				for seq in outputdic[k]:
+					#print seq
+					o.write(">" + seq[0] + "\n")
+					o.write(seq[1] + "\n")
+			else:
+				print k + " not in reference, skipping " + k
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/baseline/script_xlsx.py	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,58 @@
+import xlrd
+import argparse
+
+parser = argparse.ArgumentParser()
+parser.add_argument("--input", help="Excel input file containing one or more sheets where column G has the gene annotation, H has the sequence id and J has the sequence")
+parser.add_argument("--ref", help="Reference file")
+parser.add_argument("--output", help="Output file")
+
+args = parser.parse_args()
+
+gene_column = 6
+id_column = 7
+seq_column = 8
+LETTERS = [x for x in "ABCDEFGHIJKLMNOPQRSTUVWXYZ"]
+
+
+refdic = dict()
+with open(args.ref, 'r') as ref:
+	currentSeq = ""
+	currentId = ""
+	for line in ref.readlines():
+		if line[0] is ">":
+			if currentSeq is not "" and currentId is not "":
+				refdic[currentId[1:]] = currentSeq
+			currentId = line.rstrip()
+			currentSeq = ""
+		else:
+			currentSeq += line.rstrip()
+	refdic[currentId[1:]] = currentSeq
+	
+currentSeq = ""
+currentId = ""
+with xlrd.open_workbook(args.input, 'r') as wb:
+	with open(args.output, 'a') as o:
+		for sheet in wb.sheets():
+			if sheet.cell(1,gene_column).value.find("IGHV") < 0:
+				print "Genes not in column " + LETTERS[gene_column] + ", skipping sheet " + sheet.name
+				continue
+			o.write(">>>" + sheet.name + "\n")
+			outputdic = dict()
+			for rowindex in range(1, sheet.nrows):
+				ref = sheet.cell(rowindex, gene_column).value.replace(">", "")
+				if ref in outputdic:
+					outputdic[ref] += [(sheet.cell(rowindex, id_column).value.replace(">", ""), sheet.cell(rowindex, seq_column).value)]
+				else:
+					outputdic[ref] = [(sheet.cell(rowindex, id_column).value.replace(">", ""), sheet.cell(rowindex, seq_column).value)]
+			#print outputdic
+			
+			for k in outputdic.keys():
+				if k in refdic:
+					o.write(">>" + k + "\n")
+					o.write(refdic[k] + "\n")
+					for seq in outputdic[k]:
+						#print seq
+						o.write(">" + seq[0] + "\n")
+						o.write(seq[1] + "\n")
+				else:
+					print k + " not in reference, skipping " + k
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/baseline/wrapper.sh	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,104 @@
+#!/bin/bash
+dir="$(cd "$(dirname "$0")" && pwd)"
+
+testID=$1
+species=$2
+substitutionModel=$3
+mutabilityModel=$4
+clonal=$5
+fixIndels=$6
+region=$7
+inputs=$8
+inputs=($inputs)
+IDs=$9
+IDs=($IDs)
+ref=${10}
+output=${11}
+selection=${12}
+output_table=${13}
+outID="result"
+
+echo "$PWD"
+
+echo "testID = $testID"
+echo "species = $species"
+echo "substitutionModel = $substitutionModel"
+echo "mutabilityModel = $mutabilityModel"
+echo "clonal = $clonal"
+echo "fixIndels = $fixIndels"
+echo "region = $region"
+echo "inputs = ${inputs[@]}"
+echo "IDs = ${IDs[@]}"
+echo "ref = $ref"
+echo "output = $output"
+echo "outID = $outID"
+
+fasta="$PWD/baseline.fasta"
+
+
+count=0
+for current in ${inputs[@]}
+do
+	f=$(file $current)
+	zipType="Zip archive"
+	if [[ "$f" == *"$zipType"* ]] || [[ "$f" == *"XZ compressed data"* ]]
+	then
+		id=${IDs[$count]}
+		echo "id=$id"
+		if [[ "$f" == *"Zip archive"* ]] ; then
+			echo "Zip archive"
+			echo "unzip $input -d $PWD/files/"
+			unzip $current -d "$PWD/$id/"
+		elif [[ "$f" == *"XZ compressed data"* ]] ; then
+			echo "ZX archive"
+			echo "tar -xJf $input -C $PWD/files/"
+			mkdir -p "$PWD/$id/files"
+			tar -xJf $current -C "$PWD/$id/files/"
+		fi
+		summaryfile="$PWD/summary_${id}.txt"
+		gappedfile="$PWD/gappednt_${id}.txt"
+		filtered="$PWD/filtered_${id}.txt"
+		filecount=`ls -l $PWD/$id/ | wc -l`
+		if [[ "$filecount" -eq "2" ]]
+		then
+			cat $PWD/$id/*/1_* > $summaryfile
+			cat $PWD/$id/*/2_* > $gappedfile
+		else
+			cat $PWD/$id/1_* > $summaryfile
+			cat $PWD/$id/2_* > $gappedfile
+		fi
+		Rscript $dir/filter.r $summaryfile $gappedfile "$selection" $filtered 2>&1
+		
+		final="$PWD/final_${id}.txt"
+		cat $filtered | cut -f2,4,7 > $final
+		python $dir/script_imgt.py --input $final --ref $ref --output $fasta --id $id
+	else
+		python $dir/script_xlsx.py --input $current --ref $ref --output $fasta
+	fi
+	count=$((count+1))
+done
+
+if [[ $(wc -l < $fasta) -eq "1" ]]; then
+	echo "No sequences in the fasta file, exiting"
+	exit 0
+fi
+
+workdir="$PWD"
+cd $dir
+echo "file: ${inputs[0]}"
+#Rscript --verbose $dir/Baseline_Main.r $testID $species $substitutionModel $mutabilityModel $clonal $fixIndels $region ${inputs[0]} $workdir/ $outID 2>&1
+Rscript --verbose $dir/Baseline_Main.r $testID $species $substitutionModel $mutabilityModel $clonal $fixIndels $region $fasta $workdir/ $outID 2>&1
+
+echo "$workdir/${outID}.txt"
+
+rows=`tail -n +2 $workdir/${outID}.txt | grep -v "All sequences combined" | grep -n 'Group' | grep -Eoh '^[0-9]+' | tr '\n' ' '`
+rows=($rows)
+#unset rows[${#rows[@]}-1]
+
+cd $dir
+Rscript --verbose $dir/comparePDFs.r $workdir/${outID}.RData $output ${rows[@]} 2>&1
+cp $workdir/result.txt ${output_table}
+
+
+
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/change_o/DefineClones.py	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,1052 @@
+#!/usr/bin/env python3
+"""
+Assign Ig sequences into clones
+"""
+# Info
+__author__ = 'Namita Gupta, Jason Anthony Vander Heiden, Gur Yaari, Mohamed Uduman'
+from changeo import __version__, __date__
+
+# Imports
+import os
+import re
+import sys
+import numpy as np
+from argparse import ArgumentParser
+from collections import OrderedDict
+from itertools import chain
+from textwrap import dedent
+from time import time
+from Bio import pairwise2
+from Bio.Seq import translate
+
+# Presto and changeo imports
+from presto.Defaults import default_out_args
+from presto.IO import getFileType, getOutputHandle, printLog, printProgress
+from presto.Multiprocessing import manageProcesses
+from presto.Sequence import getDNAScoreDict
+from changeo.Commandline import CommonHelpFormatter, getCommonArgParser, parseCommonArgs
+from changeo.Distance import getDNADistMatrix, getAADistMatrix, \
+                             hs1f_model, m1n_model, hs5f_model, \
+                             calcDistances, formClusters
+from changeo.IO import getDbWriter, readDbFile, countDbFile
+from changeo.Multiprocessing import DbData, DbResult
+
+# Defaults
+default_translate = False
+default_distance = 0.0
+default_bygroup_model = 'hs1f'
+default_hclust_model = 'chen2010'
+default_seq_field = 'JUNCTION'
+default_norm = 'len'
+default_sym = 'avg'
+default_linkage = 'single'
+
+# TODO:  should be in Distance, but need to be after function definitions
+# Amino acid Hamming distance
+aa_model = getAADistMatrix(mask_dist=1, gap_dist=0)
+
+# DNA Hamming distance
+ham_model = getDNADistMatrix(mask_dist=0, gap_dist=0)
+
+
+# TODO:  this function is an abstraction to facilitate later cleanup
+def getModelMatrix(model):
+    """
+    Simple wrapper to get distance matrix from model name
+
+    Arguments:
+    model = model name
+
+    Return:
+    a pandas.DataFrame containing the character distance matrix
+    """
+    if model == 'aa':
+        return(aa_model)
+    elif model == 'ham':
+        return(ham_model)
+    elif model == 'm1n':
+        return(m1n_model)
+    elif model == 'hs1f':
+        return(hs1f_model)
+    elif model == 'hs5f':
+        return(hs5f_model)
+    else:
+        sys.stderr.write('Unrecognized distance model: %s.\n' % model)
+
+
+def indexJunctions(db_iter, fields=None, mode='gene', action='first'):
+    """
+    Identifies preclonal groups by V, J and junction length
+
+    Arguments: 
+    db_iter = an iterator of IgRecords defined by readDbFile
+    fields = additional annotation fields to use to group preclones;
+             if None use only V, J and junction length
+    mode = specificity of alignment call to use for assigning preclones;
+           one of ('allele', 'gene')
+    action = how to handle multiple value fields when assigning preclones;
+             one of ('first', 'set')
+    
+    Returns: 
+    a dictionary of {(V, J, junction length):[IgRecords]}
+    """
+    # Define functions for grouping keys
+    if mode == 'allele' and fields is None:
+        def _get_key(rec, act):
+            return (rec.getVAllele(act), rec.getJAllele(act),
+                    None if rec.junction is None else len(rec.junction))
+    elif mode == 'gene' and fields is None:
+        def _get_key(rec, act):  
+            return (rec.getVGene(act), rec.getJGene(act),
+                    None if rec.junction is None else len(rec.junction))
+    elif mode == 'allele' and fields is not None:
+        def _get_key(rec, act):
+            vdj = [rec.getVAllele(act), rec.getJAllele(act),
+                    None if rec.junction is None else len(rec.junction)]
+            ann = [rec.toDict().get(k, None) for k in fields]
+            return tuple(chain(vdj, ann))
+    elif mode == 'gene' and fields is not None:
+        def _get_key(rec, act):
+            vdj = [rec.getVGene(act), rec.getJGene(act),
+                    None if rec.junction is None else len(rec.junction)]
+            ann = [rec.toDict().get(k, None) for k in fields]
+            return tuple(chain(vdj, ann))
+
+    start_time = time()
+    clone_index = {}
+    rec_count = 0
+    for rec in db_iter:
+        key = _get_key(rec, action)
+
+        # Print progress
+        if rec_count == 0:
+            print('PROGRESS> Grouping sequences')
+
+        printProgress(rec_count, step=1000, start_time=start_time)
+        rec_count += 1
+
+        # Assigned passed preclone records to key and failed to index None
+        if all([k is not None and k != '' for k in key]):
+            #print key
+            # TODO:  Has much slow. Should have less slow.
+            if action == 'set':
+                
+                f_range = list(range(2, 3 + (len(fields) if fields else 0)))
+                vdj_range = list(range(2))
+                
+                # Check for any keys that have matching columns and junction length and overlapping genes/alleles
+                to_remove = []
+                if len(clone_index) > (1 if None in clone_index else 0) and key not in clone_index:
+                    key = list(key)
+                    for k in clone_index:
+                        if k is not None and all([key[i] == k[i] for i in f_range]):
+                            if all([not set(key[i]).isdisjoint(set(k[i])) for i in vdj_range]):
+                                for i in vdj_range:  key[i] = tuple(set(key[i]).union(set(k[i])))
+                                to_remove.append(k)
+                
+                # Remove original keys, replace with union of all genes/alleles and append values to new key
+                val = [rec]
+                val += list(chain(*(clone_index.pop(k) for k in to_remove)))
+                clone_index[tuple(key)] = clone_index.get(tuple(key),[]) + val 
+
+            elif action == 'first':
+                clone_index.setdefault(key, []).append(rec)
+        else:
+            clone_index.setdefault(None, []).append(rec)
+
+    printProgress(rec_count, step=1000, start_time=start_time, end=True)
+
+    return clone_index
+
+
+def distanceClones(records, model=default_bygroup_model, distance=default_distance,
+                   dist_mat=None, norm=default_norm, sym=default_sym,
+                   linkage=default_linkage, seq_field=default_seq_field):
+    """
+    Separates a set of IgRecords into clones
+
+    Arguments: 
+    records = an iterator of IgRecords
+    model = substitution model used to calculate distance
+    distance = the distance threshold to assign clonal groups
+    dist_mat = pandas DataFrame of pairwise nucleotide or amino acid distances
+    norm = normalization method
+    sym = symmetry method
+    linkage = type of linkage
+    seq_field = sequence field used to calculate distance between records
+
+    Returns: 
+    a dictionary of lists defining {clone number: [IgRecords clonal group]}
+    """
+    # Get distance matrix if not provided
+    if dist_mat is None:  dist_mat = getModelMatrix(model)
+
+    # Determine length of n-mers
+    if model in ['hs1f', 'm1n', 'aa', 'ham']:
+        nmer_len = 1
+    elif model in ['hs5f']:
+        nmer_len = 5
+    else:
+        sys.stderr.write('Unrecognized distance model: %s.\n' % model)
+
+    # Define unique junction mapping
+    seq_map = {}
+    for ig in records:
+        seq = ig.getSeqField(seq_field)
+        # Check if sequence length is 0
+        if len(seq) == 0:
+            return None
+
+        seq = re.sub('[\.-]','N', str(seq))
+        if model == 'aa':  seq = translate(seq)
+
+        seq_map.setdefault(seq, []).append(ig)
+
+    # Process records
+    if len(seq_map) == 1:
+        return {1:records}
+
+    # Define sequences
+    seqs = list(seq_map.keys())
+
+    # Calculate pairwise distance matrix
+    dists = calcDistances(seqs, nmer_len, dist_mat, norm, sym)
+
+    # Perform hierarchical clustering
+    clusters = formClusters(dists, linkage, distance)
+
+    # Turn clusters into clone dictionary
+    clone_dict = {}
+    for i, c in enumerate(clusters):
+        clone_dict.setdefault(c, []).extend(seq_map[seqs[i]])
+
+    return clone_dict
+
+
+def distChen2010(records):
+    """
+    Calculate pairwise distances as defined in Chen 2010
+    
+    Arguments:
+    records = list of IgRecords where first is query to be compared to others in list
+    
+    Returns:
+    list of distances
+    """
+    # Pull out query sequence and V/J information
+    query = records.popitem(last=False)
+    query_cdr3 = query.junction[3:-3]
+    query_v_allele = query.getVAllele()
+    query_v_gene = query.getVGene()
+    query_v_family = query.getVFamily()
+    query_j_allele = query.getJAllele()
+    query_j_gene = query.getJGene()
+    # Create alignment scoring dictionary
+    score_dict = getDNAScoreDict()
+    
+    scores = [0]*len(records)    
+    for i in range(len(records)):
+        ld = pairwise2.align.globalds(query_cdr3, records[i].junction[3:-3],
+                                      score_dict, -1, -1, one_alignment_only=True)
+        # Check V similarity
+        if records[i].getVAllele() == query_v_allele: ld += 0
+        elif records[i].getVGene() == query_v_gene: ld += 1
+        elif records[i].getVFamily() == query_v_family: ld += 3
+        else: ld += 5
+        # Check J similarity
+        if records[i].getJAllele() == query_j_allele: ld += 0
+        elif records[i].getJGene() == query_j_gene: ld += 1
+        else: ld += 3
+        # Divide by length
+        scores[i] = ld/max(len(records[i].junction[3:-3]), query_cdr3)
+        
+    return scores
+
+
+def distAdemokun2011(records):
+    """
+    Calculate pairwise distances as defined in Ademokun 2011
+    
+    Arguments:
+    records = list of IgRecords where first is query to be compared to others in list
+    
+    Returns:
+    list of distances
+    """
+    # Pull out query sequence and V family information
+    query = records.popitem(last=False)
+    query_cdr3 = query.junction[3:-3]
+    query_v_family = query.getVFamily()
+    # Create alignment scoring dictionary
+    score_dict = getDNAScoreDict()
+    
+    scores = [0]*len(records)    
+    for i in range(len(records)):
+        
+        if abs(len(query_cdr3) - len(records[i].junction[3:-3])) > 10:
+            scores[i] = 1
+        elif query_v_family != records[i].getVFamily(): 
+            scores[i] = 1
+        else: 
+            ld = pairwise2.align.globalds(query_cdr3, records[i].junction[3:-3], 
+                                          score_dict, -1, -1, one_alignment_only=True)
+            scores[i] = ld/min(len(records[i].junction[3:-3]), query_cdr3)
+    
+    return scores
+
+
+def hierClust(dist_mat, method='chen2010'):
+    """
+    Calculate hierarchical clustering
+    
+    Arguments:
+    dist_mat = square-formed distance matrix of pairwise CDR3 comparisons
+    
+    Returns:
+    list of cluster ids
+    """
+    if method == 'chen2010':
+        clusters = formClusters(dist_mat, 'average', 0.32)
+    elif method == 'ademokun2011':
+        clusters = formClusters(dist_mat, 'complete', 0.25)
+    else: clusters = np.ones(dist_mat.shape[0])
+        
+    return clusters
+
+# TODO:  Merge duplicate feed, process and collect functions.
+def feedQueue(alive, data_queue, db_file, group_func, group_args={}):
+    """
+    Feeds the data queue with Ig records
+
+    Arguments: 
+    alive = a multiprocessing.Value boolean controlling whether processing continues
+            if False exit process
+    data_queue = a multiprocessing.Queue to hold data for processing
+    db_file = the Ig record database file
+    group_func = the function to use for assigning preclones
+    group_args = a dictionary of arguments to pass to group_func
+    
+    Returns: 
+    None
+    """
+    # Open input file and perform grouping
+    try:
+        # Iterate over Ig records and assign groups
+        db_iter = readDbFile(db_file)
+        clone_dict = group_func(db_iter, **group_args)
+    except:
+        #sys.stderr.write('Exception in feeder grouping step\n')
+        alive.value = False
+        raise
+    
+    # Add groups to data queue
+    try:
+        #print 'START FEED', alive.value
+        # Iterate over groups and feed data queue
+        clone_iter = iter(clone_dict.items())
+        while alive.value:
+            # Get data from queue
+            if data_queue.full():  continue
+            else:  data = next(clone_iter, None)
+            # Exit upon reaching end of iterator
+            if data is None:  break
+            #print "FEED", alive.value, k
+            
+            # Feed queue
+            data_queue.put(DbData(*data))
+        else:
+            sys.stderr.write('PID %s:  Error in sibling process detected. Cleaning up.\n' \
+                             % os.getpid())
+            return None
+    except:
+        #sys.stderr.write('Exception in feeder queue feeding step\n')
+        alive.value = False
+        raise
+
+    return None
+
+
+def feedQueueClust(alive, data_queue, db_file, group_func=None, group_args={}):
+    """
+    Feeds the data queue with Ig records
+
+    Arguments: 
+    alive = a multiprocessing.Value boolean controlling whether processing continues
+            if False exit process
+    data_queue = a multiprocessing.Queue to hold data for processing
+    db_file = the Ig record database file
+    
+    Returns: 
+    None
+    """
+    # Open input file and perform grouping
+    try:
+        # Iterate over Ig records and order by junction length
+        records = {}
+        db_iter = readDbFile(db_file)
+        for rec in db_iter:
+            records[rec.id] = rec
+        records = OrderedDict(sorted(list(records.items()), key=lambda i: i[1].junction_length))
+        dist_dict = {}
+        for __ in range(len(records)):
+            k,v = records.popitem(last=False)
+            dist_dict[k] = [v].append(list(records.values()))
+    except:
+        #sys.stderr.write('Exception in feeder grouping step\n')
+        alive.value = False
+        raise
+    
+    # Add groups to data queue
+    try:
+        # print 'START FEED', alive.value
+        # Iterate over groups and feed data queue
+        dist_iter = iter(dist_dict.items())
+        while alive.value:
+            # Get data from queue
+            if data_queue.full():  continue
+            else:  data = next(dist_iter, None)
+            # Exit upon reaching end of iterator
+            if data is None:  break
+            #print "FEED", alive.value, k
+            
+            # Feed queue
+            data_queue.put(DbData(*data))
+        else:
+            sys.stderr.write('PID %s:  Error in sibling process detected. Cleaning up.\n' \
+                             % os.getpid())
+            return None
+    except:
+        #sys.stderr.write('Exception in feeder queue feeding step\n')
+        alive.value = False
+        raise
+
+    return None
+
+
+def processQueue(alive, data_queue, result_queue, clone_func, clone_args):
+    """
+    Pulls from data queue, performs calculations, and feeds results queue
+
+    Arguments: 
+    alive = a multiprocessing.Value boolean controlling whether processing continues
+            if False exit process
+    data_queue = a multiprocessing.Queue holding data to process
+    result_queue = a multiprocessing.Queue to hold processed results
+    clone_func = the function to call for clonal assignment
+    clone_args = a dictionary of arguments to pass to clone_func
+
+    Returns: 
+    None
+    """
+    try:
+        # Iterator over data queue until sentinel object reached
+        while alive.value:
+            # Get data from queue
+            if data_queue.empty():  continue
+            else:  data = data_queue.get()
+            # Exit upon reaching sentinel
+            if data is None:  break
+
+            # Define result object for iteration and get data records
+            records = data.data
+            result = DbResult(data.id, records)
+
+            # Check for invalid data (due to failed indexing) and add failed result
+            if not data:
+                result_queue.put(result)
+                continue
+
+            # Add V(D)J to log
+            result.log['ID'] = ','.join([str(x) for x in data.id])
+            result.log['VALLELE'] = ','.join(set([(r.getVAllele() or '') for r in records]))
+            result.log['DALLELE'] = ','.join(set([(r.getDAllele() or '') for r in records]))
+            result.log['JALLELE'] = ','.join(set([(r.getJAllele() or '') for r in records]))
+            result.log['JUNCLEN'] = ','.join(set([(str(len(r.junction)) or '0') for r in records]))
+            result.log['SEQUENCES'] = len(records)
+             
+            # Checking for preclone failure and assign clones
+            clones = clone_func(records, **clone_args) if data else None
+
+            # import cProfile
+            # prof = cProfile.Profile()
+            # clones = prof.runcall(clone_func, records, **clone_args)
+            # prof.dump_stats('worker-%d.prof' % os.getpid())
+
+            if clones is not None:
+                result.results = clones
+                result.valid = True
+                result.log['CLONES'] = len(clones)
+            else:
+                result.log['CLONES'] = 0
+  
+            # Feed results to result queue
+            result_queue.put(result)
+        else:
+            sys.stderr.write('PID %s:  Error in sibling process detected. Cleaning up.\n' \
+                             % os.getpid())
+            return None
+    except:
+        #sys.stderr.write('Exception in worker\n')
+        alive.value = False
+        raise
+    
+    return None
+
+
+def processQueueClust(alive, data_queue, result_queue, clone_func, clone_args):
+    """
+    Pulls from data queue, performs calculations, and feeds results queue
+
+    Arguments: 
+    alive = a multiprocessing.Value boolean controlling whether processing continues
+            if False exit process
+    data_queue = a multiprocessing.Queue holding data to process
+    result_queue = a multiprocessing.Queue to hold processed results
+    clone_func = the function to call for calculating pairwise distances between sequences
+    clone_args = a dictionary of arguments to pass to clone_func
+
+    Returns: 
+    None
+    """
+    
+    try:
+        # print 'START WORK', alive.value
+        # Iterator over data queue until sentinel object reached
+        while alive.value:
+            # Get data from queue
+            if data_queue.empty():  continue
+            else:  data = data_queue.get()
+            # Exit upon reaching sentinel
+            if data is None:  break
+            # print "WORK", alive.value, data['id']
+
+            # Define result object for iteration and get data records
+            records = data.data
+            result = DbResult(data.id, records)
+             
+            # Create row of distance matrix and check for error
+            dist_row = clone_func(records, **clone_args) if data else None
+            if dist_row is not None:
+                result.results = dist_row
+                result.valid = True
+  
+            # Feed results to result queue
+            result_queue.put(result)
+        else:
+            sys.stderr.write('PID %s:  Error in sibling process detected. Cleaning up.\n' \
+                             % os.getpid())
+            return None
+    except:
+        #sys.stderr.write('Exception in worker\n')
+        alive.value = False
+        raise
+    
+    return None
+
+
+def collectQueue(alive, result_queue, collect_queue, db_file, out_args, cluster_func=None, cluster_args={}):
+    """
+    Assembles results from a queue of individual sequence results and manages log/file I/O
+
+    Arguments: 
+    alive = a multiprocessing.Value boolean controlling whether processing continues
+            if False exit process
+    result_queue = a multiprocessing.Queue holding processQueue results
+    collect_queue = a multiprocessing.Queue to store collector return values
+    db_file = the input database file name
+    out_args = common output argument dictionary from parseCommonArgs
+    cluster_func = the function to call for carrying out clustering on distance matrix
+    cluster_args = a dictionary of arguments to pass to cluster_func
+    
+    Returns: 
+    None
+    (adds 'log' and 'out_files' to collect_dict)
+    """
+    # Open output files
+    try:
+        # Count records and define output format 
+        out_type = getFileType(db_file) if out_args['out_type'] is None \
+                   else out_args['out_type']
+        result_count = countDbFile(db_file)
+        
+        # Defined successful output handle
+        pass_handle = getOutputHandle(db_file, 
+                                      out_label='clone-pass', 
+                                      out_dir=out_args['out_dir'], 
+                                      out_name=out_args['out_name'], 
+                                      out_type=out_type)
+        pass_writer = getDbWriter(pass_handle, db_file, add_fields='CLONE')
+        
+        # Defined failed alignment output handle
+        if out_args['failed']:
+            fail_handle = getOutputHandle(db_file,
+                                          out_label='clone-fail', 
+                                          out_dir=out_args['out_dir'], 
+                                          out_name=out_args['out_name'], 
+                                          out_type=out_type)
+            fail_writer = getDbWriter(fail_handle, db_file)
+        else:
+            fail_handle = None
+            fail_writer = None
+
+        # Define log handle
+        if out_args['log_file'] is None:  
+            log_handle = None
+        else:  
+            log_handle = open(out_args['log_file'], 'w')
+    except:
+        #sys.stderr.write('Exception in collector file opening step\n')
+        alive.value = False
+        raise
+
+    # Get results from queue and write to files
+    try:
+        #print 'START COLLECT', alive.value
+        # Iterator over results queue until sentinel object reached
+        start_time = time()
+        rec_count = clone_count = pass_count = fail_count = 0
+        while alive.value:
+            # Get result from queue
+            if result_queue.empty():  continue
+            else:  result = result_queue.get()
+            # Exit upon reaching sentinel
+            if result is None:  break
+            #print "COLLECT", alive.value, result['id']
+            
+            # Print progress for previous iteration and update record count
+            if rec_count == 0:
+                print('PROGRESS> Assigning clones')
+            printProgress(rec_count, result_count, 0.05, start_time) 
+            rec_count += len(result.data)
+            
+            # Write passed and failed records
+            if result:
+                for clone in result.results.values():
+                    clone_count += 1
+                    for i, rec in enumerate(clone):
+                        rec.annotations['CLONE'] = clone_count
+                        pass_writer.writerow(rec.toDict())
+                        pass_count += 1
+                        result.log['CLONE%i-%i' % (clone_count, i + 1)] = str(rec.junction)
+    
+            else:
+                for i, rec in enumerate(result.data):
+                    if fail_writer is not None: fail_writer.writerow(rec.toDict())
+                    fail_count += 1
+                    result.log['CLONE0-%i' % (i + 1)] = str(rec.junction)
+                    
+            # Write log
+            printLog(result.log, handle=log_handle)
+        else:
+            sys.stderr.write('PID %s:  Error in sibling process detected. Cleaning up.\n' \
+                             % os.getpid())
+            return None
+        
+        # Print total counts
+        printProgress(rec_count, result_count, 0.05, start_time)
+
+        # Close file handles
+        pass_handle.close()
+        if fail_handle is not None:  fail_handle.close()
+        if log_handle is not None:  log_handle.close()
+                
+        # Update return list
+        log = OrderedDict()
+        log['OUTPUT'] = os.path.basename(pass_handle.name)
+        log['CLONES'] = clone_count
+        log['RECORDS'] = rec_count
+        log['PASS'] = pass_count
+        log['FAIL'] = fail_count
+        collect_dict = {'log':log, 'out_files': [pass_handle.name]}
+        collect_queue.put(collect_dict)
+    except:
+        #sys.stderr.write('Exception in collector result processing step\n')
+        alive.value = False
+        raise
+
+    return None
+
+
+def collectQueueClust(alive, result_queue, collect_queue, db_file, out_args, cluster_func, cluster_args):
+    """
+    Assembles results from a queue of individual sequence results and manages log/file I/O
+
+    Arguments: 
+    alive = a multiprocessing.Value boolean controlling whether processing continues
+            if False exit process
+    result_queue = a multiprocessing.Queue holding processQueue results
+    collect_queue = a multiprocessing.Queue to store collector return values
+    db_file = the input database file name
+    out_args = common output argument dictionary from parseCommonArgs
+    cluster_func = the function to call for carrying out clustering on distance matrix
+    cluster_args = a dictionary of arguments to pass to cluster_func
+    
+    Returns: 
+    None
+    (adds 'log' and 'out_files' to collect_dict)
+    """
+    # Open output files
+    try:
+               
+        # Iterate over Ig records to count and order by junction length
+        result_count = 0
+        records = {}
+        # print 'Reading file...'
+        db_iter = readDbFile(db_file)
+        for rec in db_iter:
+            records[rec.id] = rec
+            result_count += 1
+        records = OrderedDict(sorted(list(records.items()), key=lambda i: i[1].junction_length))
+                
+        # Define empty matrix to store assembled results
+        dist_mat = np.zeros((result_count,result_count))
+        
+        # Count records and define output format 
+        out_type = getFileType(db_file) if out_args['out_type'] is None \
+                   else out_args['out_type']
+                   
+        # Defined successful output handle
+        pass_handle = getOutputHandle(db_file, 
+                                      out_label='clone-pass', 
+                                      out_dir=out_args['out_dir'], 
+                                      out_name=out_args['out_name'], 
+                                      out_type=out_type)
+        pass_writer = getDbWriter(pass_handle, db_file, add_fields='CLONE')
+        
+        # Defined failed cloning output handle
+        if out_args['failed']:
+            fail_handle = getOutputHandle(db_file,
+                                          out_label='clone-fail', 
+                                          out_dir=out_args['out_dir'], 
+                                          out_name=out_args['out_name'], 
+                                          out_type=out_type)
+            fail_writer = getDbWriter(fail_handle, db_file)
+        else:
+            fail_handle = None
+            fail_writer = None
+
+        # Open log file
+        if out_args['log_file'] is None:
+            log_handle = None
+        else:
+            log_handle = open(out_args['log_file'], 'w')
+    except:
+        alive.value = False
+        raise
+    
+    try:
+        # Iterator over results queue until sentinel object reached
+        start_time = time()
+        row_count = rec_count = 0
+        while alive.value:
+            # Get result from queue
+            if result_queue.empty():  continue
+            else:  result = result_queue.get()
+            # Exit upon reaching sentinel
+            if result is None:  break
+
+            # Print progress for previous iteration
+            if row_count == 0:
+                print('PROGRESS> Assigning clones')
+            printProgress(row_count, result_count, 0.05, start_time)
+            
+            # Update counts for iteration
+            row_count += 1
+            rec_count += len(result)
+            
+            # Add result row to distance matrix
+            if result:
+                dist_mat[list(range(result_count-len(result),result_count)),result_count-len(result)] = result.results
+                
+        else:
+            sys.stderr.write('PID %s:  Error in sibling process detected. Cleaning up.\n' \
+                             % os.getpid())
+            return None    
+        
+        # Calculate linkage and carry out clustering
+        # print dist_mat
+        clusters = cluster_func(dist_mat, **cluster_args) if dist_mat is not None else None
+        clones = {}
+        # print clusters
+        for i, c in enumerate(clusters):
+            clones.setdefault(c, []).append(records[list(records.keys())[i]])
+        
+        # Write passed and failed records
+        clone_count = pass_count = fail_count = 0
+        if clones:
+            for clone in clones.values():
+                clone_count += 1
+                for i, rec in enumerate(clone):
+                    rec.annotations['CLONE'] = clone_count
+                    pass_writer.writerow(rec.toDict())
+                    pass_count += 1
+                    #result.log['CLONE%i-%i' % (clone_count, i + 1)] = str(rec.junction)
+
+        else:
+            for i, rec in enumerate(result.data):
+                fail_writer.writerow(rec.toDict())
+                fail_count += 1
+                #result.log['CLONE0-%i' % (i + 1)] = str(rec.junction)
+        
+        # Print final progress
+        printProgress(row_count, result_count, 0.05, start_time)
+    
+        # Close file handles
+        pass_handle.close()
+        if fail_handle is not None:  fail_handle.close()
+        if log_handle is not None:  log_handle.close()
+                
+        # Update return list
+        log = OrderedDict()
+        log['OUTPUT'] = os.path.basename(pass_handle.name)
+        log['CLONES'] = clone_count
+        log['RECORDS'] = rec_count
+        log['PASS'] = pass_count
+        log['FAIL'] = fail_count
+        collect_dict = {'log':log, 'out_files': [pass_handle.name]}
+        collect_queue.put(collect_dict)
+    except:
+        alive.value = False
+        raise
+    
+    return None
+
+
+def defineClones(db_file, feed_func, work_func, collect_func, clone_func, cluster_func=None,
+                 group_func=None, group_args={}, clone_args={}, cluster_args={}, 
+                 out_args=default_out_args, nproc=None, queue_size=None):
+    """
+    Define clonally related sequences
+    
+    Arguments:
+    db_file = filename of input database
+    feed_func = the function that feeds the queue
+    work_func = the worker function that will run on each CPU
+    collect_func = the function that collects results from the workers
+    group_func = the function to use for assigning preclones
+    clone_func = the function to use for determining clones within preclonal groups
+    group_args = a dictionary of arguments to pass to group_func
+    clone_args = a dictionary of arguments to pass to clone_func
+    out_args = common output argument dictionary from parseCommonArgs
+    nproc = the number of processQueue processes;
+            if None defaults to the number of CPUs
+    queue_size = maximum size of the argument queue;
+                 if None defaults to 2*nproc    
+    
+    Returns:
+    a list of successful output file names
+    """
+    # Print parameter info
+    log = OrderedDict()
+    log['START'] = 'DefineClones'
+    log['DB_FILE'] = os.path.basename(db_file)
+    if group_func is not None:
+        log['GROUP_FUNC'] = group_func.__name__
+        log['GROUP_ARGS'] = group_args
+    log['CLONE_FUNC'] = clone_func.__name__
+
+    # TODO:  this is yucky, but can be fixed by using a model class
+    clone_log = clone_args.copy()
+    if 'dist_mat' in clone_log:  del clone_log['dist_mat']
+    log['CLONE_ARGS'] = clone_log
+
+    if cluster_func is not None:
+        log['CLUSTER_FUNC'] = cluster_func.__name__
+        log['CLUSTER_ARGS'] = cluster_args
+    log['NPROC'] = nproc
+    printLog(log)
+    
+    # Define feeder function and arguments
+    feed_args = {'db_file': db_file,
+                 'group_func': group_func, 
+                 'group_args': group_args}
+    # Define worker function and arguments
+    work_args = {'clone_func': clone_func, 
+                 'clone_args': clone_args}
+    # Define collector function and arguments
+    collect_args = {'db_file': db_file,
+                    'out_args': out_args,
+                    'cluster_func': cluster_func,
+                    'cluster_args': cluster_args}
+    
+    # Call process manager
+    result = manageProcesses(feed_func, work_func, collect_func, 
+                             feed_args, work_args, collect_args, 
+                             nproc, queue_size)
+        
+    # Print log
+    result['log']['END'] = 'DefineClones'
+    printLog(result['log'])
+    
+    return result['out_files']
+
+
+def getArgParser():
+    """
+    Defines the ArgumentParser
+
+    Arguments: 
+    None
+                      
+    Returns: 
+    an ArgumentParser object
+    """
+    # Define input and output fields
+    fields = dedent(
+             '''
+             output files:
+                 clone-pass
+                     database with assigned clonal group numbers.
+                 clone-fail
+                     database with records failing clonal grouping.
+
+             required fields:
+                 SEQUENCE_ID, V_CALL or V_CALL_GENOTYPED, D_CALL, J_CALL, JUNCTION_LENGTH
+
+                 <field>
+                     sequence field specified by the --sf parameter
+                
+             output fields:
+                 CLONE
+              ''')
+
+    # Define ArgumentParser
+    parser = ArgumentParser(description=__doc__, epilog=fields,
+                            formatter_class=CommonHelpFormatter)
+    parser.add_argument('--version', action='version',
+                        version='%(prog)s:' + ' %s-%s' %(__version__, __date__))
+    subparsers = parser.add_subparsers(title='subcommands', dest='command', metavar='',
+                                       help='Cloning method')
+    # TODO:  This is a temporary fix for Python issue 9253
+    subparsers.required = True
+    
+    # Parent parser    
+    parser_parent = getCommonArgParser(seq_in=False, seq_out=False, db_in=True, 
+                                       multiproc=True)
+    
+    # Distance cloning method
+    parser_bygroup = subparsers.add_parser('bygroup', parents=[parser_parent],
+                                        formatter_class=CommonHelpFormatter,
+                                        help='''Defines clones as having same V assignment,
+                                              J assignment, and junction length with
+                                              specified substitution distance model.''')
+    parser_bygroup.add_argument('-f', nargs='+', action='store', dest='fields', default=None,
+                             help='Additional fields to use for grouping clones (non VDJ)')
+    parser_bygroup.add_argument('--mode', action='store', dest='mode', 
+                             choices=('allele', 'gene'), default='gene', 
+                             help='''Specifies whether to use the V(D)J allele or gene for
+                                  initial grouping.''')
+    parser_bygroup.add_argument('--act', action='store', dest='action', default='set',
+                             choices=('first', 'set'),
+                             help='''Specifies how to handle multiple V(D)J assignments
+                                  for initial grouping.''')
+    parser_bygroup.add_argument('--model', action='store', dest='model', 
+                             choices=('aa', 'ham', 'm1n', 'hs1f', 'hs5f'),
+                             default=default_bygroup_model,
+                             help='''Specifies which substitution model to use for
+                                  calculating distance between sequences. Where m1n is the
+                                  mouse single nucleotide transition/trasversion model
+                                  of Smith et al, 1996; hs1f is the human single
+                                  nucleotide model derived from Yaari et al, 2013; hs5f
+                                  is the human S5F model of Yaari et al, 2013; ham is
+                                  nucleotide Hamming distance; and aa is amino acid
+                                  Hamming distance. The hs5f data should be
+                                  considered experimental.''')
+    parser_bygroup.add_argument('--dist', action='store', dest='distance', type=float, 
+                             default=default_distance,
+                             help='The distance threshold for clonal grouping')
+    parser_bygroup.add_argument('--norm', action='store', dest='norm',
+                             choices=('len', 'mut', 'none'), default=default_norm,
+                             help='''Specifies how to normalize distances. One of none
+                                  (do not normalize), len (normalize by length),
+                                  or mut (normalize by number of mutations between sequences).''')
+    parser_bygroup.add_argument('--sym', action='store', dest='sym',
+                             choices=('avg', 'min'), default=default_sym,
+                             help='''Specifies how to combine asymmetric distances. One of avg
+                                  (average of A->B and B->A) or min (minimum of A->B and B->A).''')
+    parser_bygroup.add_argument('--link', action='store', dest='linkage',
+                             choices=('single', 'average', 'complete'), default=default_linkage,
+                             help='''Type of linkage to use for hierarchical clustering.''')
+    parser_bygroup.add_argument('--sf', action='store', dest='seq_field',
+                                default=default_seq_field,
+                                help='''The name of the field to be used to calculate
+                                     distance between records''')
+    parser_bygroup.set_defaults(feed_func=feedQueue)
+    parser_bygroup.set_defaults(work_func=processQueue)
+    parser_bygroup.set_defaults(collect_func=collectQueue)  
+    parser_bygroup.set_defaults(group_func=indexJunctions)  
+    parser_bygroup.set_defaults(clone_func=distanceClones)
+    
+    
+    # Hierarchical clustering cloning method
+    parser_hclust = subparsers.add_parser('hclust', parents=[parser_parent],
+                                        formatter_class=CommonHelpFormatter,
+                                        help='Defines clones by specified distance metric on CDR3s and \
+                                              cutting of hierarchical clustering tree')
+#     parser_hclust.add_argument('-f', nargs='+', action='store', dest='fields', default=None,
+#                              help='Fields to use for grouping clones (non VDJ)')
+    parser_hclust.add_argument('--method', action='store', dest='method', 
+                             choices=('chen2010', 'ademokun2011'), default=default_hclust_model, 
+                             help='Specifies which cloning method to use for calculating distance \
+                                   between CDR3s, computing linkage, and cutting clusters')
+    parser_hclust.set_defaults(feed_func=feedQueueClust)
+    parser_hclust.set_defaults(work_func=processQueueClust)
+    parser_hclust.set_defaults(collect_func=collectQueueClust)
+    parser_hclust.set_defaults(cluster_func=hierClust)
+        
+    return parser
+
+
+if __name__ == '__main__':
+    """
+    Parses command line arguments and calls main function
+    """
+    # Parse arguments
+    parser = getArgParser()
+    args = parser.parse_args()
+    args_dict = parseCommonArgs(args)
+    # Convert case of fields
+    if 'seq_field' in args_dict:
+        args_dict['seq_field'] = args_dict['seq_field'].upper()
+    if 'fields' in args_dict and args_dict['fields'] is not None:  
+        args_dict['fields'] = [f.upper() for f in args_dict['fields']]
+    
+    # Define clone_args
+    if args.command == 'bygroup':
+        args_dict['group_args'] = {'fields': args_dict['fields'],
+                                   'action': args_dict['action'], 
+                                   'mode':args_dict['mode']}
+        args_dict['clone_args'] = {'model':  args_dict['model'],
+                                   'distance':  args_dict['distance'],
+                                   'norm': args_dict['norm'],
+                                   'sym': args_dict['sym'],
+                                   'linkage': args_dict['linkage'],
+                                   'seq_field': args_dict['seq_field']}
+
+        # TODO:  can be cleaned up with abstract model class
+        args_dict['clone_args']['dist_mat'] = getModelMatrix(args_dict['model'])
+
+        del args_dict['fields']
+        del args_dict['action']
+        del args_dict['mode']
+        del args_dict['model']
+        del args_dict['distance']
+        del args_dict['norm']
+        del args_dict['sym']
+        del args_dict['linkage']
+        del args_dict['seq_field']
+
+    # Define clone_args
+    if args.command == 'hclust':
+        dist_funcs = {'chen2010':distChen2010, 'ademokun2011':distAdemokun2011}
+        args_dict['clone_func'] = dist_funcs[args_dict['method']]
+        args_dict['cluster_args'] = {'method':  args_dict['method']}
+        #del args_dict['fields']
+        del args_dict['method']
+    
+    # Call defineClones
+    del args_dict['command']
+    del args_dict['db_files']
+    for f in args.__dict__['db_files']:
+        args_dict['db_file'] = f
+        defineClones(**args_dict)
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/change_o/MakeDb.py	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,1025 @@
+#!/usr/bin/env python3
+"""
+Create tab-delimited database file to store sequence alignment information
+"""
+# Info
+__author__ = 'Namita Gupta, Jason Anthony Vander Heiden'
+from changeo import __version__, __date__
+
+# Imports
+import csv
+import os
+import re
+import sys
+import pandas as pd
+import tarfile
+import zipfile
+from argparse import ArgumentParser
+from collections import OrderedDict
+from itertools import groupby
+from shutil import rmtree
+from tempfile import mkdtemp
+from textwrap import dedent
+from time import time
+from Bio import SeqIO
+from Bio.Seq import Seq
+from Bio.Alphabet import IUPAC
+
+# Presto and changeo imports
+from presto.Defaults import default_out_args
+from presto.Annotation import parseAnnotation
+from presto.IO import countSeqFile, printLog, printProgress
+from changeo.Commandline import CommonHelpFormatter, getCommonArgParser, parseCommonArgs
+from changeo.IO import getDbWriter, countDbFile, getRepo
+from changeo.Receptor import IgRecord, parseAllele, v_allele_regex, d_allele_regex, \
+                             j_allele_regex
+
+# Default parameters
+default_delimiter = ('\t', ',', '-')
+
+
+def gapV(ig_dict, repo_dict):
+    """
+    Insert gaps into V region and update alignment information
+
+    Arguments:
+      ig_dict : Dictionary of parsed IgBlast output
+      repo_dict : Dictionary of IMGT gapped germline sequences
+
+    Returns:
+      dict : Updated with SEQUENCE_IMGT, V_GERM_START_IMGT, and V_GERM_LENGTH_IMGT fields
+    """
+
+    seq_imgt = '.' * (int(ig_dict['V_GERM_START_VDJ'])-1) + ig_dict['SEQUENCE_VDJ']
+
+    # Find gapped germline V segment
+    vgene = parseAllele(ig_dict['V_CALL'], v_allele_regex, 'first')
+    vkey = (vgene, )
+    #TODO: Figure out else case
+    if vkey in repo_dict:
+        vgap = repo_dict[vkey]
+        # Iterate over gaps in the germline segment
+        gaps = re.finditer(r'\.', vgap)
+        gapcount = int(ig_dict['V_GERM_START_VDJ'])-1
+        for gap in gaps:
+            i = gap.start()
+            # Break if gap begins after V region
+            if i >= ig_dict['V_GERM_LENGTH_VDJ'] + gapcount:
+                break
+            # Insert gap into IMGT sequence
+            seq_imgt = seq_imgt[:i] + '.' + seq_imgt[i:]
+            # Update gap counter
+            gapcount += 1
+        ig_dict['SEQUENCE_IMGT'] = seq_imgt
+        # Update IMGT positioning information for V
+        ig_dict['V_GERM_START_IMGT'] = 1
+        ig_dict['V_GERM_LENGTH_IMGT'] = ig_dict['V_GERM_LENGTH_VDJ'] + gapcount
+
+    return ig_dict
+
+
+def getIMGTJunc(ig_dict, repo_dict):
+    """
+    Identify junction region by IMGT definition
+
+    Arguments:
+      ig_dict : Dictionary of parsed IgBlast output
+      repo_dict : Dictionary of IMGT gapped germline sequences
+
+    Returns:
+      dict : Updated with JUNCTION_LENGTH_IMGT and JUNCTION_IMGT fields
+    """
+    # Find germline J segment
+    jgene = parseAllele(ig_dict['J_CALL'], j_allele_regex, 'first')
+    jkey = (jgene, )
+    #TODO: Figure out else case
+    if jkey in repo_dict:
+        # Get germline J sequence
+        jgerm = repo_dict[jkey]
+        jgerm = jgerm[:ig_dict['J_GERM_START']+ig_dict['J_GERM_LENGTH']-1]
+        # Look for (F|W)GXG aa motif in nt sequence
+        motif = re.search(r'T(TT|TC|GG)GG[ACGT]{4}GG[AGCT]', jgerm)
+        aa_end = len(ig_dict['SEQUENCE_IMGT'])
+        #TODO: Figure out else case
+        if motif:
+            # print('\n', motif.group())
+            aa_end = motif.start() - len(jgerm) + 3
+        # Add fields to dict
+        ig_dict['JUNCTION'] = ig_dict['SEQUENCE_IMGT'][309:aa_end]
+        ig_dict['JUNCTION_LENGTH'] = len(ig_dict['JUNCTION'])
+
+    return ig_dict
+
+
+def getRegions(ig_dict):
+    """
+    Identify FWR and CDR regions by IMGT definition
+
+    Arguments:
+      ig_dict : Dictionary of parsed alignment output
+
+    Returns:
+      dict : Updated with FWR1_IMGT, FWR2_IMGT, FWR3_IMGT, FWR4_IMGT,
+             CDR1_IMGT, CDR2_IMGT, and CDR3_IMGT fields
+    """
+    try:
+        seq_len = len(ig_dict['SEQUENCE_IMGT'])
+        ig_dict['FWR1_IMGT'] = ig_dict['SEQUENCE_IMGT'][0:min(78,seq_len)]
+    except (KeyError, IndexError):
+        return ig_dict
+
+    try: ig_dict['CDR1_IMGT'] = ig_dict['SEQUENCE_IMGT'][78:min(114, seq_len)]
+    except (IndexError): return ig_dict
+
+    try: ig_dict['FWR2_IMGT'] = ig_dict['SEQUENCE_IMGT'][114:min(165, seq_len)]
+    except (IndexError): return ig_dict
+
+    try: ig_dict['CDR2_IMGT'] = ig_dict['SEQUENCE_IMGT'][165:min(195, seq_len)]
+    except (IndexError): return ig_dict
+
+    try: ig_dict['FWR3_IMGT'] = ig_dict['SEQUENCE_IMGT'][195:min(312, seq_len)]
+    except (IndexError): return ig_dict
+
+    try:
+        cdr3_end = 306 + ig_dict['JUNCTION_LENGTH']
+        ig_dict['CDR3_IMGT'] = ig_dict['SEQUENCE_IMGT'][312:cdr3_end]
+        ig_dict['FWR4_IMGT'] = ig_dict['SEQUENCE_IMGT'][cdr3_end:]
+    except (KeyError, IndexError):
+        return ig_dict
+
+    return ig_dict
+
+
+def getSeqforIgBlast(seq_file):
+    """
+    Fetch input sequences for IgBlast queries
+
+    Arguments:
+    seq_file = a fasta file of sequences input to IgBlast
+
+    Returns:
+    a dictionary of {ID:Seq}
+    """
+
+    seq_dict = SeqIO.index(seq_file, "fasta", IUPAC.ambiguous_dna)
+
+    # Create a seq_dict ID translation using IDs truncate up to space or 50 chars
+    seqs = {}
+    for seq in seq_dict.values():
+        seqs.update({seq.description:str(seq.seq)})
+
+    return seqs
+
+
+def findLine(handle, query):
+    """
+    Finds line with query string in file
+
+    Arguments:
+    handle = file handle in which to search for line
+    query = query string for which to search in file
+
+    Returns:
+    line from handle in which query string was found
+    """
+    for line in handle:
+        if(re.match(query, line)):
+            return line
+
+
+def extractIMGT(imgt_output):
+    """
+    Extract necessary files from IMGT results, zipped or unzipped
+    
+    Arguments:
+    imgt_output = zipped file or unzipped folder output by IMGT
+    
+    Returns:
+    sorted list of filenames from which information will be read
+    """
+    #file_ext = os.path.splitext(imgt_output)[1].lower()
+    imgt_flags = ('1_Summary', '2_IMGT-gapped', '3_Nt-sequences', '6_Junction')
+    temp_dir = mkdtemp()
+    if zipfile.is_zipfile(imgt_output):
+        # Open zip file
+        imgt_zip = zipfile.ZipFile(imgt_output, 'r')
+        # Extract required files
+        imgt_files = sorted([n for n in imgt_zip.namelist() \
+                             if os.path.basename(n).startswith(imgt_flags)])
+        imgt_zip.extractall(temp_dir, imgt_files)
+        # Define file list
+        imgt_files = [os.path.join(temp_dir, f) for f in imgt_files]
+    elif os.path.isdir(imgt_output):
+        # Find required files in folder
+        folder_files = []
+        for root, dirs, files in os.walk(imgt_output):
+            folder_files.extend([os.path.join(os.path.abspath(root), f) for f in files])
+        # Define file list
+        imgt_files = sorted([n for n in folder_files \
+                             if os.path.basename(n).startswith(imgt_flags)])
+    elif tarfile.is_tarfile(imgt_output):
+        # Open zip file
+        imgt_tar = tarfile.open(imgt_output, 'r')
+        # Extract required files
+        imgt_files = sorted([n for n in imgt_tar.getnames() \
+                             if os.path.basename(n).startswith(imgt_flags)])
+        imgt_tar.extractall(temp_dir, [imgt_tar.getmember(n) for n in imgt_files])
+        # Define file list
+        imgt_files = [os.path.join(temp_dir, f) for f in imgt_files]
+    else:
+        sys.exit('ERROR: Unsupported IGMT output file. Must be either a zipped file (.zip), LZMA compressed tarfile (.txz) or a folder.')
+    
+    if len(imgt_files) > len(imgt_flags): # e.g. multiple 1_Summary files
+        sys.exit('ERROR: Wrong files in IMGT output %s.' % imgt_output)
+    elif len(imgt_files) < len(imgt_flags):
+        sys.exit('ERROR: Missing necessary file IMGT output %s.' % imgt_output)
+        
+    return temp_dir, imgt_files
+
+
+# TODO: return a dictionary with keys determined by the comment strings in the blocks, thus avoiding problems with missing blocks
+def readOneIgBlastResult(block):
+    """
+    Parse a single IgBLAST query result
+
+    Arguments:
+    block =  itertools groupby object of single result
+
+    Returns:
+    None if no results, otherwise list of DataFrames for each result block
+    """
+    results = list()
+    i = 0
+    for match, subblock in groupby(block, lambda l: l=='\n'):
+        if not match:
+            # Strip whitespace and comments
+            sub = [s.strip() for s in subblock if not s.startswith('#')]
+
+            # Continue on empty block
+            if not sub:  continue
+            else:  i += 1
+
+            # Split by tabs
+            sub = [s.split('\t') for s in sub]
+
+            # Append list for "V-(D)-J rearrangement summary" (i == 1)
+            # And "V-(D)-J junction details" (i == 2)
+            # Otherwise append DataFrame of subblock
+            if i == 1 or i == 2:
+                results.append(sub[0])
+            else:
+                df = pd.DataFrame(sub)
+                if not df.empty: results.append(df)
+
+    return results if results else None
+
+
+# TODO:  needs more speeds. pandas is probably to blame.
+def readIgBlast(igblast_output, seq_dict, repo_dict,
+                score_fields=False, region_fields=False):
+    """
+    Reads IgBlast output
+
+    Arguments:
+    igblast_output = IgBlast output file (format 7)
+    seq_dict = a dictionary of {ID:Seq} from input fasta file
+    repo_dict = dictionary of IMGT gapped germline sequences
+    score_fields = if True parse alignment scores
+    region_fields = if True add FWR and CDR region fields
+
+    Returns:
+    a generator of dictionaries containing alignment data
+    """
+
+    # Open IgBlast output file
+    with open(igblast_output) as f:
+        # Iterate over individual results (separated by # IGBLASTN)
+        for k1, block in groupby(f, lambda x: re.match('# IGBLASTN', x)):
+            block = list(block)
+            if not k1:
+                # TODO: move query name extraction into block parser readOneIgBlastResult().
+                # Extract sequence ID
+                query_name = ' '.join(block[0].strip().split(' ')[2:])
+                # Initialize db_gen to have ID and input sequence
+                db_gen = {'SEQUENCE_ID':     query_name,
+                          'SEQUENCE_INPUT':  seq_dict[query_name]}
+
+                # Parse further sub-blocks
+                block_list = readOneIgBlastResult(block)
+
+                # TODO: this is indented pretty far.  should be a separate function. or several functions.
+                # If results exist, parse further to obtain full db_gen
+                if block_list is not None:
+                    # Parse quality information
+                    db_gen['STOP'] = 'T' if block_list[0][-4] == 'Yes' else 'F'
+                    db_gen['IN_FRAME'] = 'T' if block_list[0][-3] == 'In-frame' else 'F'
+                    db_gen['FUNCTIONAL'] = 'T' if block_list[0][-2] == 'Yes' else 'F'
+                    if block_list[0][-1] == '-':
+                        db_gen['SEQUENCE_INPUT'] = str(Seq(db_gen['SEQUENCE_INPUT'],
+                                                           IUPAC.ambiguous_dna).reverse_complement())
+
+                    # Parse V, D, and J calls
+                    call_str = ' '.join(block_list[0])
+                    v_call = parseAllele(call_str, v_allele_regex, action='list')
+                    d_call = parseAllele(call_str, d_allele_regex, action='list')
+                    j_call = parseAllele(call_str, j_allele_regex, action='list')
+                    db_gen['V_CALL'] = ','.join(v_call) if v_call is not None else 'None'
+                    db_gen['D_CALL'] = ','.join(d_call) if d_call is not None else 'None'
+                    db_gen['J_CALL'] = ','.join(j_call) if j_call is not None else 'None'
+
+                    # Parse junction sequence
+                    # db_gen['JUNCTION_VDJ'] = re.sub('(N/A)|\[|\(|\)|\]', '', ''.join(block_list[1]))
+                    # db_gen['JUNCTION_LENGTH_VDJ'] = len(db_gen['JUNCTION_VDJ'])
+
+                    # TODO:  IgBLAST does a stupid and doesn't output block #3 sometimes. why?
+                    # TODO:  maybe we should fail these. they look craptastic.
+                    #pd.set_option('display.width', 500)
+                    #print query_name, len(block_list), hit_idx
+                    #for i, x in enumerate(block_list):
+                    #    print '[%i]' % i
+                    #    print x
+
+                    # Parse segment start and stop positions
+                    hit_df = block_list[-1]
+
+                    # Alignment info block
+                    #  0:  segment
+                    #  1:  query id
+                    #  2:  subject id
+                    #  3:  % identity
+                    #  4:  alignment length
+                    #  5:  mismatches
+                    #  6:  gap opens
+                    #  7:  gaps
+                    #  8:  q. start
+                    #  9:  q. end
+                    # 10:  s. start
+                    # 11:  s. end
+                    # 12:  evalue
+                    # 13:  bit score
+                    # 14:  query seq
+                    # 15:  subject seq
+                    # 16:  btop
+
+                    # If V call exists, parse V alignment information
+                    seq_vdj = ''
+                    if v_call is not None:
+                        v_align = hit_df[hit_df[0] == 'V'].iloc[0]
+                        # Germline positions
+                        db_gen['V_GERM_START_VDJ'] = int(v_align[10])
+                        db_gen['V_GERM_LENGTH_VDJ'] = int(v_align[11]) - db_gen['V_GERM_START_VDJ'] + 1
+                        # Query sequence positions
+                        db_gen['V_SEQ_START'] = int(v_align[8])
+                        db_gen['V_SEQ_LENGTH'] = int(v_align[9]) - db_gen['V_SEQ_START'] + 1
+
+                        if int(v_align[6]) == 0:
+                            db_gen['INDELS'] = 'F'
+                        else:
+                            db_gen['INDELS'] = 'T'
+                            # Set functional to none so record gets tossed (junction will be wrong)
+                            # db_gen['FUNCTIONAL'] = None
+
+                        # V alignment scores
+                        if score_fields:
+                            try: db_gen['V_SCORE'] = float(v_align[13])
+                            except (TypeError, ValueError): db_gen['V_SCORE'] = 'None'
+
+                            try: db_gen['V_IDENTITY'] = float(v_align[3]) / 100.0
+                            except (TypeError, ValueError): db_gen['V_IDENTITY'] = 'None'
+
+                            try: db_gen['V_EVALUE'] = float(v_align[12])
+                            except (TypeError, ValueError): db_gen['V_EVALUE'] = 'None'
+
+                            try: db_gen['V_BTOP'] = v_align[16]
+                            except (TypeError, ValueError): db_gen['V_BTOP'] = 'None'
+
+                        # Update VDJ sequence, removing insertions
+                        start = 0
+                        for m in re.finditer(r'-', v_align[15]):
+                            ins = m.start()
+                            seq_vdj += v_align[14][start:ins]
+                            start = ins + 1
+                        seq_vdj += v_align[14][start:]
+
+                    # TODO:  needs to check that the V results are present before trying to determine N1_LENGTH from them.
+                    # If D call exists, parse D alignment information
+                    if d_call is not None:
+                        d_align = hit_df[hit_df[0] == 'D'].iloc[0]
+
+                        # TODO:  this is kinda gross.  not sure how else to fix the alignment overlap problem though.
+                        # Determine N-region length and amount of J overlap with V or D alignment
+                        overlap = 0
+                        if v_call is not None:
+                            n1_len = int(d_align[8]) - (db_gen['V_SEQ_START'] + db_gen['V_SEQ_LENGTH'])
+                            if n1_len < 0:
+                                db_gen['N1_LENGTH'] = 0
+                                overlap = abs(n1_len)
+                            else:
+                                db_gen['N1_LENGTH'] = n1_len
+                                n1_start = (db_gen['V_SEQ_START'] + db_gen['V_SEQ_LENGTH']-1)
+                                n1_end = int(d_align[8])-1
+                                seq_vdj += db_gen['SEQUENCE_INPUT'][n1_start:n1_end]
+
+                        # Query sequence positions
+                        db_gen['D_SEQ_START'] = int(d_align[8]) + overlap
+                        db_gen['D_SEQ_LENGTH'] = max(int(d_align[9]) - db_gen['D_SEQ_START'] + 1, 0)
+
+                        # Germline positions
+                        db_gen['D_GERM_START'] = int(d_align[10]) + overlap
+                        db_gen['D_GERM_LENGTH'] = max(int(d_align[11]) - db_gen['D_GERM_START'] + 1, 0)
+
+                        # Update VDJ sequence, removing insertions
+                        start = overlap
+                        for m in re.finditer(r'-', d_align[15]):
+                            ins = m.start()
+                            seq_vdj += d_align[14][start:ins]
+                            start = ins + 1
+                        seq_vdj += d_align[14][start:]
+
+                    # TODO:  needs to check that the V results are present before trying to determine N1_LENGTH from them.
+                    # If J call exists, parse J alignment information
+                    if j_call is not None:
+                        j_align = hit_df[hit_df[0] == 'J'].iloc[0]
+
+                        # TODO:  this is kinda gross.  not sure how else to fix the alignment overlap problem though.
+                        # Determine N-region length and amount of J overlap with V or D alignment
+                        overlap = 0
+                        if d_call is not None:
+                            n2_len = int(j_align[8]) - (db_gen['D_SEQ_START'] + db_gen['D_SEQ_LENGTH'])
+                            if n2_len < 0:
+                                db_gen['N2_LENGTH'] = 0
+                                overlap = abs(n2_len)
+                            else:
+                                db_gen['N2_LENGTH'] = n2_len
+                                n2_start = (db_gen['D_SEQ_START']+db_gen['D_SEQ_LENGTH']-1)
+                                n2_end = int(j_align[8])-1
+                                seq_vdj += db_gen['SEQUENCE_INPUT'][n2_start:n2_end]
+                        elif v_call is not None:
+                            n1_len = int(j_align[8]) - (db_gen['V_SEQ_START'] + db_gen['V_SEQ_LENGTH'])
+                            if n1_len < 0:
+                                db_gen['N1_LENGTH'] = 0
+                                overlap = abs(n1_len)
+                            else:
+                                db_gen['N1_LENGTH'] = n1_len
+                                n1_start = (db_gen['V_SEQ_START']+db_gen['V_SEQ_LENGTH']-1)
+                                n1_end = int(j_align[8])-1
+                                seq_vdj += db_gen['SEQUENCE_INPUT'][n1_start:n1_end]
+                        else:
+                            db_gen['N1_LENGTH'] = 0
+
+                        # Query positions
+                        db_gen['J_SEQ_START'] = int(j_align[8]) + overlap
+                        db_gen['J_SEQ_LENGTH'] = max(int(j_align[9]) - db_gen['J_SEQ_START'] + 1, 0)
+
+                        # Germline positions
+                        db_gen['J_GERM_START'] = int(j_align[10]) + overlap
+                        db_gen['J_GERM_LENGTH'] = max(int(j_align[11]) - db_gen['J_GERM_START'] + 1, 0)
+
+                        # J alignment scores
+                        if score_fields:
+                            try: db_gen['J_SCORE'] = float(j_align[13])
+                            except (TypeError, ValueError): db_gen['J_SCORE'] = 'None'
+
+                            try: db_gen['J_IDENTITY'] = float(j_align[3]) / 100.0
+                            except (TypeError, ValueError): db_gen['J_IDENTITY'] = 'None'
+
+                            try: db_gen['J_EVALUE'] = float(j_align[12])
+                            except (TypeError, ValueError): db_gen['J_EVALUE'] = 'None'
+
+                            try: db_gen['J_BTOP'] = j_align[16]
+                            except (TypeError, ValueError): db_gen['J_BTOP'] = 'None'
+
+                        # Update VDJ sequence, removing insertions
+                        start = overlap
+                        for m in re.finditer(r'-', j_align[15]):
+                            ins = m.start()
+                            seq_vdj += j_align[14][start:ins]
+                            start = ins + 1
+                        seq_vdj += j_align[14][start:]
+
+                    db_gen['SEQUENCE_VDJ'] = seq_vdj
+
+                    # Create IMGT-gapped sequence and infer IMGT junction
+                    if v_call is not None:
+                        db_gen = gapV(db_gen, repo_dict)
+                        if j_call is not None:
+                            db_gen = getIMGTJunc(db_gen, repo_dict)
+
+                    # FWR and CDR regions
+                    if region_fields: getRegions(db_gen)
+
+                yield IgRecord(db_gen)
+
+
+# TODO:  should be more readable
+def readIMGT(imgt_files, score_fields=False, region_fields=False):
+    """
+    Reads IMGT/HighV-Quest output
+
+    Arguments: 
+    imgt_files = IMGT/HighV-Quest output files 1, 2, 3, and 6
+    score_fields = if True parse alignment scores
+    region_fields = if True add FWR and CDR region fields
+    
+    Returns: 
+    a generator of dictionaries containing alignment data
+    """
+    imgt_iters = [csv.DictReader(open(f, 'rU'), delimiter='\t') for f in imgt_files]
+    # Create a dictionary for each sequence alignment and yield its generator
+    for sm, gp, nt, jn in zip(*imgt_iters):
+        if len(set([sm['Sequence ID'],
+                    gp['Sequence ID'],
+                    nt['Sequence ID'],
+                    jn['Sequence ID']])) != 1:
+            sys.exit('Error: IMGT files are corrupt starting with Summary file record %s' \
+                     % sm['Sequence ID'])
+
+        db_gen = {'SEQUENCE_ID': sm['Sequence ID'],
+                  'SEQUENCE_INPUT': sm['Sequence']}
+
+        if 'No results' not in sm['Functionality']:
+            db_gen['FUNCTIONAL'] = ['?','T','F'][('productive' in sm['Functionality']) +
+                                                 ('unprod' in sm['Functionality'])]
+            db_gen['IN_FRAME'] = ['?','T','F'][('in-frame' in sm['JUNCTION frame']) +
+                                               ('out-of-frame' in sm['JUNCTION frame'])],
+            db_gen['STOP'] = ['F','?','T'][('stop codon' in sm['Functionality comment']) +
+                                           ('unprod' in sm['Functionality'])]
+            db_gen['MUTATED_INVARIANT'] = ['F','?','T'][(any(('missing' in sm['Functionality comment'],
+                                                         'missing' in sm['V-REGION potential ins/del']))) +
+                                                         ('unprod' in sm['Functionality'])]
+            db_gen['INDELS'] = ['F','T'][any((sm['V-REGION potential ins/del'],
+                                              sm['V-REGION insertions'],
+                                              sm['V-REGION deletions']))]
+
+            db_gen['SEQUENCE_VDJ'] = nt['V-D-J-REGION'] if nt['V-D-J-REGION'] else nt['V-J-REGION']
+            db_gen['SEQUENCE_IMGT'] = gp['V-D-J-REGION'] if gp['V-D-J-REGION'] else gp['V-J-REGION']
+
+            db_gen['V_CALL'] = re.sub('\sor\s', ',', re.sub(',', '', gp['V-GENE and allele']))
+            db_gen['D_CALL'] = re.sub('\sor\s', ',', re.sub(',', '', gp['D-GENE and allele']))
+            db_gen['J_CALL'] = re.sub('\sor\s', ',', re.sub(',', '', gp['J-GENE and allele']))
+
+            v_seq_length = len(nt['V-REGION']) if nt['V-REGION'] else 0
+            db_gen['V_SEQ_START'] = nt['V-REGION start']
+            db_gen['V_SEQ_LENGTH'] = v_seq_length
+            db_gen['V_GERM_START_IMGT'] = 1
+            db_gen['V_GERM_LENGTH_IMGT'] = len(gp['V-REGION']) if gp['V-REGION'] else 0
+
+            db_gen['N1_LENGTH'] = sum(int(i) for i in [jn["P3'V-nt nb"],
+                                                       jn['N-REGION-nt nb'],
+                                                       jn['N1-REGION-nt nb'],
+                                                       jn["P5'D-nt nb"]] if i)
+            db_gen['D_SEQ_START'] = sum(int(i) for i in [1, v_seq_length,
+                                                         jn["P3'V-nt nb"],
+                                                         jn['N-REGION-nt nb'],
+                                                         jn['N1-REGION-nt nb'],
+                                                         jn["P5'D-nt nb"]] if i)
+            db_gen['D_SEQ_LENGTH'] = int(jn["D-REGION-nt nb"] or 0)
+            db_gen['D_GERM_START'] = int(jn["5'D-REGION trimmed-nt nb"] or 0) + 1
+            db_gen['D_GERM_LENGTH'] = int(jn["D-REGION-nt nb"] or 0)
+            db_gen['N2_LENGTH'] = sum(int(i) for i in [jn["P3'D-nt nb"],
+                                                       jn['N2-REGION-nt nb'],
+                                                       jn["P5'J-nt nb"]] if i)
+
+            db_gen['J_SEQ_START_IMGT'] = sum(int(i) for i in [1, v_seq_length,
+                                                         jn["P3'V-nt nb"],
+                                                         jn['N-REGION-nt nb'],
+                                                         jn['N1-REGION-nt nb'],
+                                                         jn["P5'D-nt nb"],
+                                                         jn["D-REGION-nt nb"],
+                                                         jn["P3'D-nt nb"],
+                                                         jn['N2-REGION-nt nb'],
+                                                         jn["P5'J-nt nb"]] if i)
+            db_gen['J_SEQ_LENGTH'] = len(nt['J-REGION']) if nt['J-REGION'] else 0
+            db_gen['J_GERM_START'] = int(jn["5'J-REGION trimmed-nt nb"] or 0) + 1
+            db_gen['J_GERM_LENGTH'] = len(gp['J-REGION']) if gp['J-REGION'] else 0
+
+            db_gen['JUNCTION_LENGTH'] = len(jn['JUNCTION']) if jn['JUNCTION'] else 0
+            db_gen['JUNCTION'] = jn['JUNCTION']
+
+            # Alignment scores
+            if score_fields:
+                try:  db_gen['V_SCORE'] = float(sm['V-REGION score'])
+                except (TypeError, ValueError):  db_gen['V_SCORE'] = 'None'
+
+                try:  db_gen['V_IDENTITY'] = float(sm['V-REGION identity %']) / 100.0
+                except (TypeError, ValueError):  db_gen['V_IDENTITY'] = 'None'
+
+                try:  db_gen['J_SCORE'] = float(sm['J-REGION score'])
+                except (TypeError, ValueError):  db_gen['J_SCORE'] = 'None'
+
+                try:  db_gen['J_IDENTITY'] = float(sm['J-REGION identity %']) / 100.0
+                except (TypeError, ValueError):  db_gen['J_IDENTITY'] = 'None'
+
+            # FWR and CDR regions
+            if region_fields: getRegions(db_gen)
+        else:
+            db_gen['V_CALL'] = 'None'
+            db_gen['D_CALL'] = 'None'
+            db_gen['J_CALL'] = 'None'
+
+        yield IgRecord(db_gen)
+
+    
+def getIDforIMGT(seq_file):
+    """
+    Create a sequence ID translation using IMGT truncation
+    
+    Arguments: 
+    seq_file = a fasta file of sequences input to IMGT
+                    
+    Returns: 
+    a dictionary of {truncated ID: full seq description} 
+    """
+    
+    # Create a seq_dict ID translation using IDs truncate up to space or 50 chars
+    ids = {}
+    for i, rec in enumerate(SeqIO.parse(seq_file, 'fasta', IUPAC.ambiguous_dna)):
+        if len(rec.description) <= 50:
+            id_key = rec.description
+        else:
+            id_key = re.sub('\||\s|!|&|\*|<|>|\?','_',rec.description[:50])
+        ids.update({id_key:rec.description})
+
+    return ids
+
+
+def writeDb(db_gen, file_prefix, total_count, id_dict={}, no_parse=True,
+            score_fields=False, region_fields=False, out_args=default_out_args):
+    """
+    Writes tab-delimited database file in output directory
+    
+    Arguments:
+    db_gen = a generator of IgRecord objects containing alignment data
+    file_prefix = directory and prefix for CLIP tab-delim file
+    total_count = number of records (for progress bar)
+    id_dict = a dictionary of {IMGT ID: full seq description}
+    no_parse = if ID is to be parsed for pRESTO output with default delimiters
+    score_fields = if True add alignment score fields to output file
+    region_fields = if True add FWR and CDR region fields to output file
+    out_args = common output argument dictionary from parseCommonArgs
+
+    Returns:
+    None
+    """
+    pass_file = "%s_db-pass.tab" % file_prefix
+    fail_file = "%s_db-fail.tab" % file_prefix
+    ordered_fields = ['SEQUENCE_ID',
+                      'SEQUENCE_INPUT',
+                      'FUNCTIONAL',
+                      'IN_FRAME',
+                      'STOP',
+                      'MUTATED_INVARIANT',
+                      'INDELS',
+                      'V_CALL',
+                      'D_CALL',
+                      'J_CALL',
+                      'SEQUENCE_VDJ',
+                      'SEQUENCE_IMGT',
+                      'V_SEQ_START',
+                      'V_SEQ_LENGTH',
+                      'V_GERM_START_VDJ',
+                      'V_GERM_LENGTH_VDJ',
+                      'V_GERM_START_IMGT',
+                      'V_GERM_LENGTH_IMGT',
+                      'N1_LENGTH',
+                      'D_SEQ_START',
+                      'D_SEQ_LENGTH',
+                      'D_GERM_START',
+                      'D_GERM_LENGTH',
+                      'N2_LENGTH',
+                      'J_SEQ_START',
+                      'J_SEQ_LENGTH',
+                      'J_GERM_START',
+                      'J_GERM_LENGTH',
+                      'JUNCTION_LENGTH',
+                      'JUNCTION']
+
+    if score_fields:
+        ordered_fields.extend(['V_SCORE',
+                               'V_IDENTITY',
+                               'V_EVALUE',
+                               'V_BTOP',
+                               'J_SCORE',
+                               'J_IDENTITY',
+                               'J_EVALUE',
+                               'J_BTOP'])
+
+    if region_fields:
+        ordered_fields.extend(['FWR1_IMGT', 'FWR2_IMGT', 'FWR3_IMGT', 'FWR4_IMGT',
+                               'CDR1_IMGT', 'CDR2_IMGT', 'CDR3_IMGT'])
+
+
+    # TODO:  This is not the best approach. should pass in output fields.
+    # Initiate passed handle
+    pass_handle = None
+
+    # Open failed file
+    if out_args['failed']:
+        fail_handle = open(fail_file, 'wt')
+        fail_writer = getDbWriter(fail_handle, add_fields=['SEQUENCE_ID', 'SEQUENCE_INPUT'])
+    else:
+        fail_handle = None
+        fail_writer = None
+
+    # Initialize counters and file
+    pass_writer = None
+    start_time = time()
+    rec_count = pass_count = fail_count = 0
+    for record in db_gen:
+        #printProgress(i + (total_count/2 if id_dict else 0), total_count, 0.05, start_time)
+        printProgress(rec_count, total_count, 0.05, start_time)
+        rec_count += 1
+
+        # Count pass or fail
+        if (record.v_call == 'None' and record.j_call == 'None') or \
+                record.functional is None or \
+                not record.seq_vdj or \
+                not record.junction:
+            # print(record.v_call, record.j_call, record.functional, record.junction)
+            fail_count += 1
+            if fail_writer is not None: fail_writer.writerow(record.toDict())
+            continue
+        else: 
+            pass_count += 1
+            
+        # Build sample sequence description
+        if record.id in id_dict:
+            record.id = id_dict[record.id]
+
+        # Parse sequence description into new columns
+        if not no_parse:
+            record.annotations = parseAnnotation(record.id, delimiter=out_args['delimiter'])
+            record.id = record.annotations['ID']
+            del record.annotations['ID']
+
+        # TODO:  This is not the best approach. should pass in output fields.
+        # If first sequence, use parsed description to create new columns and initialize writer
+        if pass_writer is None:
+            if not no_parse:  ordered_fields.extend(list(record.annotations.keys()))
+            pass_handle = open(pass_file, 'wt')
+            pass_writer = getDbWriter(pass_handle, add_fields=ordered_fields)
+
+        # Write row to tab-delim CLIP file
+        pass_writer.writerow(record.toDict())
+    
+    # Print log
+    #printProgress(i+1 + (total_count/2 if id_dict else 0), total_count, 0.05, start_time)
+    printProgress(rec_count, total_count, 0.05, start_time)
+
+    log = OrderedDict()
+    log['OUTPUT'] = pass_file
+    log['PASS'] = pass_count
+    log['FAIL'] = fail_count
+    log['END'] = 'MakeDb'
+    printLog(log)
+    
+    if pass_handle is not None: pass_handle.close()
+    if fail_handle is not None: fail_handle.close()
+
+
+# TODO:  may be able to merge with parseIMGT
+def parseIgBlast(igblast_output, seq_file, repo, no_parse=True, score_fields=False,
+                 region_fields=False, out_args=default_out_args):
+    """
+    Main for IgBlast aligned sample sequences
+
+    Arguments:
+    igblast_output = IgBlast output file to process
+    seq_file = fasta file input to IgBlast (from which to get sequence)
+    repo = folder with germline repertoire files
+    no_parse = if ID is to be parsed for pRESTO output with default delimiters
+    score_fields = if True add alignment score fields to output file
+    region_fields = if True add FWR and CDR region fields to output file
+    out_args = common output argument dictionary from parseCommonArgs
+
+    Returns:
+    None
+    """
+    # Print parameter info
+    log = OrderedDict()
+    log['START'] = 'MakeDB'
+    log['ALIGNER'] = 'IgBlast'
+    log['ALIGN_RESULTS'] = os.path.basename(igblast_output)
+    log['SEQ_FILE'] = os.path.basename(seq_file)
+    log['NO_PARSE'] = no_parse
+    log['SCORE_FIELDS'] = score_fields
+    log['REGION_FIELDS'] = region_fields
+    printLog(log)
+
+    # Get input sequence dictionary
+    seq_dict = getSeqforIgBlast(seq_file)
+
+    # Formalize out_dir and file-prefix
+    if not out_args['out_dir']:
+        out_dir = os.path.split(igblast_output)[0]
+    else:
+        out_dir = os.path.abspath(out_args['out_dir'])
+        if not os.path.exists(out_dir):  os.mkdir(out_dir)
+    if out_args['out_name']:
+        file_prefix = out_args['out_name']
+    else:
+        file_prefix = os.path.basename(os.path.splitext(igblast_output)[0])
+    file_prefix = os.path.join(out_dir, file_prefix)
+
+    total_count = countSeqFile(seq_file)
+
+    # Create
+    repo_dict = getRepo(repo)
+    igblast_dict = readIgBlast(igblast_output, seq_dict, repo_dict,
+                               score_fields=score_fields, region_fields=region_fields)
+    writeDb(igblast_dict, file_prefix, total_count, no_parse=no_parse,
+            score_fields=score_fields, region_fields=region_fields, out_args=out_args)
+
+
+# TODO:  may be able to merge with parseIgBlast
+def parseIMGT(imgt_output, seq_file=None, no_parse=True, score_fields=False,
+              region_fields=False, out_args=default_out_args):
+    """
+    Main for IMGT aligned sample sequences
+
+    Arguments:
+    imgt_output = zipped file or unzipped folder output by IMGT
+    seq_file = FASTA file input to IMGT (from which to get seqID)
+    no_parse = if ID is to be parsed for pRESTO output with default delimiters
+    score_fields = if True add alignment score fields to output file
+    region_fields = if True add FWR and CDR region fields to output file
+    out_args = common output argument dictionary from parseCommonArgs
+        
+    Returns: 
+    None
+    """
+    # Print parameter info
+    log = OrderedDict()
+    log['START'] = 'MakeDb'
+    log['ALIGNER'] = 'IMGT'
+    log['ALIGN_RESULTS'] = imgt_output
+    log['SEQ_FILE'] = os.path.basename(seq_file) if seq_file else ''
+    log['NO_PARSE'] = no_parse
+    log['SCORE_FIELDS'] = score_fields
+    log['REGION_FIELDS'] = region_fields
+    printLog(log)
+    
+    # Get individual IMGT result files
+    temp_dir, imgt_files = extractIMGT(imgt_output)
+        
+    # Formalize out_dir and file-prefix
+    if not out_args['out_dir']:
+        out_dir = os.path.dirname(os.path.abspath(imgt_output))
+    else:
+        out_dir = os.path.abspath(out_args['out_dir'])
+        if not os.path.exists(out_dir):  os.mkdir(out_dir)
+    if out_args['out_name']:
+        file_prefix = out_args['out_name']
+    else:
+        file_prefix = os.path.splitext(os.path.split(os.path.abspath(imgt_output))[1])[0]
+    file_prefix = os.path.join(out_dir, file_prefix)
+
+    total_count = countDbFile(imgt_files[0])
+    
+    # Get (parsed) IDs from fasta file submitted to IMGT
+    id_dict = getIDforIMGT(seq_file) if seq_file else {}
+    
+    # Create
+    imgt_dict = readIMGT(imgt_files, score_fields=score_fields,
+                         region_fields=region_fields)
+    writeDb(imgt_dict, file_prefix, total_count, id_dict=id_dict, no_parse=no_parse,
+            score_fields=score_fields, region_fields=region_fields, out_args=out_args)
+
+    # Delete temp directory
+    rmtree(temp_dir)
+
+
+def getArgParser():
+    """
+    Defines the ArgumentParser
+
+    Arguments: 
+    None
+                      
+    Returns: 
+    an ArgumentParser object
+    """
+    fields = dedent(
+             '''
+              output files:
+                  db-pass
+                      database of parsed alignment records.
+                  db-fail
+                      database with records failing alignment.
+
+              output fields:
+                  SEQUENCE_ID, SEQUENCE_INPUT, FUNCTIONAL, IN_FRAME, STOP, MUTATED_INVARIANT,
+                  INDELS, V_CALL, D_CALL, J_CALL, SEQUENCE_VDJ and/or SEQUENCE_IMGT,
+                  V_SEQ_START, V_SEQ_LENGTH, V_GERM_START_VDJ and/or V_GERM_START_IMGT,
+                  V_GERM_LENGTH_VDJ and/or V_GERM_LENGTH_IMGT, N1_LENGTH,
+                  D_SEQ_START, D_SEQ_LENGTH, D_GERM_START, D_GERM_LENGTH, N2_LENGTH,
+                  J_SEQ_START, J_SEQ_LENGTH, J_GERM_START, J_GERM_LENGTH,
+                  JUNCTION_LENGTH, JUNCTION, V_SCORE, V_IDENTITY, V_EVALUE, V_BTOP,
+                  J_SCORE, J_IDENTITY, J_EVALUE, J_BTOP, FWR1_IMGT, FWR2_IMGT, FWR3_IMGT,
+                  FWR4_IMGT, CDR1_IMGT, CDR2_IMGT, CDR3_IMGT
+              ''')
+                
+    # Define ArgumentParser
+    parser = ArgumentParser(description=__doc__, epilog=fields,
+                            formatter_class=CommonHelpFormatter)
+    parser.add_argument('--version', action='version',
+                        version='%(prog)s:' + ' %s-%s' %(__version__, __date__))
+    subparsers = parser.add_subparsers(title='subcommands', dest='command',
+                                       help='Aligner used', metavar='')
+    # TODO:  This is a temporary fix for Python issue 9253
+    subparsers.required = True
+
+    # Parent parser    
+    parser_parent = getCommonArgParser(seq_in=False, seq_out=False, log=False)
+
+    # IgBlast Aligner
+    parser_igblast = subparsers.add_parser('igblast', help='Process IgBlast output',
+                                           parents=[parser_parent],
+                                           formatter_class=CommonHelpFormatter)
+    parser_igblast.set_defaults(func=parseIgBlast)
+    parser_igblast.add_argument('-i', nargs='+', action='store', dest='aligner_files',
+                                required=True,
+                                help='''IgBLAST output files in format 7 with query sequence
+                                     (IgBLAST argument \'-outfmt "7 std qseq sseq btop"\').''')
+    parser_igblast.add_argument('-r', nargs='+', action='store', dest='repo', required=True,
+                                help='''List of folders and/or fasta files containing
+                                     IMGT-gapped germline sequences corresponding to the
+                                     set of germlines used in the IgBLAST alignment.''')
+    parser_igblast.add_argument('-s', action='store', nargs='+', dest='seq_files',
+                                required=True,
+                                help='List of input FASTA files containing sequences')
+    parser_igblast.add_argument('--noparse', action='store_true', dest='no_parse',
+                                help='''Specify if input IDs should not be parsed to add
+                                     new columns to database.''')
+    parser_igblast.add_argument('--scores', action='store_true', dest='score_fields',
+                                help='''Specify if alignment score metrics should be
+                                     included in the output. Adds the V_SCORE, V_IDENTITY,
+                                     V_EVALUE, V_BTOP, J_SCORE, J_IDENTITY,
+                                     J_BTOP, and J_EVALUE columns.''')
+    parser_igblast.add_argument('--regions', action='store_true', dest='region_fields',
+                                help='''Specify if IMGT framework and CDR regions should be
+                                     included in the output. Adds the FWR1_IMGT, FWR2_IMGT,
+                                     FWR3_IMGT, FWR4_IMGT, CDR1_IMGT, CDR2_IMGT, and
+                                     CDR3_IMGT columns.''')
+    
+    # IMGT aligner
+    parser_imgt = subparsers.add_parser('imgt', help='Process IMGT/HighV-Quest output', 
+                                        parents=[parser_parent], 
+                                        formatter_class=CommonHelpFormatter)
+    imgt_arg_group =  parser_imgt.add_mutually_exclusive_group(required=True)
+    imgt_arg_group.add_argument('-i', nargs='+', action='store', dest='aligner_files',
+                                help='''Either zipped IMGT output files (.zip) or a folder
+                                     containing unzipped IMGT output files (which must
+                                     include 1_Summary, 2_IMGT-gapped, 3_Nt-sequences,
+                                     and 6_Junction).''')
+    parser_imgt.add_argument('-s', nargs='*', action='store', dest='seq_files',
+                             required=False,
+                             help='List of input FASTA files containing sequences')
+    parser_imgt.add_argument('--noparse', action='store_true', dest='no_parse', 
+                             help='''Specify if input IDs should not be parsed to add new
+                                  columns to database.''')
+    parser_imgt.add_argument('--scores', action='store_true', dest='score_fields',
+                             help='''Specify if alignment score metrics should be
+                                  included in the output. Adds the V_SCORE, V_IDENTITY,
+                                  J_SCORE and J_IDENTITY. Note, this will also add
+                                  the columns V_EVALUE, V_BTOP, J_EVALUE and J_BTOP,
+                                  but they will be empty for IMGT output.''')
+    parser_imgt.add_argument('--regions', action='store_true', dest='region_fields',
+                             help='''Specify if IMGT framework and CDR regions should be
+                                  included in the output. Adds the FWR1_IMGT, FWR2_IMGT,
+                                  FWR3_IMGT, FWR4_IMGT, CDR1_IMGT, CDR2_IMGT, and
+                                  CDR3_IMGT columns.''')
+    parser_imgt.set_defaults(func=parseIMGT)
+
+    return parser
+    
+    
+if __name__ == "__main__":
+    """
+    Parses command line arguments and calls main
+    """
+    parser = getArgParser()    
+    args = parser.parse_args()
+    args_dict = parseCommonArgs(args, in_arg='aligner_files')
+
+    # Set no ID parsing if sequence files are not provided
+    if 'seq_files' in args_dict and not args_dict['seq_files']:
+        args_dict['no_parse'] = True
+
+    # Delete
+    if 'seq_files' in args_dict: del args_dict['seq_files']
+    if 'aligner_files' in args_dict: del args_dict['aligner_files']
+    if 'command' in args_dict: del args_dict['command']
+    if 'func' in args_dict: del args_dict['func']           
+    
+    if args.command == 'imgt':
+        for i in range(len(args.__dict__['aligner_files'])):
+            args_dict['imgt_output'] = args.__dict__['aligner_files'][i]
+            args_dict['seq_file'] = args.__dict__['seq_files'][i] \
+                                    if args.__dict__['seq_files'] else None
+            args.func(**args_dict)
+    elif args.command == 'igblast':
+        for i in range(len(args.__dict__['aligner_files'])):
+            args_dict['igblast_output'] =  args.__dict__['aligner_files'][i]
+            args_dict['seq_file'] = args.__dict__['seq_files'][i]
+            args.func(**args_dict)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/change_o/define_clones.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,15 @@
+args <- commandArgs(trailingOnly = TRUE)
+
+input=args[1]
+output=args[2]
+
+change.o = read.table(input, header=T, sep="\t", quote="", stringsAsFactors=F)
+
+freq = data.frame(table(change.o$CLONE))
+freq2 = data.frame(table(freq$Freq))
+
+freq2$final = as.numeric(freq2$Freq) * as.numeric(as.character(freq2$Var1))
+
+names(freq2) = c("Clone size", "Nr of clones", "Nr of sequences")
+
+write.table(x=freq2, file=output, sep="\t",quote=F,row.names=F,col.names=T)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/change_o/define_clones.sh	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,43 @@
+#!/bin/bash
+dir="$(cd "$(dirname "$0")" && pwd)"
+
+#define_clones.sh $input $noparse $scores $regions $out_file
+
+type=$1
+input=$2
+
+mkdir -p $PWD/outdir
+
+cp $input $PWD/input.tab #file has to have a ".tab" extension
+
+if [ "bygroup" == "$type" ] ; then	
+	mode=$3
+	act=$4
+	model=$5
+	norm=$6
+	sym=$7
+	link=$8
+	dist=$9
+	output=${10}
+	output2=${11}
+	
+	python3 $dir/DefineClones.py bygroup -d $PWD/input.tab --nproc 4 --outdir $PWD/outdir --outname output --mode $mode --act $act --model $model --dist $dist --norm $norm --sym $sym --link $link
+	#/data/users/david/anaconda3/bin/python $dir/DefineClones.py bygroup -d $PWD/input.tab --nproc 4 --outdir $PWD/outdir --outname output --mode $mode --act $act --model $model --dist $dist --norm $norm --sym $sym --link $link
+	#/home/galaxy/anaconda3/bin/python $dir/DefineClones.py bygroup -d $PWD/input.tab --nproc 4 --outdir $PWD/outdir --outname output --mode $mode --act $act --model $model --dist $dist --norm $norm --sym $sym --link $link
+	
+	Rscript $dir/define_clones.r $PWD/outdir/output_clone-pass.tab $output2 2>&1
+else
+	method=$3
+	output=$4
+	output2=$5
+	
+	python3 $dir/DefineClones.py hclust -d $PWD/input.tab --nproc 4 --outdir $PWD/outdir --outname output --method $method
+	#/data/users/david/anaconda3/bin/python $dir/DefineClones.py hclust -d $PWD/input.tab --nproc 4 --outdir $PWD/outdir --outname output --method $method
+	#/home/galaxy/anaconda3/bin/python $dir/DefineClones.py hclust -d $PWD/input.tab --nproc 4 --outdir $PWD/outdir --outname output --method $method
+	
+	Rscript $dir/define_clones.r $PWD/outdir/output_clone-pass.tab $output2 2>&1
+fi
+
+cp $PWD/outdir/output_clone-pass.tab $output
+
+rm -rf $PWD/outdir/
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/change_o/makedb.sh	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,38 @@
+#!/bin/bash
+dir="$(cd "$(dirname "$0")" && pwd)"
+
+input=$1
+noparse=$2
+scores=$3
+regions=$4
+output=$5
+
+if [ "true" == "$noparse" ] ; then
+	noparse="--noparse"
+else
+	noparse=""
+fi
+
+if [ "true" == "$scores" ] ; then
+	scores="--scores"
+else
+	scores=""
+fi
+
+if [ "true" == "$regions" ] ; then
+	regions="--regions"
+else
+	regions=""
+fi
+
+mkdir $PWD/outdir
+
+echo "makedb: $PWD/outdir"
+
+python3 $dir/MakeDb.py imgt -i $input --outdir $PWD/outdir --outname output $noparse $scores $regions
+#/data/users/david/anaconda3/bin/python $dir/MakeDb.py imgt -i $input --outdir $PWD/outdir --outname output $noparse $scores $regions
+#/home/galaxy/anaconda3/bin/python $dir/MakeDb.py imgt -i $input --outdir $PWD/outdir --outname output $noparse $scores $regions
+
+mv $PWD/outdir/output_db-pass.tab $output
+
+rm -rf $PWD/outdir/
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/datatypes_conf.xml	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,6 @@
+<?xml version="1.0"?>
+<datatypes>
+    <registration>
+        <datatype extension="imgt_archive" type="galaxy.datatypes.binary:CompressedArchive" display_in_upload="True" subclass="True"/>
+    </registration>
+</datatypes>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/gene_identification.py	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,220 @@
+import re
+import argparse
+import time
+starttime= int(time.time() * 1000)
+
+parser = argparse.ArgumentParser()
+parser.add_argument("--input", help="The 1_Summary file from an IMGT zip file")
+parser.add_argument("--output", help="The annotated output file to be merged back with the summary file")
+
+args = parser.parse_args()
+
+infile = args.input
+#infile = "test_VH-Ca_Cg_25nt/1_Summary_test_VH-Ca_Cg_25nt_241013.txt"
+output = args.output
+#outfile = "identified.txt"
+
+dic = dict()
+total = 0
+
+
+first = True
+IDIndex = 0
+seqIndex = 0
+
+with open(infile, 'r') as f: #read all sequences into a dictionary as key = ID, value = sequence
+	for line in f:
+		total += 1
+		linesplt = line.split("\t")
+		if first:
+			print "linesplt", linesplt
+			IDIndex = linesplt.index("Sequence ID")
+			seqIndex = linesplt.index("Sequence")
+			first = False
+			continue
+		
+		ID = linesplt[IDIndex]
+		if len(linesplt) < 28: #weird rows without a sequence
+			dic[ID] = ""
+		else:
+			dic[ID] = linesplt[seqIndex]
+			
+print "Number of input sequences:", len(dic)
+
+#old cm sequence: gggagtgcatccgccccaacccttttccccctcgtctcctgtgagaattccc
+#old cg sequence: ctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccag
+
+#lambda/kappa reference sequence
+searchstrings = {"ca": "catccccgaccagccccaaggtcttcccgctgagcctctgcagcacccagccagatgggaacgtggtcatcgcctgcctgg",
+                 "cg": "ctccaccaagggcccatcggtcttccccctggcaccctcctccaagagcacctctgggggcacagcggcc",
+                 "cm": "gggagtgcatccgccccaacc"} #new (shorter) cm sequence
+
+compiledregex = {"ca": [],
+                 "cg": [],
+                 "cm": []}
+
+#lambda/kappa reference sequence variable nucleotides
+ca1 = {38: 't', 39: 'g', 48: 'a', 49: 'g', 51: 'c', 68: 'a', 73: 'c'}
+ca2 = {38: 'g', 39: 'a', 48: 'c', 49: 'c', 51: 'a', 68: 'g', 73: 'a'}
+cg1 = {0: 'c', 33: 'a', 38: 'c', 44: 'a', 54: 't', 56: 'g', 58: 'g', 66: 'g', 132: 'c'}
+cg2 = {0: 'c', 33: 'g', 38: 'g', 44: 'g', 54: 'c', 56: 'a', 58: 'a', 66: 'g', 132: 't'}
+cg3 = {0: 't', 33: 'g', 38: 'g', 44: 'g', 54: 't', 56: 'g', 58: 'g', 66: 'g', 132: 'c'}
+cg4 = {0: 't', 33: 'g', 38: 'g', 44: 'g', 54: 'c', 56: 'a', 58: 'a', 66: 'c', 132: 'c'}
+
+#remove last snp for shorter cg sequence --- note, also change varsInCG
+del cg1[132]
+del cg2[132]
+del cg3[132]
+del cg4[132]
+
+#reference sequences are cut into smaller parts of 'chunklength' length, and with 'chunklength' / 2 overlap
+chunklength = 8
+
+#create the chunks of the reference sequence with regular expressions for the variable nucleotides
+for i in range(0, len(searchstrings["ca"]) - chunklength, chunklength / 2):
+  pos = i
+  chunk = searchstrings["ca"][i:i+chunklength]
+  result = ""
+  varsInResult = 0
+  for c in chunk:
+    if pos in ca1.keys():
+      varsInResult += 1
+      result += "[" + ca1[pos] + ca2[pos] + "]"
+    else:
+      result += c
+    pos += 1
+  compiledregex["ca"].append((re.compile(result), varsInResult))
+
+for i in range(0, len(searchstrings["cg"]) - chunklength, chunklength / 2):
+  pos = i
+  chunk = searchstrings["cg"][i:i+chunklength]
+  result = ""
+  varsInResult = 0
+  for c in chunk:
+    if pos in cg1.keys():
+      varsInResult += 1
+      result += "[" + "".join(set([cg1[pos], cg2[pos], cg3[pos], cg4[pos]])) + "]"
+    else:
+      result += c
+    pos += 1
+  compiledregex["cg"].append((re.compile(result), varsInResult))
+
+for i in range(0, len(searchstrings["cm"]) - chunklength, chunklength / 2):
+  compiledregex["cm"].append((re.compile(searchstrings["cm"][i:i+chunklength]), False))
+
+
+
+def removeAndReturnMaxIndex(x): #simplifies a list comprehension
+  m = max(x)
+  index = x.index(m)
+  x[index] = 0
+  return index
+  
+
+start_location = dict()
+hits = dict()
+alltotal = 0
+for key in compiledregex.keys(): #for ca/cg/cm
+	regularexpressions = compiledregex[key] #get the compiled regular expressions
+	for ID in dic.keys()[0:]: #for every ID
+		if ID not in hits.keys(): #ensure that the dictionairy that keeps track of the hits for every gene exists
+			hits[ID] = {"ca_hits": 0, "cg_hits": 0, "cm_hits": 0, "ca1": 0, "ca2": 0, "cg1": 0, "cg2": 0, "cg3": 0, "cg4": 0}
+		currentIDHits = hits[ID]
+		seq = dic[ID]
+		lastindex = 0
+		start_zero = len(searchstrings[key]) #allows the reference sequence to start before search sequence (start_locations of < 0)
+		start = [0] * (len(seq) + start_zero)
+		for i, regexp in enumerate(regularexpressions): #for every regular expression
+			relativeStartLocation = lastindex - (chunklength / 2) * i
+			if relativeStartLocation >= len(seq):
+				break
+			regex, hasVar = regexp
+			matches = regex.finditer(seq[lastindex:])
+			for match in matches: #for every match with the current regex, only uses the first hit
+				lastindex += match.start()
+				start[relativeStartLocation + start_zero] += 1
+				if hasVar: #if the regex has a variable nt in it
+					chunkstart = chunklength / 2 * i #where in the reference does this chunk start
+					chunkend = chunklength / 2 * i + chunklength #where in the reference does this chunk end
+					if key == "ca": #just calculate the variable nt score for 'ca', cheaper
+						currentIDHits["ca1"] += len([1 for x in ca1 if chunkstart <= x < chunkend and ca1[x] == seq[lastindex + x - chunkstart]])
+						currentIDHits["ca2"] += len([1 for x in ca2 if chunkstart <= x < chunkend and ca2[x] == seq[lastindex + x - chunkstart]])
+					elif key == "cg": #just calculate the variable nt score for 'cg', cheaper
+						currentIDHits["cg1"] += len([1 for x in cg1 if chunkstart <= x < chunkend and cg1[x] == seq[lastindex + x - chunkstart]])
+						currentIDHits["cg2"] += len([1 for x in cg2 if chunkstart <= x < chunkend and cg2[x] == seq[lastindex + x - chunkstart]])
+						currentIDHits["cg3"] += len([1 for x in cg3 if chunkstart <= x < chunkend and cg3[x] == seq[lastindex + x - chunkstart]])
+						currentIDHits["cg4"] += len([1 for x in cg4 if chunkstart <= x < chunkend and cg4[x] == seq[lastindex + x - chunkstart]])
+					else: #key == "cm" #no variable regions in 'cm'
+						pass
+				break #this only breaks when there was a match with the regex, breaking means the 'else:' clause is skipped
+			else: #only runs if there were no hits
+				continue
+			#print "found ", regex.pattern , "at", lastindex, "adding one to", (lastindex - chunklength / 2 * i), "to the start array of", ID, "gene", key, "it's now:", start[lastindex - chunklength / 2 * i]
+			currentIDHits[key + "_hits"] += 1
+		start_location[ID + "_" + key] = str([(removeAndReturnMaxIndex(start) + 1 - start_zero) for x in range(5) if len(start) > 0 and max(start) > 1])
+		#start_location[ID + "_" + key] = str(start.index(max(start)))
+
+
+chunksInCA = len(compiledregex["ca"])
+chunksInCG = len(compiledregex["cg"])
+chunksInCM = len(compiledregex["cm"])
+requiredChunkPercentage = 0.7
+varsInCA = float(len(ca1.keys()) * 2)
+varsInCG = float(len(cg1.keys()) * 2) - 2 # -2 because the sliding window doesn't hit the first and last nt twice
+varsInCM = 0
+
+
+
+first = True
+seq_write_count=0
+with open(infile, 'r') as f: #read all sequences into a dictionary as key = ID, value = sequence
+	with open(output, 'w') as o:
+		for line in f:
+			total += 1
+			if first:
+				o.write("Sequence ID\tbest_match\tnt_hit_percentage\tchunk_hit_percentage\tstart_locations\n")
+				first = False
+				continue
+			linesplt = line.split("\t")
+			if linesplt[2] == "No results":
+				pass
+			ID = linesplt[1]
+			currentIDHits = hits[ID]
+			possibleca = float(len(compiledregex["ca"]))
+			possiblecg = float(len(compiledregex["cg"]))
+			possiblecm = float(len(compiledregex["cm"]))
+			cahits = currentIDHits["ca_hits"]
+			cghits = currentIDHits["cg_hits"]
+			cmhits = currentIDHits["cm_hits"]
+			if cahits >= cghits and cahits >= cmhits: #its a ca gene
+				ca1hits = currentIDHits["ca1"]
+				ca2hits = currentIDHits["ca2"]
+				if ca1hits >= ca2hits:
+					o.write(ID + "\tIGA1\t" + str(int(ca1hits / varsInCA * 100)) + "\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\n")
+				else:
+					o.write(ID + "\tIGA2\t" + str(int(ca2hits / varsInCA * 100)) + "\t" + str(int(cahits / possibleca * 100)) + "\t" + start_location[ID + "_ca"] + "\n")
+			elif cghits >= cahits and cghits >= cmhits: #its a cg gene
+				cg1hits = currentIDHits["cg1"]
+				cg2hits = currentIDHits["cg2"]
+				cg3hits = currentIDHits["cg3"]
+				cg4hits = currentIDHits["cg4"]
+				if cg1hits >= cg2hits and cg1hits >= cg3hits and cg1hits >= cg4hits: #cg1 gene
+					o.write(ID + "\tIGG1\t" + str(int(cg1hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
+				elif cg2hits >= cg1hits and cg2hits >= cg3hits and cg2hits >= cg4hits: #cg2 gene
+					o.write(ID + "\tIGG2\t" + str(int(cg2hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
+				elif cg3hits >= cg1hits and cg3hits >= cg2hits and cg3hits >= cg4hits: #cg3 gene
+					o.write(ID + "\tIGG3\t" + str(int(cg3hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
+				else: #cg4 gene
+					o.write(ID + "\tIGG4\t" + str(int(cg4hits / varsInCG * 100)) + "\t" + str(int(cghits / possiblecg * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
+			else: #its a cm gene
+				o.write(ID + "\tIGM\t100\t" + str(int(cmhits / possiblecm * 100)) + "\t" + start_location[ID + "_cg"] + "\n")
+			seq_write_count += 1
+
+print "Time: %i" % (int(time.time() * 1000) - starttime)
+
+print "Number of sequences written to file:", seq_write_count
+
+
+
+
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/imgt_loader.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,82 @@
+args <- commandArgs(trailingOnly = TRUE)
+
+summ.file = args[1]
+aa.file = args[2]
+junction.file = args[3]
+out.file = args[4]
+
+summ = read.table(summ.file, sep="\t", header=T, quote="", fill=T)
+aa = read.table(aa.file, sep="\t", header=T, quote="", fill=T)
+junction = read.table(junction.file, sep="\t", header=T, quote="", fill=T)
+
+old_summary_columns=c('Sequence.ID','JUNCTION.frame','V.GENE.and.allele','D.GENE.and.allele','J.GENE.and.allele','CDR1.IMGT.length','CDR2.IMGT.length','CDR3.IMGT.length','Orientation')
+old_sequence_columns=c('CDR1.IMGT','CDR2.IMGT','CDR3.IMGT')
+old_junction_columns=c('JUNCTION')
+
+added_summary_columns=c('Functionality','V.REGION.identity..','V.REGION.identity.nt','D.REGION.reading.frame','AA.JUNCTION','Functionality.comment','Sequence')
+added_sequence_columns=c('FR1.IMGT','FR2.IMGT','FR3.IMGT','CDR3.IMGT','JUNCTION','J.REGION','FR4.IMGT')
+
+added_junction_columns=c('P3.V.nt.nb','N.REGION.nt.nb','N1.REGION.nt.nb','P5.D.nt.nb','P3.D.nt.nb','N2.REGION.nt.nb','P5.J.nt.nb','X3.V.REGION.trimmed.nt.nb','X5.D.REGION.trimmed.nt.nb','X3.D.REGION.trimmed.nt.nb','X5.J.REGION.trimmed.nt.nb','N.REGION','N1.REGION','N2.REGION')
+added_junction_columns=c(added_junction_columns, 'P5.D1.nt.nb', 'P3.D1.nt.nb', 'N2.REGION.nt.nb', 'P5.D2.nt.nb', 'P3.D2.nt.nb', 'N3.REGION.nt.nb', 'P5.D3.nt.nb', 'P3.D2.nt.nb', 'N4.REGION.nt.nb', 'X5.D1.REGION.trimmed.nt.nb', 'X3.D1.REGION.trimmed.nt.nb', 'X5.D2.REGION.trimmed.nt.nb', 'X3.D2.REGION.trimmed.nt.nb', 'X5.D3.REGION.trimmed.nt.nb', 'X3.D3.REGION.trimmed.nt.nb', 'D.REGION.nt.nb', 'D1.REGION.nt.nb', 'D2.REGION.nt.nb', 'D3.REGION.nt.nb')
+
+out=summ[,c("Sequence.ID","JUNCTION.frame","V.GENE.and.allele","D.GENE.and.allele","J.GENE.and.allele")]
+
+out[,"CDR1.Seq"] = aa[,"CDR1.IMGT"]
+out[,"CDR1.Length"] = summ[,"CDR1.IMGT.length"]
+
+out[,"CDR2.Seq"] = aa[,"CDR2.IMGT"]
+out[,"CDR2.Length"] = summ[,"CDR2.IMGT.length"]
+
+out[,"CDR3.Seq"] = aa[,"CDR3.IMGT"]
+out[,"CDR3.Length"] = summ[,"CDR3.IMGT.length"]
+
+out[,"CDR3.Seq.DNA"] = junction[,"JUNCTION"]
+out[,"CDR3.Length.DNA"] = nchar(as.character(junction[,"JUNCTION"]))
+out[,"Strand"] = summ[,"Orientation"]
+out[,"CDR3.Found.How"] = "a"
+
+out[,added_summary_columns] = summ[,added_summary_columns]
+
+out[,added_sequence_columns] = aa[,added_sequence_columns]
+
+out[,added_junction_columns] = junction[,added_junction_columns]
+
+out[,"Top V Gene"] = gsub(".* ", "", gsub("\\*.*", "", summ[,"V.GENE.and.allele"]))
+out[,"Top D Gene"] = gsub(".* ", "", gsub("\\*.*", "", summ[,"D.GENE.and.allele"]))
+out[,"Top J Gene"] = gsub(".* ", "", gsub("\\*.*", "", summ[,"J.GENE.and.allele"]))
+
+out = out[,c('Sequence.ID','JUNCTION.frame','Top V Gene','Top D Gene','Top J Gene','CDR1.Seq','CDR1.Length','CDR2.Seq','CDR2.Length','CDR3.Seq','CDR3.Length','CDR3.Seq.DNA','CDR3.Length.DNA','Strand','CDR3.Found.How','Functionality','V.REGION.identity..','V.REGION.identity.nt','D.REGION.reading.frame','AA.JUNCTION','Functionality.comment','Sequence','FR1.IMGT','FR2.IMGT','FR3.IMGT','CDR3.IMGT','JUNCTION','J.REGION','FR4.IMGT','P3.V.nt.nb','N.REGION.nt.nb','N1.REGION.nt.nb','P5.D.nt.nb','P3.D.nt.nb','N2.REGION.nt.nb','P5.J.nt.nb','X3.V.REGION.trimmed.nt.nb','X5.D.REGION.trimmed.nt.nb','X3.D.REGION.trimmed.nt.nb','X5.J.REGION.trimmed.nt.nb','N.REGION','N1.REGION','N2.REGION', 'P5.D1.nt.nb', 'P3.D1.nt.nb', 'N2.REGION.nt.nb', 'P5.D2.nt.nb', 'P3.D2.nt.nb', 'N3.REGION.nt.nb', 'P5.D3.nt.nb', 'P3.D2.nt.nb', 'N4.REGION.nt.nb', 'X5.D1.REGION.trimmed.nt.nb', 'X3.D1.REGION.trimmed.nt.nb', 'X5.D2.REGION.trimmed.nt.nb', 'X3.D2.REGION.trimmed.nt.nb', 'X5.D3.REGION.trimmed.nt.nb', 'X3.D3.REGION.trimmed.nt.nb', 'D.REGION.nt.nb', 'D1.REGION.nt.nb', 'D2.REGION.nt.nb', 'D3.REGION.nt.nb')]
+
+names(out) = c('ID','VDJ Frame','Top V Gene','Top D Gene','Top J Gene','CDR1 Seq','CDR1 Length','CDR2 Seq','CDR2 Length','CDR3 Seq','CDR3 Length','CDR3 Seq DNA','CDR3 Length DNA','Strand','CDR3 Found How','Functionality','V-REGION identity %','V-REGION identity nt','D-REGION reading frame','AA JUNCTION','Functionality comment','Sequence','FR1-IMGT','FR2-IMGT','FR3-IMGT','CDR3-IMGT','JUNCTION','J-REGION','FR4-IMGT','P3V-nt nb','N-REGION-nt nb','N1-REGION-nt nb','P5D-nt nb','P3D-nt nb','N2-REGION-nt nb','P5J-nt nb','3V-REGION trimmed-nt nb','5D-REGION trimmed-nt nb','3D-REGION trimmed-nt nb','5J-REGION trimmed-nt nb','N-REGION','N1-REGION','N2-REGION', 'P5.D1.nt.nb', 'P3.D1.nt.nb', 'N2.REGION.nt.nb', 'P5.D2.nt.nb', 'P3.D2.nt.nb', 'N3.REGION.nt.nb', 'P5.D3.nt.nb', 'P3.D2.nt.nb', 'N4.REGION.nt.nb', 'X5.D1.REGION.trimmed.nt.nb', 'X3.D1.REGION.trimmed.nt.nb', 'X5.D2.REGION.trimmed.nt.nb', 'X3.D2.REGION.trimmed.nt.nb', 'X5.D3.REGION.trimmed.nt.nb', 'X3.D3.REGION.trimmed.nt.nb', 'D.REGION.nt.nb', 'D1.REGION.nt.nb', 'D2.REGION.nt.nb', 'D3.REGION.nt.nb')
+
+out[,"VDJ Frame"] = as.character(out[,"VDJ Frame"])
+
+fltr = out[,"VDJ Frame"] == "in-frame"
+if(any(fltr)){
+	out[fltr, "VDJ Frame"] = "In-frame"
+}
+
+fltr = out[,"VDJ Frame"] == "null"
+if(any(fltr)){
+	out[fltr, "VDJ Frame"] = "Out-of-frame"
+}
+
+fltr = out[,"VDJ Frame"] == "out-of-frame"
+if(any(fltr)){
+	out[fltr, "VDJ Frame"] = "Out-of-frame"
+}
+
+fltr = out[,"VDJ Frame"] == ""
+if(any(fltr)){
+	out[fltr, "VDJ Frame"] = "Out-of-frame"
+}
+
+for(col in c('Top V Gene','Top D Gene','Top J Gene')){
+	out[,col] = as.character(out[,col])
+	fltr = out[,col] == ""
+	if(any(fltr)){
+		out[fltr,col] = "NA"
+	}
+}
+
+write.table(out, out.file, sep="\t", quote=F, row.names=F, col.names=T)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/merge.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,27 @@
+args <- commandArgs(trailingOnly = TRUE)
+
+input.1 = args[1]
+input.2 = args[2]
+
+fields.1 = args[3]
+fields.2 = args[4]
+
+field.1 = args[5]
+field.2 = args[6]
+
+output = args[7]
+
+dat1 = read.table(input.1, header=T, sep="\t", quote="", stringsAsFactors=F, fill=T, row.names=NULL)
+if(fields.1 != "all"){
+	fields.1 = unlist(strsplit(fields.1, ","))
+	dat1 = dat1[,fields.1]
+}
+dat2 = read.table(input.2, header=T, sep="\t", quote="", stringsAsFactors=F, fill=T, row.names=NULL)
+if(fields.2 != "all"){
+	fields.2 = unlist(strsplit(fields.2, ","))
+	dat2 = dat2[,fields.2]
+}
+
+dat3 = merge(dat1, dat2, by.x=field.1, by.y=field.2)
+
+write.table(dat3, output, sep="\t",quote=F,row.names=F,col.names=T)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/merge_and_filter.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,225 @@
+args <- commandArgs(trailingOnly = TRUE)
+
+
+summaryfile = args[1]
+sequencesfile = args[2]
+mutationanalysisfile = args[3]
+mutationstatsfile = args[4]
+hotspotsfile = args[5]
+gene_identification_file= args[6]
+output = args[7]
+before.unique.file = args[8]
+unmatchedfile = args[9]
+method=args[10]
+functionality=args[11]
+unique.type=args[12]
+filter.unique=args[13]
+class.filter=args[14]
+empty.region.filter=args[15]
+
+summ = read.table(summaryfile, header=T, sep="\t", fill=T, stringsAsFactors=F, quote="")
+sequences = read.table(sequencesfile, header=T, sep="\t", fill=T, stringsAsFactors=F, quote="")
+mutationanalysis = read.table(mutationanalysisfile, header=T, sep="\t", fill=T, stringsAsFactors=F, quote="")
+mutationstats = read.table(mutationstatsfile, header=T, sep="\t", fill=T, stringsAsFactors=F, quote="")
+hotspots = read.table(hotspotsfile, header=T, sep="\t", fill=T, stringsAsFactors=F, quote="")
+gene_identification = read.table(gene_identification_file, header=T, sep="\t", fill=T, stringsAsFactors=F, quote="")
+
+if(method == "blastn"){
+	"qseqid\tsseqid\tpident\tlength\tmismatch\tgapopen\tqstart\tqend\tsstart\tsend\tevalue\tbitscore"
+	gene_identification = gene_identification[!duplicated(gene_identification$qseqid),]
+	ref_length = data.frame(sseqid=c("ca1", "ca2", "cg1", "cg2", "cg3", "cg4", "cm"), ref.length=c(81,81,141,141,141,141,52))
+	gene_identification = merge(gene_identification, ref_length, by="sseqid", all.x=T)
+	gene_identification$chunk_hit_percentage = (gene_identification$length / gene_identification$ref.length) * 100
+	gene_identification = gene_identification[,c("qseqid", "chunk_hit_percentage", "pident", "qstart", "sseqid")]
+	colnames(gene_identification) = c("Sequence.ID", "chunk_hit_percentage", "nt_hit_percentage", "start_locations", "best_match")
+	
+}
+
+input.sequence.count = nrow(summ)
+print(paste("Number of sequences in summary file:", input.sequence.count))
+
+filtering.steps = data.frame(character(0), numeric(0))
+
+filtering.steps = rbind(filtering.steps, c("Input", input.sequence.count))
+
+filtering.steps[,1] = as.character(filtering.steps[,1])
+filtering.steps[,2] = as.character(filtering.steps[,2])
+#filtering.steps[,3] = as.numeric(filtering.steps[,3])
+
+summ = merge(summ, gene_identification, by="Sequence.ID")
+
+summ = summ[summ$Functionality != "No results",]
+
+print(paste("Number of sequences after 'No results' filter:", nrow(summ)))
+
+filtering.steps = rbind(filtering.steps, c("After 'No results' filter", nrow(summ)))
+
+if(functionality == "productive"){
+	summ = summ[summ$Functionality == "productive (see comment)" | summ$Functionality == "productive",]
+} else if (functionality == "unproductive"){
+	summ = summ[summ$Functionality == "unproductive (see comment)" | summ$Functionality == "unproductive",]
+} else if (functionality == "remove_unknown"){
+	summ = summ[summ$Functionality != "No results" & summ$Functionality != "unknown (see comment)" & summ$Functionality != "unknown",]
+}
+
+print(paste("Number of sequences after productive filter:", nrow(summ)))
+
+filtering.steps = rbind(filtering.steps, c("After productive filter", nrow(summ)))
+
+splt = strsplit(class.filter, "_")[[1]]
+chunk_hit_threshold = as.numeric(splt[1])
+nt_hit_threshold = as.numeric(splt[2])
+
+higher_than=(summ$chunk_hit_percentage >= chunk_hit_threshold & summ$nt_hit_percentage >= nt_hit_threshold)
+
+unmatched=summ[NULL,c("Sequence.ID", "chunk_hit_percentage", "nt_hit_percentage", "start_locations", "best_match")]
+
+if(!all(higher_than, na.rm=T)){ #check for 'not all' because that would mean the unmatched set is empty
+	unmatched = summ[!higher_than,]
+	unmatched = unmatched[,c("Sequence.ID", "chunk_hit_percentage", "nt_hit_percentage", "start_locations", "best_match")]
+	unmatched$best_match = paste("unmatched,", unmatched$best_match)
+	summ[!higher_than,"best_match"] = paste("unmatched,", summ[!higher_than,"best_match"])
+}
+
+if(any(higher_than, na.rm=T)){
+	#summ = summ[higher_than,]
+}
+
+if(nrow(summ) == 0){
+	stop("No data remaining after filter")
+}
+
+result = merge(summ, mutationanalysis[,!(names(mutationanalysis) %in% names(summ)[-1])], by="Sequence.ID")
+
+print(paste("Number of sequences after merging with mutation analysis file:", nrow(result)))
+
+result = merge(result, mutationstats[,!(names(mutationstats) %in% names(result)[-1])], by="Sequence.ID")
+
+print(paste("Number of sequences after merging with mutation stats file:", nrow(result)))
+
+result = merge(result, hotspots[,!(names(hotspots) %in% names(result)[-1])], by="Sequence.ID")
+
+print(paste("Number of sequences after merging with hotspots file:", nrow(result)))
+
+sequences = sequences[,c("Sequence.ID", "FR1.IMGT", "CDR1.IMGT", "FR2.IMGT", "CDR2.IMGT", "FR3.IMGT", "CDR3.IMGT")]
+names(sequences) = c("Sequence.ID", "FR1.IMGT.seq", "CDR1.IMGT.seq", "FR2.IMGT.seq", "CDR2.IMGT.seq", "FR3.IMGT.seq", "CDR3.IMGT.seq")
+result = merge(result, sequences, by="Sequence.ID", all.x=T)
+
+print(paste("Number of sequences in result after merging with sequences:", nrow(result)))
+
+result$VGene = gsub("^Homsap ", "", result$V.GENE.and.allele)
+result$VGene = gsub("[*].*", "", result$VGene)
+result$DGene = gsub("^Homsap ", "", result$D.GENE.and.allele)
+result$DGene = gsub("[*].*", "", result$DGene)
+result$JGene = gsub("^Homsap ", "", result$J.GENE.and.allele)
+result$JGene = gsub("[*].*", "", result$JGene)
+
+result$past = do.call(paste, c(result[unlist(strsplit(unique.type, ","))], sep = ":"))
+
+result = result[!(duplicated(result$past)), ]
+
+result = result[,!(names(result) %in% c("past"))]
+
+print(paste("Number of sequences in result after", unique.type, "filtering:", nrow(result)))
+
+filtering.steps = rbind(filtering.steps, c("After duplicate filter", nrow(result)))
+
+print(paste("Number of empty CDR1 sequences:", sum(result$CDR1.IMGT.seq == "")))
+print(paste("Number of empty FR2 sequences:", sum(result$FR2.IMGT.seq == "")))
+print(paste("Number of empty CDR2 sequences:", sum(result$CDR2.IMGT.seq == "")))
+print(paste("Number of empty FR3 sequences:", sum(result$FR3.IMGT.seq == "")))
+
+if(empty.region.filter == "FR1"){
+	result = result[result$CDR1.IMGT.seq != "" & result$FR2.IMGT.seq != "" & result$CDR2.IMGT.seq != "" & result$FR3.IMGT.seq != "", ]
+	print(paste("Number of sequences after empty CDR1, FR2, CDR2 and FR3 column filter:", nrow(result)))
+	filtering.steps = rbind(filtering.steps, c("After empty CDR1, FR2, CDR2, FR3 filter", nrow(result)))
+} else if(empty.region.filter == "CDR1"){
+	result = result[result$FR2.IMGT.seq != "" & result$CDR2.IMGT.seq != "" & result$FR3.IMGT.seq != "", ]
+	print(paste("Number of sequences after empty FR2, CDR2 and FR3 column filter:", nrow(result)))
+	filtering.steps = rbind(filtering.steps, c("After empty FR2, CDR2, FR3 filter", nrow(result)))
+} else if(empty.region.filter == "FR2"){
+	result = result[result$CDR2.IMGT.seq != "" & result$FR3.IMGT.seq != "", ]
+	print(paste("Number of sequences after empty CDR2 and FR3 column filter:", nrow(result)))
+	filtering.steps = rbind(filtering.steps, c("After empty CDR2, FR3 filter", nrow(result)))
+}
+
+if(empty.region.filter == "FR1"){
+	result = result[!(grepl("n|N", result$FR2.IMGT.seq) | grepl("n|N", result$FR3.IMGT.seq) | grepl("n|N", result$CDR1.IMGT.seq) | grepl("n|N", result$CDR2.IMGT.seq) | grepl("n|N", result$CDR3.IMGT.seq)),]
+} else if(empty.region.filter == "CDR1"){
+	result = result[!(grepl("n|N", result$FR2.IMGT.seq) | grepl("n|N", result$FR3.IMGT.seq) | grepl("n|N", result$CDR2.IMGT.seq) | grepl("n|N", result$CDR3.IMGT.seq)),]
+} else if(empty.region.filter == "FR2"){
+	result = result[!(grepl("n|N", result$FR3.IMGT.seq) | grepl("n|N", result$CDR3.IMGT.seq)),]
+}
+
+print(paste("Number of sequences in result after n filtering:", nrow(result)))
+filtering.steps = rbind(filtering.steps, c("After N filter", nrow(result)))
+
+cleanup_columns = c("FR1.IMGT.Nb.of.mutations", 
+                    "CDR1.IMGT.Nb.of.mutations", 
+                    "FR2.IMGT.Nb.of.mutations", 
+                    "CDR2.IMGT.Nb.of.mutations", 
+                    "FR3.IMGT.Nb.of.mutations")
+
+for(col in cleanup_columns){
+  result[,col] = gsub("\\(.*\\)", "", result[,col])
+  result[,col] = as.numeric(result[,col])
+  result[is.na(result[,col]),] = 0
+}
+
+write.table(result, before.unique.file, sep="\t", quote=F,row.names=F,col.names=T)
+
+if(filter.unique != "no"){
+	clmns = names(result)
+	
+	if(empty.region.filter == "FR1"){
+		result$unique.def = paste(result$CDR1.IMGT.seq, result$FR2.IMGT.seq, result$CDR2.IMGT.seq, result$FR3.IMGT.seq, result$CDR3.IMGT.seq)
+	} else if(empty.region.filter == "CDR1"){
+		rresult$unique.def = paste(result$FR2.IMGT.seq, result$CDR2.IMGT.seq, result$FR3.IMGT.seq, result$CDR3.IMGT.seq)
+	} else if(empty.region.filter == "FR2"){
+		result$unique.def = paste(result$CDR2.IMGT.seq, result$FR3.IMGT.seq, result$CDR3.IMGT.seq)
+	}
+	
+	if(grepl("_c", filter.unique)){
+		result$unique.def = paste(result$unique.def, result$best_match)
+	}
+
+	#fltr = result$unique.def %in% result.filtered$unique.def
+
+	if(grepl("keep", filter.unique)){
+		result$unique.def = paste(result$unique.def, result$best_match) #keep the unique sequences that are in multiple classes
+		result = result[!duplicated(result$unique.def),]
+	} else {
+		result = result[duplicated(result$unique.def) | duplicated(result$unique.def, fromLast=T),]
+		result$unique.def = paste(result$unique.def, result$best_match) #keep the unique sequences that are in multiple classes
+		result = result[!duplicated(result$unique.def),]
+	}
+	
+	#result = result[,clmns]
+	
+	#write.table(inputdata.removed, "unique_removed.csv", sep=",",quote=F,row.names=F,col.names=T)
+}
+
+print(paste("Number of sequences in result after CDR/FR filtering:", nrow(result)))
+print(paste("Number of matched sequences in result after CDR/FR filtering:", nrow(result[!grepl("unmatched", result$best_match),])))
+
+filtering.steps = rbind(filtering.steps, c("After unique filter", nrow(result)))
+
+print(paste("Number of rows in result:", nrow(result)))
+print(paste("Number of rows in unmatched:", nrow(unmatched)))
+
+matched.sequences = result[!grepl("^unmatched", result$best_match),]
+
+write.table(x=matched.sequences, file=gsub("merged.txt$", "filtered.txt", output), sep="\t",quote=F,row.names=F,col.names=T)
+
+matched.sequences.count = nrow(matched.sequences)
+unmatched.sequences.count = sum(grepl("^unmatched", result$best_match))
+
+filtering.steps = rbind(filtering.steps, c("Number of matched sequences", matched.sequences.count))
+filtering.steps = rbind(filtering.steps, c("Number of unmatched sequences", unmatched.sequences.count))
+filtering.steps[,2] = as.numeric(filtering.steps[,2])
+filtering.steps$perc = round(filtering.steps[,2] / input.sequence.count * 100, 2)
+
+write.table(x=filtering.steps, file=gsub("unmatched", "filtering_steps", unmatchedfile), sep="\t",quote=F,row.names=F,col.names=F)
+
+write.table(x=result, file=output, sep="\t",quote=F,row.names=F,col.names=T)
+write.table(x=unmatched, file=unmatchedfile, sep="\t",quote=F,row.names=F,col.names=T)
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/naive_output.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,45 @@
+args <- commandArgs(trailingOnly = TRUE)
+
+naive.file = args[1]
+shm.file = args[2]
+output.file.ca = args[3]
+output.file.cg = args[4]
+output.file.cm = args[5]
+
+naive = read.table(naive.file, sep="\t", header=T, quote="", fill=T)
+shm.merge = read.table(shm.file, sep="\t", header=T, quote="", fill=T)
+
+
+final = merge(naive, shm.merge[,c("Sequence.ID", "best_match")], by.x="ID", by.y="Sequence.ID")
+print(paste("nrow final:", nrow(final)))
+names(final)[names(final) == "best_match"] = "Sample"
+final.numeric = final[,sapply(final, is.numeric)]
+final.numeric[is.na(final.numeric)] = 0
+final[,sapply(final, is.numeric)] = final.numeric
+
+final.ca = final[grepl("^ca", final$Sample),]
+final.cg = final[grepl("^cg", final$Sample),]
+final.cm = final[grepl("^cm", final$Sample),]
+
+if(nrow(final.ca) > 0){
+	final.ca$Replicate = 1
+}
+
+if(nrow(final.cg) > 0){
+	final.cg$Replicate = 1
+}
+
+if(nrow(final.cm) > 0){
+	final.cm$Replicate = 1
+}
+
+#print(paste("nrow final:", nrow(final)))
+#final2 = final
+#final2$Sample = gsub("[0-9]", "", final2$Sample)
+#final = rbind(final, final2)
+#final$Replicate = 1
+
+write.table(final.ca, output.file.ca, quote=F, sep="\t", row.names=F, col.names=T)
+write.table(final.cg, output.file.cg, quote=F, sep="\t", row.names=F, col.names=T)
+write.table(final.cm, output.file.cm, quote=F, sep="\t", row.names=F, col.names=T)
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/new_imgt.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,29 @@
+args <- commandArgs(trailingOnly = TRUE)
+
+imgt.dir = args[1]
+merged.file = args[2]
+gene = args[3]
+
+merged = read.table(merged.file, header=T, sep="\t", fill=T, stringsAsFactors=F)
+
+if(gene != "-"){
+	merged = merged[grepl(paste("^", gene, sep=""), merged$best_match),]
+} else {
+	merged = merged[!grepl("unmatched", merged$best_match),]
+}
+
+merged = merged[!grepl("unmatched", merged$best_match),]
+
+for(f in list.files(imgt.dir, pattern="*.txt$")){
+	#print(paste("filtering", f))
+	path = paste(imgt.dir, f, sep="")
+	dat = read.table(path, header=T, sep="\t", fill=T, quote="", stringsAsFactors=F, check.names=FALSE)
+	
+	dat = dat[dat[,"Sequence ID"] %in% merged$Sequence.ID,]
+	
+	if(nrow(dat) > 0 & grepl("^8_", f)){ #change the FR1 columns to 0 in the "8_..." file
+		dat[,grepl("^FR1", names(dat))] = 0
+	}
+	
+	write.table(dat, path, quote=F, sep="\t", row.names=F, col.names=T, na="")
+}
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/pattern_plots.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,154 @@
+library(ggplot2)
+library(reshape2)
+library(scales)
+
+args <- commandArgs(trailingOnly = TRUE)
+
+input.file = args[1] #the data that's get turned into the "SHM overview" table in the html report "data_sum.txt"
+
+plot1.path = args[2]
+plot1.png = paste(plot1.path, ".png", sep="")
+plot1.txt = paste(plot1.path, ".txt", sep="")
+
+plot2.path = args[3]
+plot2.png = paste(plot2.path, ".png", sep="")
+plot2.txt = paste(plot2.path, ".txt", sep="")
+
+plot3.path = args[4]
+plot3.png = paste(plot3.path, ".png", sep="")
+plot3.txt = paste(plot3.path, ".txt", sep="")
+
+dat = read.table(input.file, header=F, sep=",", quote="", stringsAsFactors=F, fill=T, row.names=1)
+
+
+
+classes = c("IGA", "IGA1", "IGA2", "IGG", "IGG1", "IGG2", "IGG3", "IGG4", "IGM")
+xyz = c("x", "y", "z")
+new.names = c(paste(rep(classes, each=3), xyz, sep="."), paste("un", xyz, sep="."), paste("all", xyz, sep="."))
+
+names(dat) = new.names
+
+dat["RGYW.WRCY",] = colSums(dat[c(13,14),], na.rm=T)
+dat["TW.WA",] = colSums(dat[c(15,16),], na.rm=T)
+
+data1 = dat[c("RGYW.WRCY", "TW.WA"),]
+
+data1 = data1[,names(data1)[grepl(".z", names(data1))]]
+names(data1) = gsub("\\..*", "", names(data1))
+
+data1 = melt(t(data1))
+
+names(data1) = c("Class", "Type", "value")
+
+data1 = data1[order(data1$Type),]
+
+write.table(data1, plot1.txt, quote=F, sep="\t", na="", row.names=F, col.names=T)
+
+p = ggplot(data1, aes(Class, value)) + geom_bar(aes(fill=Type), stat="identity", position="dodge", colour = "black") + ylab("% of mutations") + guides(fill=guide_legend(title=NULL))
+p = p + theme(panel.background = element_rect(fill = "white", colour="black")) + scale_fill_manual(values=c("RGYW.WRCY" = "white", "TW.WA" = "blue4"))
+#p = p + scale_colour_manual(values=c("RGYW.WRCY" = "black", "TW.WA" = "blue4"))
+png(filename=plot1.png, width=480, height=300)
+print(p)
+dev.off()
+
+data2 = dat[5:8,]
+
+data2["sum",] = colSums(data2, na.rm=T)
+
+data2 = data2[,names(data2)[grepl("\\.x", names(data2))]]
+names(data2) = gsub(".x", "", names(data2))
+
+data2["A/T",] = round(colSums(data2[3:4,]) / data2["sum",] * 100, 1)
+data2["A/T",is.nan(unlist(data2["A/T",]))] = 0
+
+data2["G/C transversions",] = round(data2[2,] / data2["sum",] * 100, 1)
+data2["G/C transitions",] = round(data2[1,] / data2["sum",] * 100, 1)
+
+
+data2["G/C transversions",is.nan(unlist(data2["G/C transversions",]))] = 0
+data2["G/C transversions",is.infinite(unlist(data2["G/C transversions",]))] = 0
+data2["G/C transitions",is.nan(unlist(data2["G/C transitions",]))] = 0
+data2["G/C transitions",is.infinite(unlist(data2["G/C transitions",]))] = 0
+
+data2 = melt(t(data2[6:8,]))
+
+names(data2) = c("Class", "Type", "value")
+
+data2 = data2[order(data2$Type),]
+
+write.table(data2, plot2.txt, quote=F, sep="\t", na="", row.names=F, col.names=T)
+
+p = ggplot(data2, aes(x=Class, y=value, fill=Type)) + geom_bar(position="fill", stat="identity", colour = "black") + scale_y_continuous(labels=percent_format()) + guides(fill=guide_legend(title=NULL)) + ylab("% of mutations")
+p = p + theme(panel.background = element_rect(fill = "white", colour="black")) + scale_fill_manual(values=c("A/T" = "blue4", "G/C transversions" = "gray74", "G/C transitions" = "white"))
+#p = p + scale_colour_manual(values=c("A/T" = "blue4", "G/C transversions" = "gray74", "G/C transitions" = "black"))
+png(filename=plot2.png, width=480, height=300)
+print(p)
+dev.off()
+
+data3 = dat[c(5, 6, 8, 17:20),]
+data3 = data3[,names(data3)[grepl("\\.x", names(data3))]]
+names(data3) = gsub(".x", "", names(data3))
+
+data3[is.na(data3)] = 0
+#data3[is.infinite(data3)] = 0
+
+data3["G/C transitions",] = round(data3[1,] / (data3[5,] + data3[7,]) * 100, 1)
+
+data3["G/C transversions",] = round(data3[2,] / (data3[5,] + data3[7,]) * 100, 1)
+
+data3["A/T",] = round(data3[3,] / (data3[4,] + data3[6,]) * 100, 1)
+
+data3["G/C transitions",is.nan(unlist(data3["G/C transitions",]))] = 0
+data3["G/C transitions",is.infinite(unlist(data3["G/C transitions",]))] = 0
+
+data3["G/C transversions",is.nan(unlist(data3["G/C transversions",]))] = 0
+data3["G/C transversions",is.infinite(unlist(data3["G/C transversions",]))] = 0
+
+data3["A/T",is.nan(unlist(data3["A/T",]))] = 0
+data3["A/T",is.infinite(unlist(data3["A/T",]))] = 0
+
+data3 = melt(t(data3[8:10,]))
+names(data3) = c("Class", "Type", "value")
+
+data3 = data3[order(data3$Type),]
+
+write.table(data3, plot3.txt, quote=F, sep="\t", na="", row.names=F, col.names=T)
+
+p = ggplot(data3, aes(Class, value)) + geom_bar(aes(fill=Type), stat="identity", position="dodge", colour = "black") + ylab("% of nucleotides") + guides(fill=guide_legend(title=NULL))
+p = p + theme(panel.background = element_rect(fill = "white", colour="black")) + scale_fill_manual(values=c("A/T" = "blue4", "G/C transversions" = "gray74", "G/C transitions" = "white"))
+#p = p + scale_colour_manual(values=c("A/T" = "blue4", "G/C transversions" = "gray74", "G/C transitions" = "black"))
+png(filename=plot3.png, width=480, height=300)
+print(p)
+dev.off()
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/sequence_overview.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,315 @@
+library(reshape2)
+
+args <- commandArgs(trailingOnly = TRUE)
+
+before.unique.file = args[1]
+merged.file = args[2]
+outputdir = args[3]
+gene.classes = unlist(strsplit(args[4], ","))
+hotspot.analysis.sum.file = args[5]
+NToverview.file = paste(outputdir, "ntoverview.txt", sep="/")
+NTsum.file = paste(outputdir, "ntsum.txt", sep="/")
+main.html = "index.html"
+
+setwd(outputdir)
+
+before.unique = read.table(before.unique.file, header=T, sep="\t", fill=T, stringsAsFactors=F, quote="")
+merged = read.table(merged.file, header=T, sep="\t", fill=T, stringsAsFactors=F, quote="")
+hotspot.analysis.sum = read.table(hotspot.analysis.sum.file, header=F, sep=",", fill=T, stringsAsFactors=F, quote="")
+
+#before.unique = before.unique[!grepl("unmatched", before.unique$best_match),]
+
+before.unique$seq_conc = paste(before.unique$CDR1.IMGT.seq, before.unique$FR2.IMGT.seq, before.unique$CDR2.IMGT.seq, before.unique$FR3.IMGT.seq, before.unique$CDR3.IMGT.seq)
+
+IDs = before.unique[,c("Sequence.ID", "seq_conc", "best_match", "Functionality")]
+IDs$best_match = as.character(IDs$best_match)
+
+#dat = data.frame(data.table(dat)[, list(freq=.N), by=c("best_match", "seq_conc")])
+
+dat = data.frame(table(before.unique$seq_conc))
+#dat = data.frame(table(merged$seq_conc, merged$Functionality))
+
+#dat = dat[dat$Freq > 1,]
+
+#names(dat) = c("seq_conc", "Functionality", "Freq")
+names(dat) = c("seq_conc", "Freq")
+
+dat$seq_conc = factor(dat$seq_conc)
+
+dat = dat[order(as.character(dat$seq_conc)),]
+
+#writing html from R...
+get.bg.color = function(val){
+	if(val %in% c("TRUE", "FALSE", "T", "F")){ #if its a logical value, give the background a green/red color
+		return(ifelse(val,"#eafaf1","#f9ebea"))
+	} else if (!is.na(as.numeric(val))) { #if its a numerical value, give it a grey tint if its >0
+		return(ifelse(val > 0,"#eaecee","white"))
+	} else {
+		return("white")
+	}
+}
+td = function(val) {
+  return(paste("<td bgcolor='", get.bg.color(val), "'>", val, "</td>", sep=""))
+}
+tr = function(val) { 
+	return(paste(c("<tr>", sapply(val, td), "</tr>"), collapse="")) 
+}
+
+make.link = function(id, clss, val) { 
+	paste("<a href='", clss, "_", id, ".html'>", val, "</a>", sep="") 
+}
+tbl = function(df) {
+	res = "<table border='1'>"
+	for(i in 1:nrow(df)){ 
+		res = paste(res, tr(df[i,]), sep="")
+	}
+	res = paste(res, "</table>")
+}
+
+cat("<table border='1' class='pure-table pure-table-striped'>", file=main.html, append=F)
+#cat("<caption>CDR1+FR2+CDR2+FR3+CDR3 sequences that show up more than once</caption>", file=main.html, append=T)
+cat("<tr>", file=main.html, append=T)
+cat("<th>Sequence</th><th>Functionality</th><th>ca1</th><th>ca2</th><th>cg1</th><th>cg2</th><th>cg3</th><th>cg4</th><th>cm</th><th>un</th>", file=main.html, append=T)
+cat("<th>total CA</th><th>total CG</th><th>number of subclasses</th><th>present in both Ca and Cg</th><th>Ca1+Ca2</th>", file=main.html, append=T)
+cat("<th>Cg1+Cg2</th><th>Cg1+Cg3</th><th>Cg1+Cg4</th><th>Cg2+Cg3</th><th>Cg2+Cg4</th><th>Cg3+Cg4</th>", file=main.html, append=T)
+cat("<th>Cg1+Cg2+Cg3</th><th>Cg2+Cg3+Cg4</th><th>Cg1+Cg2+Cg4</th><th>Cg1+Cg3+Cg4</th><th>Cg1+Cg2+Cg3+Cg4</th>", file=main.html, append=T)
+cat("</tr>", file=main.html, append=T)
+
+
+
+single.sequences=0 #sequence only found once, skipped
+in.multiple=0 #same sequence across multiple subclasses
+multiple.in.one=0 #same sequence multiple times in one subclass
+unmatched=0 #all of the sequences are unmatched
+some.unmatched=0 #one or more sequences in a clone are unmatched
+matched=0 #should be the same als matched sequences
+
+sequence.id.page="by_id.html"
+
+for(i in 1:nrow(dat)){
+	
+	ca1 = IDs[IDs$seq_conc == dat[i,c("seq_conc")] & grepl("^IGA1", IDs$best_match),]
+	ca2 = IDs[IDs$seq_conc == dat[i,c("seq_conc")] & grepl("^IGA2", IDs$best_match),]
+	
+	cg1 = IDs[IDs$seq_conc == dat[i,c("seq_conc")] & grepl("^IGG1", IDs$best_match),]
+	cg2 = IDs[IDs$seq_conc == dat[i,c("seq_conc")] & grepl("^IGG2", IDs$best_match),]
+	cg3 = IDs[IDs$seq_conc == dat[i,c("seq_conc")] & grepl("^IGG3", IDs$best_match),]
+	cg4 = IDs[IDs$seq_conc == dat[i,c("seq_conc")] & grepl("^IGG4", IDs$best_match),]
+	
+	cm = IDs[IDs$seq_conc == dat[i,c("seq_conc")] & grepl("^IGM", IDs$best_match),]
+	
+	un = IDs[IDs$seq_conc == dat[i,c("seq_conc")] & grepl("^unmatched", IDs$best_match),]
+	allc = rbind(ca1, ca2, cg1, cg2, cg3, cg4, cm, un)
+	
+	ca1.n = nrow(ca1)
+	ca2.n = nrow(ca2)
+	
+	cg1.n = nrow(cg1)
+	cg2.n = nrow(cg2)
+	cg3.n = nrow(cg3)
+	cg4.n = nrow(cg4)
+	
+	cm.n = nrow(cm)
+	
+	un.n = nrow(un)
+	
+	classes = c(ca1.n, ca2.n, cg1.n, cg2.n, cg3.n, cg4.n, cm.n, un.n)
+	
+	classes.sum = sum(classes)
+	
+	if(classes.sum == 1){
+		single.sequences = single.sequences + 1
+		next
+	}
+	
+	if(un.n == classes.sum){
+		unmatched = unmatched + 1
+		next
+	}
+	
+	in.classes = sum(classes > 0)
+	
+	matched = matched + in.classes #count in how many subclasses the sequence occurs.
+	
+	if(any(classes  == classes.sum)){
+		multiple.in.one = multiple.in.one + 1
+	} else if (un.n > 0) {
+		some.unmatched = some.unmatched + 1
+	} else {
+		in.multiple = in.multiple + 1
+	}
+	
+	id = as.numeric(dat[i,"seq_conc"])
+	
+	functionality = paste(unique(allc[,"Functionality"]), collapse=",")
+	
+	by.id.row = c()
+	
+	if(ca1.n > 0){
+		cat(tbl(ca1), file=paste("IGA1_", id, ".html", sep=""))
+	}
+
+	if(ca2.n > 0){
+		cat(tbl(ca2), file=paste("IGA2_", id, ".html", sep=""))
+	}
+
+	if(cg1.n > 0){
+		cat(tbl(cg1), file=paste("IGG1_", id, ".html", sep=""))
+	}
+
+	if(cg2.n > 0){
+		cat(tbl(cg2), file=paste("IGG2_", id, ".html", sep=""))
+	}
+
+	if(cg3.n > 0){
+		cat(tbl(cg3), file=paste("IGG3_", id, ".html", sep=""))
+	}
+
+	if(cg4.n > 0){
+		cat(tbl(cg4), file=paste("IGG4_", id, ".html", sep=""))
+	}
+
+	if(cm.n > 0){
+		cat(tbl(cm), file=paste("IGM_", id, ".html", sep=""))
+	}
+
+	if(un.n > 0){
+		cat(tbl(un), file=paste("un_", id, ".html", sep=""))
+	}
+	
+	ca1.html = make.link(id, "IGA1", ca1.n)
+	ca2.html = make.link(id, "IGA2", ca2.n)
+	
+	cg1.html = make.link(id, "IGG1", cg1.n)
+	cg2.html = make.link(id, "IGG2", cg2.n)
+	cg3.html = make.link(id, "IGG3", cg3.n)
+	cg4.html = make.link(id, "IGG4", cg4.n)
+	
+	cm.html = make.link(id, "IGM", cm.n)
+	
+	un.html = make.link(id, "un", un.n)
+	
+	#extra columns
+	ca.n = ca1.n + ca2.n
+	
+	cg.n = cg1.n + cg2.n + cg3.n + cg4.n
+	
+	#in.classes
+	
+	in.ca.cg = (ca.n > 0 & cg.n > 0)
+	
+	in.ca1.ca2 = (ca1.n > 0 & ca2.n > 0)
+	
+	in.cg1.cg2 = (cg1.n > 0 & cg2.n > 0)
+	in.cg1.cg3 = (cg1.n > 0 & cg3.n > 0)
+	in.cg1.cg4 = (cg1.n > 0 & cg4.n > 0)
+	in.cg2.cg3 = (cg2.n > 0 & cg3.n > 0)
+	in.cg2.cg4 = (cg2.n > 0 & cg4.n > 0)
+	in.cg3.cg4 = (cg3.n > 0 & cg4.n > 0)
+	
+	in.cg1.cg2.cg3 = (cg1.n > 0 & cg2.n > 0 & cg3.n > 0)
+	in.cg2.cg3.cg4 = (cg2.n > 0 & cg3.n > 0 & cg4.n > 0)
+	in.cg1.cg2.cg4 = (cg1.n > 0 & cg2.n > 0 & cg4.n > 0)
+	in.cg1.cg3.cg4 = (cg1.n > 0 & cg3.n > 0 & cg4.n > 0)
+	
+	in.cg.all = (cg1.n > 0 & cg2.n > 0 & cg3.n > 0 & cg4.n > 0)
+	
+	
+	
+	
+	#rw = c(as.character(dat[i,"seq_conc"]), functionality, ca1.html, ca2.html, cg1.html, cg2.html, cg3.html, cg4.html, cm.html, un.html)
+	rw = c(as.character(dat[i,"seq_conc"]), functionality, ca1.html, ca2.html, cg1.html, cg2.html, cg3.html, cg4.html, cm.html, un.html)
+	rw = c(rw, ca.n, cg.n, in.classes, in.ca.cg, in.ca1.ca2, in.cg1.cg2, in.cg1.cg3, in.cg1.cg4, in.cg2.cg3, in.cg2.cg4, in.cg3.cg4, in.cg1.cg2.cg3, in.cg2.cg3.cg4, in.cg1.cg2.cg4, in.cg1.cg3.cg4, in.cg.all)
+
+	cat(tr(rw), file=main.html, append=T)
+	
+	
+	for(i in 1:nrow(allc)){ #generate html by id
+		html = make.link(id, allc[i,"best_match"], allc[i,"Sequence.ID"])
+		cat(paste(html, "<br />"), file=sequence.id.page, append=T)
+	}
+}
+
+cat("</table>", file=main.html, append=T)
+
+print(paste("Single sequences:", single.sequences))
+print(paste("Sequences in multiple subclasses:", in.multiple))
+print(paste("Multiple sequences in one subclass:", multiple.in.one))
+print(paste("Matched with unmatched:", some.unmatched))
+print(paste("Count that should match 'matched' sequences:", matched))
+
+#ACGT overview
+
+NToverview = merged[!grepl("^unmatched", merged$best_match),]
+
+NToverview$seq = paste(NToverview$CDR1.IMGT.seq, NToverview$FR2.IMGT.seq, NToverview$CDR2.IMGT.seq, NToverview$FR3.IMGT.seq, sep="_")
+
+NToverview$A = nchar(gsub("[^Aa]", "", NToverview$seq))
+NToverview$C = nchar(gsub("[^Cc]", "", NToverview$seq))
+NToverview$G = nchar(gsub("[^Gg]", "", NToverview$seq))
+NToverview$T = nchar(gsub("[^Tt]", "", NToverview$seq))
+
+#Nsum = data.frame(Sequence.ID="-", best_match="Sum", seq="-", A = sum(NToverview$A), C = sum(NToverview$C), G = sum(NToverview$G), T = sum(NToverview$T))
+
+#NToverview = rbind(NToverview, NTsum)
+
+NTresult = data.frame(nt=c("A", "C", "T", "G"))
+
+for(clazz in gene.classes){
+	NToverview.sub = NToverview[grepl(paste("^", clazz, sep=""), NToverview$best_match),]
+	new.col.x = c(sum(NToverview.sub$A), sum(NToverview.sub$C), sum(NToverview.sub$T), sum(NToverview.sub$G))
+	new.col.y = sum(new.col.x)
+	new.col.z = round(new.col.x / new.col.y * 100, 2)
+	
+	tmp = names(NTresult)
+	NTresult = cbind(NTresult, data.frame(new.col.x, new.col.y, new.col.z))
+	names(NTresult) = c(tmp, paste(clazz, c("x", "y", "z"), sep=""))
+}
+
+write.table(NToverview[,c("Sequence.ID", "best_match", "seq", "A", "C", "G", "T")], NToverview.file, quote=F, sep="\t", row.names=F, col.names=T)
+
+NToverview = NToverview[!grepl("unmatched", NToverview$best_match),]
+
+new.col.x = c(sum(NToverview$A), sum(NToverview$C), sum(NToverview$T), sum(NToverview$G))
+new.col.y = sum(new.col.x)
+new.col.z = round(new.col.x / new.col.y * 100, 2)
+
+tmp = names(NTresult)
+NTresult = cbind(NTresult, data.frame(new.col.x, new.col.y, new.col.z))
+names(NTresult) = c(tmp, paste("all", c("x", "y", "z"), sep=""))
+
+names(hotspot.analysis.sum) = names(NTresult)
+
+hotspot.analysis.sum = rbind(hotspot.analysis.sum, NTresult)
+
+write.table(hotspot.analysis.sum, hotspot.analysis.sum.file, quote=F, sep=",", row.names=F, col.names=F, na="0")
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/shm_csr.py	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,290 @@
+from __future__ import division
+from collections import defaultdict
+import re
+import argparse
+
+parser = argparse.ArgumentParser()
+parser.add_argument("--input",
+					help="The '7_V-REGION-mutation-and-AA-change-table' and '10_V-REGION-mutation-hotspots' merged together, with an added 'best_match' annotation")
+parser.add_argument("--genes", help="The genes available in the 'best_match' column")
+parser.add_argument("--includefr1", help="Should the mutation/nucleotides in the FR1 region be included?")
+parser.add_argument("--output", help="Output file")
+
+args = parser.parse_args()
+
+infile = args.input
+genes = str(args.genes).split(",")
+print "includefr1 =", args.includefr1
+include_fr1 = True if args.includefr1 == "yes" else False
+outfile = args.output
+
+genedic = dict()
+
+mutationdic = dict()
+mutationMatcher = re.compile("^(.)(\d+).(.),?(.)?(\d+)?.?(.)?(.?.?.?.?.?)?")
+NAMatchResult = (None, None, None, None, None, None, '')
+linecount = 0
+
+IDIndex = 0
+best_matchIndex = 0
+fr1Index = 0
+cdr1Index = 0
+fr2Index = 0
+cdr2Index = 0
+fr3Index = 0
+first = True
+IDlist = []
+mutationList = []
+mutationListByID = {}
+cdr1LengthDic = {}
+cdr2LengthDic = {}
+
+with open(infile, 'r') as i:
+	for line in i:
+		if first:
+			linesplt = line.split("\t")
+			IDIndex = linesplt.index("Sequence.ID")
+			best_matchIndex = linesplt.index("best_match")
+			fr1Index = linesplt.index("FR1.IMGT")
+			cdr1Index = linesplt.index("CDR1.IMGT")
+			fr2Index = linesplt.index("FR2.IMGT")
+			cdr2Index = linesplt.index("CDR2.IMGT")
+			fr3Index = linesplt.index("FR3.IMGT")
+			cdr1LengthIndex = linesplt.index("CDR1.IMGT.length")
+			cdr2LengthIndex = linesplt.index("CDR2.IMGT.length")
+			first = False
+			continue
+		linecount += 1
+		linesplt = line.split("\t")
+		ID = linesplt[IDIndex]
+		genedic[ID] = linesplt[best_matchIndex]
+		try:
+			if linesplt[fr1Index] != "NA":
+				mutationdic[ID + "_FR1"] = [mutationMatcher.match(x).groups() for x in linesplt[fr1Index].split("|") if x] if include_fr1 else []
+			else:
+				mutationdic[ID + "_FR1"] = []
+			mutationdic[ID + "_CDR1"] = [mutationMatcher.match(x).groups() for x in linesplt[cdr1Index].split("|") if x] if linesplt[cdr1Index] != "NA" else []
+			mutationdic[ID + "_FR2"] = [mutationMatcher.match(x).groups() for x in linesplt[fr2Index].split("|") if x] if linesplt[fr2Index] != "NA" else []
+			mutationdic[ID + "_CDR2"] = [mutationMatcher.match(x).groups() for x in linesplt[cdr2Index].split("|") if x] if linesplt[cdr2Index] != "NA" else []
+			mutationdic[ID + "_FR2-CDR2"] = mutationdic[ID + "_FR2"] + mutationdic[ID + "_CDR2"]
+			mutationdic[ID + "_FR3"] = [mutationMatcher.match(x).groups() for x in linesplt[fr3Index].split("|") if x] if linesplt[fr3Index] != "NA" else []
+		except e:
+			print linesplt
+			print linecount
+			print e
+		mutationList += mutationdic[ID + "_FR1"] + mutationdic[ID + "_CDR1"] + mutationdic[ID + "_FR2"] + mutationdic[ID + "_CDR2"] + mutationdic[ID + "_FR3"]
+		mutationListByID[ID] = mutationdic[ID + "_FR1"] + mutationdic[ID + "_CDR1"] + mutationdic[ID + "_FR2"] + mutationdic[ID + "_CDR2"] + mutationdic[ID + "_FR3"]
+
+		cdr1Length = linesplt[cdr1LengthIndex]
+		cdr2Length = linesplt[cdr2LengthIndex]
+
+		cdr1LengthDic[ID] = int(cdr1Length) if cdr1Length != "X" else 0
+		cdr2LengthDic[ID] = int(cdr2Length) if cdr2Length != "X" else 0
+		
+		IDlist += [ID]
+
+AALength = (int(max(mutationList, key=lambda i: int(i[4]) if i[4] else 0)[4]) + 1)  # [4] is the position of the AA mutation, None if silent
+if AALength < 60:
+	AALength = 64
+
+AA_mutation = [0] * AALength
+AA_mutation_dic = {"IGA": AA_mutation[:], "IGG": AA_mutation[:], "IGM": AA_mutation[:], "unm": AA_mutation[:]}
+AA_mutation_empty = AA_mutation[:]
+
+aa_mutations_by_id_file = outfile[:outfile.rindex("/")] + "/aa_id_mutations.txt"
+with open(aa_mutations_by_id_file, 'w') as o:
+	o.write("ID\tbest_match\t" + "\t".join([str(x) for x in range(1,AALength)]) + "\n")
+	for ID in mutationListByID.keys():
+		AA_mutation_for_ID = AA_mutation_empty[:]
+		for mutation in mutationListByID[ID]:
+			if mutation[4]:
+				AA_mutation_position = int(mutation[4])
+				AA_mutation[AA_mutation_position] += 1
+				AA_mutation_for_ID[AA_mutation_position] += 1
+				clss = genedic[ID][:3]
+				AA_mutation_dic[clss][AA_mutation_position] += 1
+		o.write(ID + "\t" + genedic[ID] + "\t" + "\t".join([str(x) for x in AA_mutation_for_ID[1:]]) + "\n")
+
+
+
+#absent AA stuff
+absentAACDR1Dic = defaultdict(list)
+absentAACDR1Dic[5] = range(29,36)
+absentAACDR1Dic[6] = range(29,35)
+absentAACDR1Dic[7] = range(30,35)
+absentAACDR1Dic[8] = range(30,34)
+absentAACDR1Dic[9] = range(31,34)
+absentAACDR1Dic[10] = range(31,33)
+absentAACDR1Dic[11] = [32]
+
+absentAACDR2Dic = defaultdict(list)
+absentAACDR2Dic[0] = range(55,65)
+absentAACDR2Dic[1] = range(56,65)
+absentAACDR2Dic[2] = range(56,64)
+absentAACDR2Dic[3] = range(57,64)
+absentAACDR2Dic[4] = range(57,63)
+absentAACDR2Dic[5] = range(58,63)
+absentAACDR2Dic[6] = range(58,62)
+absentAACDR2Dic[7] = range(59,62)
+absentAACDR2Dic[8] = range(59,61)
+absentAACDR2Dic[9] = [60]
+
+absentAA = [len(IDlist)] * (AALength-1)
+for k, cdr1Length in cdr1LengthDic.iteritems():
+	for c in absentAACDR1Dic[cdr1Length]:
+		absentAA[c] -= 1
+
+for k, cdr2Length in cdr2LengthDic.iteritems():
+	for c in absentAACDR2Dic[cdr2Length]:
+		absentAA[c] -= 1
+
+
+aa_mutations_by_id_file = outfile[:outfile.rindex("/")] + "/absent_aa_id.txt"
+with open(aa_mutations_by_id_file, 'w') as o:
+	o.write("ID\tcdr1length\tcdr2length\tbest_match\t" + "\t".join([str(x) for x in range(1,AALength)]) + "\n")
+	for ID in IDlist:
+		absentAAbyID = [1] * (AALength-1)
+		cdr1Length = cdr1LengthDic[ID]
+		for c in absentAACDR1Dic[cdr1Length]:
+			absentAAbyID[c] -= 1
+
+		cdr2Length = cdr2LengthDic[ID]
+		for c in absentAACDR2Dic[cdr2Length]:
+			absentAAbyID[c] -= 1
+		o.write(ID + "\t" + str(cdr1Length) + "\t" + str(cdr2Length) + "\t" + genedic[ID] + "\t" + "\t".join([str(x) for x in absentAAbyID]) + "\n")
+
+if linecount == 0:
+	print "No data, exiting"
+	with open(outfile, 'w') as o:
+		o.write("RGYW (%)," + ("0,0,0\n" * len(genes)))
+		o.write("WRCY (%)," + ("0,0,0\n" * len(genes)))
+		o.write("WA (%)," + ("0,0,0\n" * len(genes)))
+		o.write("TW (%)," + ("0,0,0\n" * len(genes)))
+	import sys
+
+	sys.exit()
+
+hotspotMatcher = re.compile("[actg]+,(\d+)-(\d+)\((.*)\)")
+RGYWCount = {}
+WRCYCount = {}
+WACount = {}
+TWCount = {}
+
+#IDIndex = 0
+ataIndex = 0
+tatIndex = 0
+aggctatIndex = 0
+atagcctIndex = 0
+first = True
+with open(infile, 'r') as i:
+	for line in i:
+		if first:
+			linesplt = line.split("\t")
+			ataIndex = linesplt.index("X.a.t.a")
+			tatIndex = linesplt.index("t.a.t.")
+			aggctatIndex = linesplt.index("X.a.g.g.c.t..a.t.")
+			atagcctIndex = linesplt.index("X.a.t..a.g.c.c.t.")
+			first = False
+			continue
+		linesplt = line.split("\t")
+		gene = linesplt[best_matchIndex]
+		ID = linesplt[IDIndex]
+		if ID == "ca2":
+			print linesplt
+		RGYW = [(int(x), int(y), z) for (x, y, z) in
+				[hotspotMatcher.match(x).groups() for x in linesplt[aggctatIndex].split("|") if x]]
+		WRCY = [(int(x), int(y), z) for (x, y, z) in
+				[hotspotMatcher.match(x).groups() for x in linesplt[atagcctIndex].split("|") if x]]
+		WA = [(int(x), int(y), z) for (x, y, z) in
+			  [hotspotMatcher.match(x).groups() for x in linesplt[ataIndex].split("|") if x]]
+		TW = [(int(x), int(y), z) for (x, y, z) in
+			  [hotspotMatcher.match(x).groups() for x in linesplt[tatIndex].split("|") if x]]
+		RGYWCount[ID], WRCYCount[ID], WACount[ID], TWCount[ID] = 0, 0, 0, 0
+
+		mutationList = (mutationdic[ID + "_FR1"] if include_fr1 else []) + mutationdic[ID + "_CDR1"] + mutationdic[
+			ID + "_FR2"] + mutationdic[ID + "_CDR2"] + mutationdic[ID + "_FR3"]
+		for mutation in mutationList:
+			frm, where, to, AAfrm, AAwhere, AAto, junk = mutation
+			mutation_in_RGYW = any([(start <= int(where) <= end) for (start, end, region) in RGYW])
+			mutation_in_WRCY = any([(start <= int(where) <= end) for (start, end, region) in WRCY])
+			mutation_in_WA = any([(start <= int(where) <= end) for (start, end, region) in WA])
+			mutation_in_TW = any([(start <= int(where) <= end) for (start, end, region) in TW])
+
+			in_how_many_motifs = sum([mutation_in_RGYW, mutation_in_WRCY, mutation_in_WA, mutation_in_TW])
+
+			if in_how_many_motifs > 0:
+				RGYWCount[ID] += (1.0 * int(mutation_in_RGYW)) / in_how_many_motifs
+				WRCYCount[ID] += (1.0 * int(mutation_in_WRCY)) / in_how_many_motifs
+				WACount[ID] += (1.0 * int(mutation_in_WA)) / in_how_many_motifs
+				TWCount[ID] += (1.0 * int(mutation_in_TW)) / in_how_many_motifs
+
+
+def mean(lst):
+	return (float(sum(lst)) / len(lst)) if len(lst) > 0 else 0.0
+
+
+def median(lst):
+	lst = sorted(lst)
+	l = len(lst)
+	if l == 0:
+		return 0
+	if l == 1:
+		return lst[0]
+		
+	l = int(l / 2)
+	
+	if len(lst) % 2 == 0:
+		return float(lst[l] + lst[(l - 1)]) / 2.0
+	else:
+		return lst[l]
+
+funcs = {"mean": mean, "median": median, "sum": sum}
+
+directory = outfile[:outfile.rfind("/") + 1]
+value = 0
+valuedic = dict()
+
+for fname in funcs.keys():
+	for gene in genes:
+		with open(directory + gene + "_" + fname + "_value.txt", 'r') as v:
+			valuedic[gene + "_" + fname] = float(v.readlines()[0].rstrip())
+	with open(directory + "all_" + fname + "_value.txt", 'r') as v:
+		valuedic["total_" + fname] = float(v.readlines()[0].rstrip())
+	
+
+def get_xyz(lst, gene, f, fname):
+	x = int(round(f(lst)))
+	y = valuedic[gene + "_" + fname]
+	z = str(round(x / float(y) * 100, 1)) if y != 0 else "0"
+	return (str(x), str(y), z)
+
+dic = {"RGYW": RGYWCount, "WRCY": WRCYCount, "WA": WACount, "TW": TWCount}
+arr = ["RGYW", "WRCY", "WA", "TW"]
+
+geneMatchers = {gene: re.compile("^" + gene + ".*") for gene in genes}
+
+for fname in funcs.keys():
+	func = funcs[fname]
+	foutfile = outfile[:outfile.rindex("/")] + "/hotspot_analysis_" + fname + ".txt"
+	with open(foutfile, 'w') as o:
+		for typ in arr:
+			o.write(typ + " (%)")
+			curr = dic[typ]
+			for gene in genes:
+				geneMatcher = geneMatchers[gene] #re.compile("^" + gene + ".*") #recompile every loop....
+				if valuedic[gene + "_" + fname] is 0:
+					o.write(",0,0,0")
+				else:
+					x, y, z = get_xyz([curr[x] for x in [y for y, z in genedic.iteritems() if geneMatcher.match(z)]], gene, func, fname)
+					o.write("," + x + "," + y + "," + z)
+
+			x, y, z = get_xyz([y for x, y in curr.iteritems() if not genedic[x].startswith("unmatched")], "total", func, fname)
+			o.write("," + x + "," + y + "," + z + "\n")
+
+
+# for testing
+seq_motif_file = outfile[:outfile.rindex("/")] + "/motif_per_seq.txt"
+with open(seq_motif_file, 'w') as o:
+	o.write("ID\tRGYWC\tWRCY\tWA\tTW\n")
+	for ID in IDlist:
+		o.write(ID + "\t" + str(round(RGYWCount[ID], 2)) + "\t" + str(round(WRCYCount[ID], 2)) + "\t" + str(round(WACount[ID], 2)) + "\t" + str(round(TWCount[ID], 2)) + "\n")
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/shm_csr.r	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,493 @@
+library(data.table)
+library(ggplot2)
+library(reshape2)
+
+args <- commandArgs(trailingOnly = TRUE)
+
+input = args[1]
+genes = unlist(strsplit(args[2], ","))
+outputdir = args[3]
+include_fr1 = ifelse(args[4] == "yes", T, F)
+setwd(outputdir)
+
+dat = read.table(input, header=T, sep="\t", fill=T, stringsAsFactors=F)
+
+if(length(dat$Sequence.ID) == 0){
+  setwd(outputdir)
+  result = data.frame(x = rep(0, 5), y = rep(0, 5), z = rep(NA, 5))
+  row.names(result) = c("Number of Mutations (%)", "Transition (%)", "Transversions (%)", "Transitions at G C (%)", "Targeting of C G (%)")
+  write.table(x=result, file="mutations.txt", sep=",",quote=F,row.names=T,col.names=F)
+  transitionTable = data.frame(A=rep(0, 4),C=rep(0, 4),G=rep(0, 4),T=rep(0, 4))
+  row.names(transitionTable) = c("A", "C", "G", "T")
+  transitionTable["A","A"] = NA
+  transitionTable["C","C"] = NA
+  transitionTable["G","G"] = NA
+  transitionTable["T","T"] = NA
+  write.table(x=transitionTable, file="transitions.txt", sep=",",quote=F,row.names=T,col.names=NA)
+  cat("0", file="n.txt")
+  stop("No data")
+}
+
+cleanup_columns = c("FR1.IMGT.c.a",
+                    "FR2.IMGT.g.t",
+                    "CDR1.IMGT.Nb.of.nucleotides",
+                    "CDR2.IMGT.t.a",
+                    "FR1.IMGT.c.g",
+                    "CDR1.IMGT.c.t",
+                    "FR2.IMGT.a.c",
+                    "FR2.IMGT.Nb.of.mutations",
+                    "FR2.IMGT.g.c",
+                    "FR2.IMGT.a.g",
+                    "FR3.IMGT.t.a",
+                    "FR3.IMGT.t.c",
+                    "FR2.IMGT.g.a",
+                    "FR3.IMGT.c.g",
+                    "FR1.IMGT.Nb.of.mutations",
+                    "CDR1.IMGT.g.a",
+                    "CDR1.IMGT.t.g",
+                    "CDR1.IMGT.g.c",
+                    "CDR2.IMGT.Nb.of.nucleotides",
+                    "FR2.IMGT.a.t",
+                    "CDR1.IMGT.Nb.of.mutations",
+                    "CDR3.IMGT.Nb.of.nucleotides",
+                    "CDR1.IMGT.a.g",
+                    "FR3.IMGT.a.c",
+                    "FR1.IMGT.g.a",
+                    "FR3.IMGT.a.g",
+                    "FR1.IMGT.a.t",
+                    "CDR2.IMGT.a.g",
+                    "CDR2.IMGT.Nb.of.mutations",
+                    "CDR2.IMGT.g.t",
+                    "CDR2.IMGT.a.c",
+                    "CDR1.IMGT.t.c",
+                    "FR3.IMGT.g.c",
+                    "FR1.IMGT.g.t",
+                    "FR3.IMGT.g.t",
+                    "CDR1.IMGT.a.t",
+                    "FR1.IMGT.a.g",
+                    "FR3.IMGT.a.t",
+                    "FR3.IMGT.Nb.of.nucleotides",
+                    "FR2.IMGT.t.c",
+                    "CDR2.IMGT.g.a",
+                    "FR2.IMGT.t.a",
+                    "CDR1.IMGT.t.a",
+                    "FR2.IMGT.t.g",
+                    "FR3.IMGT.t.g",
+                    "FR2.IMGT.Nb.of.nucleotides",
+                    "FR1.IMGT.t.a",
+                    "FR1.IMGT.t.g",
+                    "FR3.IMGT.c.t",
+                    "FR1.IMGT.t.c",
+                    "CDR2.IMGT.a.t",
+                    "FR2.IMGT.c.t",
+                    "CDR1.IMGT.g.t",
+                    "CDR2.IMGT.t.g",
+                    "FR1.IMGT.Nb.of.nucleotides",
+                    "CDR1.IMGT.c.g",
+                    "CDR2.IMGT.t.c",
+                    "FR3.IMGT.g.a",
+                    "CDR1.IMGT.a.c",
+                    "FR2.IMGT.c.a",
+                    "FR3.IMGT.Nb.of.mutations",
+                    "FR2.IMGT.c.g",
+                    "CDR2.IMGT.g.c",
+                    "FR1.IMGT.g.c",
+                    "CDR2.IMGT.c.t",
+                    "FR3.IMGT.c.a",
+                    "CDR1.IMGT.c.a",
+                    "CDR2.IMGT.c.g",
+                    "CDR2.IMGT.c.a",
+                    "FR1.IMGT.c.t",
+                    "FR1.IMGT.Nb.of.silent.mutations",
+                    "FR2.IMGT.Nb.of.silent.mutations",
+                    "FR3.IMGT.Nb.of.silent.mutations",
+                    "FR1.IMGT.Nb.of.nonsilent.mutations",
+                    "FR2.IMGT.Nb.of.nonsilent.mutations",
+                    "FR3.IMGT.Nb.of.nonsilent.mutations")
+
+
+print("Cleaning up columns")
+for(col in cleanup_columns){
+  dat[,col] = gsub("\\(.*\\)", "", dat[,col])
+  #dat[dat[,col] == "",] = "0"
+  dat[,col] = as.numeric(dat[,col])
+  dat[is.na(dat[,col]),col] = 0
+}
+
+regions = c("FR1", "CDR1", "FR2", "CDR2", "FR3")
+if(!include_fr1){
+	regions = c("CDR1", "FR2", "CDR2", "FR3")
+}
+
+sum_by_row = function(x, columns) { sum(as.numeric(x[columns]), na.rm=T) }
+
+print("aggregating data into new columns")
+
+VRegionMutations_columns = paste(regions, ".IMGT.Nb.of.mutations", sep="")
+dat$VRegionMutations =  apply(dat, FUN=sum_by_row, 1, columns=VRegionMutations_columns)
+
+VRegionNucleotides_columns = paste(regions, ".IMGT.Nb.of.nucleotides", sep="")
+dat$FR3.IMGT.Nb.of.nucleotides = nchar(dat$FR3.IMGT.seq)
+dat$VRegionNucleotides =  apply(dat, FUN=sum_by_row, 1, columns=VRegionNucleotides_columns)
+
+transitionMutations_columns = paste(rep(regions, each=4), c(".IMGT.a.g", ".IMGT.g.a", ".IMGT.c.t", ".IMGT.t.c"), sep="")
+dat$transitionMutations = apply(dat, FUN=sum_by_row, 1, columns=transitionMutations_columns)
+
+transversionMutations_columns = paste(rep(regions, each=8), c(".IMGT.a.c",".IMGT.c.a",".IMGT.a.t",".IMGT.t.a",".IMGT.g.c",".IMGT.c.g",".IMGT.g.t",".IMGT.t.g"), sep="")
+dat$transversionMutations = apply(dat, FUN=sum_by_row, 1, columns=transversionMutations_columns)
+
+
+transitionMutationsAtGC_columns = paste(rep(regions, each=2), c(".IMGT.g.a",".IMGT.c.t"), sep="")
+dat$transitionMutationsAtGC = apply(dat, FUN=sum_by_row, 1, columns=transitionMutationsAtGC_columns)
+
+
+totalMutationsAtGC_columns = paste(rep(regions, each=6), c(".IMGT.c.g",".IMGT.c.t",".IMGT.c.a",".IMGT.g.c",".IMGT.g.a",".IMGT.g.t"), sep="")
+#totalMutationsAtGC_columns = paste(rep(regions, each=6), c(".IMGT.g.a",".IMGT.c.t",".IMGT.c.a",".IMGT.c.g",".IMGT.g.t"), sep="")
+dat$totalMutationsAtGC = apply(dat, FUN=sum_by_row, 1, columns=totalMutationsAtGC_columns)
+
+transitionMutationsAtAT_columns = paste(rep(regions, each=2), c(".IMGT.a.g",".IMGT.t.c"), sep="")
+dat$transitionMutationsAtAT = apply(dat, FUN=sum_by_row, 1, columns=transitionMutationsAtAT_columns)
+
+totalMutationsAtAT_columns = paste(rep(regions, each=6), c(".IMGT.a.g",".IMGT.a.c",".IMGT.a.t",".IMGT.t.g",".IMGT.t.c",".IMGT.t.a"), sep="")
+#totalMutationsAtAT_columns = paste(rep(regions, each=5), c(".IMGT.a.g",".IMGT.t.c",".IMGT.a.c",".IMGT.g.c",".IMGT.t.g"), sep="")
+dat$totalMutationsAtAT = apply(dat, FUN=sum_by_row, 1, columns=totalMutationsAtAT_columns)
+
+
+FRRegions = regions[grepl("FR", regions)]
+CDRRegions = regions[grepl("CDR", regions)]
+
+FR_silentMutations_columns = paste(FRRegions, ".IMGT.Nb.of.silent.mutations", sep="")
+dat$silentMutationsFR = apply(dat, FUN=sum_by_row, 1, columns=FR_silentMutations_columns)
+
+CDR_silentMutations_columns = paste(CDRRegions, ".IMGT.Nb.of.silent.mutations", sep="")
+dat$silentMutationsCDR = apply(dat, FUN=sum_by_row, 1, columns=CDR_silentMutations_columns)
+
+FR_nonSilentMutations_columns = paste(FRRegions, ".IMGT.Nb.of.nonsilent.mutations", sep="")
+dat$nonSilentMutationsFR = apply(dat, FUN=sum_by_row, 1, columns=FR_nonSilentMutations_columns)
+
+CDR_nonSilentMutations_columns = paste(CDRRegions, ".IMGT.Nb.of.nonsilent.mutations", sep="")
+dat$nonSilentMutationsCDR = apply(dat, FUN=sum_by_row, 1, columns=CDR_nonSilentMutations_columns)
+
+mutation.sum.columns = c("Sequence.ID", "VRegionMutations", "VRegionNucleotides", "transitionMutations", "transversionMutations", "transitionMutationsAtGC", "transitionMutationsAtAT", "silentMutationsFR", "nonSilentMutationsFR", "silentMutationsCDR", "nonSilentMutationsCDR")
+
+write.table(dat[,mutation.sum.columns], "mutation_by_id.txt", sep="\t",quote=F,row.names=F,col.names=T)
+
+setwd(outputdir)
+
+base.order = data.frame(base=c("A", "T", "C", "G"), order=1:4)
+
+calculate_result = function(i, gene, dat, matrx, f, fname, name){
+	tmp = dat[grepl(paste("^", gene, ".*", sep=""), dat$best_match),]
+
+	j = i - 1
+	x = (j * 3) + 1
+	y = (j * 3) + 2
+	z = (j * 3) + 3
+	 
+	if(nrow(tmp) > 0){
+	  
+		if(fname == "sum"){
+		matrx[1,x] = round(f(tmp$VRegionMutations, na.rm=T), digits=1)
+		matrx[1,y] = round(f(tmp$VRegionNucleotides, na.rm=T), digits=1)
+		matrx[1,z] = round(f(matrx[1,x] / matrx[1,y]) * 100, digits=1)
+		} else {
+		matrx[1,x] = round(f(tmp$VRegionMutations, na.rm=T), digits=1)
+		matrx[1,y] = round(f(tmp$VRegionNucleotides, na.rm=T), digits=1)
+		matrx[1,z] = round(f(tmp$VRegionMutations / tmp$VRegionNucleotides) * 100, digits=1)
+		}
+
+		matrx[2,x] = round(f(tmp$transitionMutations, na.rm=T), digits=1)
+		matrx[2,y] = round(f(tmp$VRegionMutations, na.rm=T), digits=1)
+		matrx[2,z] = round(matrx[2,x] / matrx[2,y] * 100, digits=1)
+
+		matrx[3,x] = round(f(tmp$transversionMutations, na.rm=T), digits=1)
+		matrx[3,y] = round(f(tmp$VRegionMutations, na.rm=T), digits=1)
+		matrx[3,z] = round(matrx[3,x] / matrx[3,y] * 100, digits=1)
+
+		matrx[4,x] = round(f(tmp$transitionMutationsAtGC, na.rm=T), digits=1)
+		matrx[4,y] = round(f(tmp$totalMutationsAtGC, na.rm=T), digits=1)
+		matrx[4,z] = round(matrx[4,x] / matrx[4,y] * 100, digits=1)
+
+		matrx[5,x] = round(f(tmp$totalMutationsAtGC, na.rm=T), digits=1)
+		matrx[5,y] = round(f(tmp$VRegionMutations, na.rm=T), digits=1)
+		matrx[5,z] = round(matrx[5,x] / matrx[5,y] * 100, digits=1)
+
+		matrx[6,x] = round(f(tmp$transitionMutationsAtAT, na.rm=T), digits=1)
+		matrx[6,y] = round(f(tmp$totalMutationsAtAT, na.rm=T), digits=1)
+		matrx[6,z] = round(matrx[6,x] / matrx[6,y] * 100, digits=1)
+
+		matrx[7,x] = round(f(tmp$totalMutationsAtAT, na.rm=T), digits=1)
+		matrx[7,y] = round(f(tmp$VRegionMutations, na.rm=T), digits=1)
+		matrx[7,z] = round(matrx[7,x] / matrx[7,y] * 100, digits=1)
+
+		matrx[8,x] = round(f(tmp$nonSilentMutationsFR, na.rm=T), digits=1)
+		matrx[8,y] = round(f(tmp$silentMutationsFR, na.rm=T), digits=1)
+		matrx[8,z] = round(matrx[8,x] / matrx[8,y], digits=1)
+
+		matrx[9,x] = round(f(tmp$nonSilentMutationsCDR, na.rm=T), digits=1)
+		matrx[9,y] = round(f(tmp$silentMutationsCDR, na.rm=T), digits=1)
+		matrx[9,z] = round(matrx[9,x] / matrx[9,y], digits=1)
+
+		if(fname == "sum"){
+			matrx[10,x] = round(f(rowSums(tmp[,c("FR2.IMGT.Nb.of.nucleotides", "FR3.IMGT.Nb.of.nucleotides")], na.rm=T)), digits=1)
+			matrx[10,y] = round(f(tmp$VRegionNucleotides, na.rm=T), digits=1)
+			matrx[10,z] = round(matrx[10,x] / matrx[10,y] * 100, digits=1)
+
+			matrx[11,x] = round(f(rowSums(tmp[,c("CDR1.IMGT.Nb.of.nucleotides", "CDR2.IMGT.Nb.of.nucleotides")], na.rm=T)), digits=1)
+			matrx[11,y] = round(f(tmp$VRegionNucleotides, na.rm=T), digits=1)
+			matrx[11,z] = round(matrx[11,x] / matrx[11,y] * 100, digits=1)
+		}
+	}
+  
+	transitionTable = data.frame(A=zeros,C=zeros,G=zeros,T=zeros)
+	row.names(transitionTable) = c("A", "C", "G", "T")
+	transitionTable["A","A"] = NA
+	transitionTable["C","C"] = NA
+	transitionTable["G","G"] = NA
+	transitionTable["T","T"] = NA
+
+	if(nrow(tmp) > 0){
+		for(nt1 in nts){
+			for(nt2 in nts){
+				if(nt1 == nt2){
+					next
+				}
+				NT1 = LETTERS[letters == nt1]
+				NT2 = LETTERS[letters == nt2]
+				FR1 = paste("FR1.IMGT.", nt1, ".", nt2, sep="")
+				CDR1 = paste("CDR1.IMGT.", nt1, ".", nt2, sep="")
+				FR2 = paste("FR2.IMGT.", nt1, ".", nt2, sep="")
+				CDR2 = paste("CDR2.IMGT.", nt1, ".", nt2, sep="")
+				FR3 = paste("FR3.IMGT.", nt1, ".", nt2, sep="")
+				if(include_fr1){
+					transitionTable[NT1,NT2] = sum(tmp[,c(FR1, CDR1, FR2, CDR2, FR3)])
+				} else {
+					transitionTable[NT1,NT2] = sum(tmp[,c(CDR1, FR2, CDR2, FR3)])
+				}
+			}
+		}
+		transition = transitionTable
+		transition$id = names(transition)
+		
+		transition2 = melt(transition, id.vars="id")
+		
+		transition2 = merge(transition2, base.order, by.x="id", by.y="base")
+		transition2 = merge(transition2, base.order, by.x="variable", by.y="base")
+
+		transition2[is.na(transition2$value),]$value = 0
+		
+		if(!all(transition2$value == 0)){ #having rows of data but a transition table filled with 0 is bad
+
+			print("Plotting stacked transition")
+
+			png(filename=paste("transitions_stacked_", name, ".png", sep=""))
+			p = ggplot(transition2, aes(factor(reorder(id, order.x)), y=value, fill=factor(reorder(variable, order.y)))) + geom_bar(position="fill", stat="identity", colour="black") #stacked bar
+			p = p + xlab("From base") + ylab("To base") + ggtitle("Mutations frequency from base to base") + guides(fill=guide_legend(title=NULL))
+			p = p + theme(panel.background = element_rect(fill = "white", colour="black")) + scale_fill_manual(values=c("A" = "blue4", "G" = "lightblue1", "C" = "olivedrab3", "T" = "olivedrab4"))
+			#p = p + scale_colour_manual(values=c("A" = "black", "G" = "black", "C" = "black", "T" = "black"))
+			print(p)
+			dev.off()
+
+			print("Plotting heatmap transition")
+
+			png(filename=paste("transitions_heatmap_", name, ".png", sep=""))
+			p = ggplot(transition2, aes(factor(reorder(id, order.x)), factor(reorder(variable, order.y)))) + geom_tile(aes(fill = value)) + scale_fill_gradient(low="white", high="steelblue") #heatmap
+			p = p + xlab("From base") + ylab("To base") + ggtitle("Mutations frequency from base to base")  + theme(panel.background = element_rect(fill = "white", colour="black"))
+			print(p)
+			dev.off()
+		} else {
+			print("No data to plot")
+		}
+	}
+
+	#print(paste("writing value file: ", name, "_", fname, "_value.txt" ,sep=""))
+
+	write.table(x=transitionTable, file=paste("transitions_", name ,"_", fname, ".txt", sep=""), sep=",",quote=F,row.names=T,col.names=NA)
+	write.table(x=tmp[,c("Sequence.ID", "best_match", "chunk_hit_percentage", "nt_hit_percentage", "start_locations")], file=paste("matched_", name , "_", fname, ".txt", sep=""), sep="\t",quote=F,row.names=F,col.names=T)
+
+	cat(matrx[1,x], file=paste(name, "_", fname, "_value.txt" ,sep=""))
+	cat(nrow(tmp), file=paste(name, "_", fname, "_n.txt" ,sep=""))
+
+	#print(paste(fname, name, nrow(tmp)))
+
+	matrx
+}
+
+nts = c("a", "c", "g", "t")
+zeros=rep(0, 4)
+
+funcs = c(median, sum, mean)
+fnames = c("median", "sum", "mean")
+
+print("Creating result tables")
+
+for(i in 1:length(funcs)){
+	func = funcs[[i]]
+	fname = fnames[[i]]
+	
+	rows = 9
+	if(fname == "sum"){
+		rows = 11
+	}
+	matrx = matrix(data = 0, ncol=((length(genes) + 1) * 3),nrow=rows)
+	
+	for(i in 1:length(genes)){
+		print(paste("Creating table for", fname, genes[i]))
+		matrx = calculate_result(i, genes[i], dat, matrx, func, fname, genes[i])
+	}
+
+	matrx = calculate_result(i + 1, ".*", dat[!grepl("unmatched", dat$best_match),], matrx, func, fname, name="all")
+	
+	result = data.frame(matrx)
+	if(fname == "sum"){
+		row.names(result) = c("Number of Mutations (%)", "Transitions (%)", "Transversions (%)", "Transitions at G C (%)", "Targeting of C G (%)", "Transitions at A T (%)", "Targeting of A T (%)", "FR R/S (ratio)", "CDR R/S (ratio)", "nt in FR", "nt in CDR")
+	} else {
+		row.names(result) = c("Number of Mutations (%)", "Transitions (%)", "Transversions (%)", "Transitions at G C (%)", "Targeting of C G (%)", "Transitions at A T (%)", "Targeting of A T (%)", "FR R/S (ratio)", "CDR R/S (ratio)")
+	}
+
+	write.table(x=result, file=paste("mutations_", fname, ".txt", sep=""), sep=",",quote=F,row.names=T,col.names=F)
+}
+
+print("Adding median number of mutations to sum table")
+
+sum.table = read.table("mutations_sum.txt", sep=",", header=F)
+median.table = read.table("mutations_median.txt", sep=",", header=F)
+
+new.table = sum.table[1,]
+new.table[2,] = median.table[1,]
+new.table[3:12,] = sum.table[2:11,]
+new.table[,1] = as.character(new.table[,1])
+new.table[2,1] = "Median of Number of Mutations (%)"
+
+#sum.table = sum.table[c("Number of Mutations (%)", "Median of Number of Mutations (%)", "Transition (%)", "Transversions (%)", "Transitions at G C (%)", "Targeting of C G (%)", "Transitions at A T (%)", "Targeting of A T (%)", "FR R/S (ratio)", "CDR R/S (ratio)", "nt in FR", "nt in CDR"),]
+
+write.table(x=new.table, file="mutations_sum.txt", sep=",",quote=F,row.names=F,col.names=F)
+
+
+print("Plotting IGA piechart")
+
+dat = dat[!grepl("^unmatched", dat$best_match),]
+
+#blegh
+genesForPlot = dat[grepl("IGA", dat$best_match),]$best_match
+if(length(genesForPlot) > 0){
+	genesForPlot = data.frame(table(genesForPlot))
+	colnames(genesForPlot) = c("Gene","Freq")
+	genesForPlot$label = paste(genesForPlot$Gene, "-", genesForPlot$Freq)
+
+	pc = ggplot(genesForPlot, aes(x = factor(1), y=Freq, fill=Gene))
+	pc = pc + geom_bar(width = 1, stat = "identity") + scale_fill_manual(labels=genesForPlot$label, values=c("IGA1" = "lightblue1", "IGA2" = "blue4"))
+	pc = pc + coord_polar(theta="y")
+	pc = pc + theme(panel.background = element_rect(fill = "white", colour="black"))
+	pc = pc + xlab(" ") + ylab(" ") + ggtitle(paste("IGA subclasses", "( n =", sum(genesForPlot$Freq), ")"))
+	write.table(genesForPlot, "IGA.txt", sep="\t",quote=F,row.names=F,col.names=T)
+
+	png(filename="IGA.png")
+	print(pc)
+	dev.off()
+}
+
+print("Plotting IGG piechart")
+
+genesForPlot = dat[grepl("IGG", dat$best_match),]$best_match
+if(length(genesForPlot) > 0){
+	genesForPlot = data.frame(table(genesForPlot))
+	colnames(genesForPlot) = c("Gene","Freq")
+	genesForPlot$label = paste(genesForPlot$Gene, "-", genesForPlot$Freq)
+
+	pc = ggplot(genesForPlot, aes(x = factor(1), y=Freq, fill=Gene))
+	pc = pc + geom_bar(width = 1, stat = "identity") + scale_fill_manual(labels=genesForPlot$label, values=c("IGG1" = "olivedrab3", "IGG2" = "red", "IGG3" = "gold", "IGG4" = "darkred"))
+	pc = pc + coord_polar(theta="y") 
+	pc = pc + theme(panel.background = element_rect(fill = "white", colour="black"))
+	pc = pc + xlab(" ") + ylab(" ") + ggtitle(paste("IGG subclasses", "( n =", sum(genesForPlot$Freq), ")"))
+	write.table(genesForPlot, "IGG.txt", sep="\t",quote=F,row.names=F,col.names=T)
+
+	png(filename="IGG.png")
+	print(pc)
+	dev.off()
+}
+
+
+print("Plotting scatterplot")
+
+dat$percentage_mutations = round(dat$VRegionMutations / dat$VRegionNucleotides * 100, 2)
+
+p = ggplot(dat, aes(best_match, percentage_mutations))
+p = p + geom_point(aes(colour=best_match), position="jitter") + geom_boxplot(aes(middle=mean(percentage_mutations)), alpha=0.1, outlier.shape = NA)
+p = p + xlab("Subclass") + ylab("Frequency") + ggtitle("Frequency scatter plot") + theme(panel.background = element_rect(fill = "white", colour="black"))
+p = p + scale_fill_manual(values=c("IGA1" = "lightblue1", "IGA2" = "blue4", "IGG1" = "olivedrab3", "IGG2" = "red", "IGG3" = "gold", "IGG4" = "darkred", "IGM" = "black"))
+p = p + scale_colour_manual(values=c("IGA1" = "lightblue1", "IGA2" = "blue4", "IGG1" = "olivedrab3", "IGG2" = "red", "IGG3" = "gold", "IGG4" = "darkred", "IGM" = "black"))
+
+png(filename="scatter.png")
+print(p)
+dev.off()
+
+write.table(dat[,c("Sequence.ID", "best_match", "VRegionMutations", "VRegionNucleotides", "percentage_mutations")], "scatter.txt", sep="\t",quote=F,row.names=F,col.names=T)
+
+write.table(dat, input, sep="\t",quote=F,row.names=F,col.names=T)
+
+
+print("Plotting frequency ranges plot")
+
+dat$best_match_class = substr(dat$best_match, 0, 3)
+freq_labels = c("0", "0-2", "2-5", "5-10", "10-15", "15-20", "20")
+dat$frequency_bins = cut(dat$percentage_mutations, breaks=c(-Inf, 0, 2,5,10,15,20, Inf), labels=freq_labels)
+
+frequency_bins_sum = data.frame(data.table(dat)[, list(class_sum=sum(.N)), by=c("best_match_class")])
+
+frequency_bins_data = data.frame(data.table(dat)[, list(frequency_count=.N), by=c("best_match_class", "frequency_bins")])
+
+frequency_bins_data = merge(frequency_bins_data, frequency_bins_sum, by="best_match_class")
+
+frequency_bins_data$frequency = round(frequency_bins_data$frequency_count / frequency_bins_data$class_sum * 100, 2)
+
+p = ggplot(frequency_bins_data, aes(frequency_bins, frequency))
+p = p + geom_bar(aes(fill=best_match_class), stat="identity", position="dodge") + theme(panel.background = element_rect(fill = "white", colour="black"))
+p = p + xlab("Frequency ranges") + ylab("Frequency") + ggtitle("Mutation Frequencies by class") + scale_fill_manual(values=c("IGA" = "blue4", "IGG" = "olivedrab3", "IGM" = "black"))
+
+png(filename="frequency_ranges.png")
+print(p)
+dev.off()
+
+frequency_bins_data_by_class = frequency_bins_data
+
+write.table(frequency_bins_data_by_class, "frequency_ranges_classes.txt", sep="\t",quote=F,row.names=F,col.names=T)
+
+frequency_bins_data = data.frame(data.table(dat)[, list(frequency_count=.N), by=c("best_match", "best_match_class", "frequency_bins")])
+
+frequency_bins_data = merge(frequency_bins_data, frequency_bins_sum, by="best_match_class")
+
+frequency_bins_data$frequency = round(frequency_bins_data$frequency_count / frequency_bins_data$class_sum * 100, 2)
+
+write.table(frequency_bins_data, "frequency_ranges_subclasses.txt", sep="\t",quote=F,row.names=F,col.names=T)
+
+
+#frequency_bins_data_by_class
+#frequency_ranges_subclasses.txt
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/shm_csr.xml	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,94 @@
+<tool id="shm_csr" name="SHM &amp; CSR pipeline" version="1.0">
+	<description></description>
+	<command interpreter="bash">
+		wrapper.sh $in_file custom $out_file $out_file.files_path ${in_file.name} ${include_fr1} $functionality $unique $naive_output_ca $naive_output_cg $naive_output_cm $filter_uniques $class_filter $empty_region_filter
+	</command>
+	<inputs>
+		<param name="in_file" type="data" label="IMGT zip file to be analysed" />
+		<param name="empty_region_filter" type="select" label="Sequence starts at" help="" >
+			<option value="FR1" selected="true">FR1: include CDR1,FR2,CDR2,FR3 in filters</option>
+			<option value="CDR1">CDR1: include FR2,CDR2,FR3 in filters</option>
+			<option value="FR2">FR2: include CDR2,FR3 in filters</option>
+		</param>
+		<param name="include_fr1" type="select" label="Include mutations in FR1 region" help="" >
+			<option value="yes">yes</option>
+			<option value="no" selected="true">no</option>
+		</param>
+		<param name="functionality" type="select" label="Functionality filter" help="" >
+			<option value="productive" selected="true">Productive: Keep "productive" and "productive (see comment)"</option>
+			<option value="unproductive">Unproductive: Keep "unproductive" and "unproductive (see comment)"</option>
+			<option value="remove_unknown">Remove "unknown" and "unknown (see comment)"</option>
+			<option value="dont_filter">Don't filter</option>
+		</param>
+		<param name="filter_uniques" type="select" label="Filter unique sequences" help="See below for an example.">
+			<option value="remove">Remove uniques (Based on nucleotide sequence + C)</option>
+			<option value="keep">Keep uniques (Based on nucleotide sequence + C)</option>
+			<option value="no" selected="true">No</option>
+		</param>
+		<param name="unique" type="select" label="Remove duplicates based on" help="" >
+			<option value="VGene,AA.JUNCTION,best_match" selected="true">Top.V.Gene, CDR3 (AA), C region</option>
+			<option value="VGene,AA.JUNCTION">Top.V.Gene, CDR3 (AA)</option>
+			<option value="AA.JUNCTION,best_match">CDR3 (AA), C region</option>
+			<option value="AA.JUNCTION">CDR3 (AA)</option>
+			
+			<option value="VGene,CDR3.IMGT.seq,best_match" selected="true">Top.V.Gene, CDR3.nt.Seq, C region</option>
+			<option value="VGene,CDR3.IMGT.seq">Top.V.Gene, CDR3 (nt)</option>
+			<option value="CDR3.IMGT.seq,best_match">CDR3 (nt), C region</option>
+			<option value="CDR3.IMGT.seq">CDR3 (nt)</option>
+			<option value="Sequence.ID">Don't remove duplicates</option>
+		</param>
+		<param name="class_filter" type="select" label="Class/Subclass filter" help="" >
+			<option value="70_70" selected="true">>70% class and >70% subclass</option>
+			<option value="60_55">>60% class and >55% subclass</option>
+			<option value="70_0">>70% class</option>
+			<option value="60_0">>60% class</option>
+			<option value="101_101">No class</option>
+		</param>
+		<conditional name="naive_output_cond">
+			<param name="naive_output" type="select" label="Output new IMGT archives per class into your history?">
+				<option value="yes">Yes</option>
+				<option value="no" selected="true">No</option>
+			</param>
+		</conditional>
+	</inputs>
+	<outputs>
+		<data format="html" name="out_file" label = "SHM &amp; CSR on ${in_file.name}"/>
+		<data format="imgt_archive" name="naive_output_ca" label = "Naive CA input data from ${in_file.name}" >
+		    <filter>naive_output_cond['naive_output'] == "yes"</filter>
+		</data>
+		<data format="imgt_archive" name="naive_output_cg" label = "Naive CG input data from ${in_file.name}" >
+		    <filter>naive_output_cond['naive_output'] == "yes"</filter>
+		</data>
+		<data format="imgt_archive" name="naive_output_cm" label = "Naive CM input data from ${in_file.name}" >
+		    <filter>naive_output_cond['naive_output'] == "yes"</filter>
+		</data>
+	</outputs>
+	<citations>
+		<citation type="doi">10.1093/nar/gks457</citation>
+		<citation type="doi">10.1093/bioinformatics/btv359</citation>
+	</citations>
+	<help>
+		Takes an IMGT zip (http://www.imgt.org/HighV-QUEST/search.action) file and creates a summarization of the mutation analysis.  
+		
+		+--------------------------+
+		|       unique filter      |
+		+--------+--------+--------+
+		| values | remove | keep   |
+		+--------+--------+--------+
+		|   A    |   A    |   A    |
+		+--------+--------+--------+
+		|   A    |   B    |   B    |
+		+--------+--------+--------+
+		|   B    |   D    |   C    |
+		+--------+--------+--------+
+		|   B    |        |   D    |
+		+--------+--------+--------+
+		|   C    |        |        |
+		+--------+--------+--------+
+		|   D    |        |        |
+		+--------+--------+--------+
+		|   D    |        |        |
+		+--------+--------+--------+
+		
+	</help>
+</tool>
Binary file style.tar.gz has changed
Binary file subclass_definition.db.nhr has changed
Binary file subclass_definition.db.nin has changed
Binary file subclass_definition.db.nsq has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/summary_to_fasta.py	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,42 @@
+import argparse
+
+parser = argparse.ArgumentParser()
+parser.add_argument("--input", help="The 1_Summary file of an IMGT zip file")
+parser.add_argument("--fasta", help="The output fasta file")
+
+args = parser.parse_args()
+
+infile = args.input
+fasta = args.fasta
+
+with open(infile, 'r') as i, open(fasta, 'w') as o:
+	first = True
+	id_col = 0
+	seq_col = 0
+	no_results = 0
+	no_seqs = 0
+	passed = 0
+	for line in i:
+		splt = line.split("\t")
+		if first:
+			id_col = splt.index("Sequence ID")
+			seq_col = splt.index("Sequence")
+			first = False
+			continue
+		if len(splt) < 5:
+			no_results += 1
+			continue
+		
+		ID = splt[id_col]
+		seq = splt[seq_col]
+		
+		if not len(seq) > 0:
+			no_seqs += 1
+			continue
+		
+		o.write(">" + ID + "\n" + seq + "\n")
+		passed += 1
+			
+	print "No results:", no_results
+	print "No sequences:", no_seqs
+	print "Written to fasta file:", passed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/wrapper.sh	Thu Oct 13 10:52:24 2016 -0400
@@ -0,0 +1,632 @@
+#!/bin/bash
+#set -e
+dir="$(cd "$(dirname "$0")" && pwd)"
+input=$1
+method=$2
+log=$3 #becomes the main html page at the end
+outdir=$4
+output="$outdir/index.html" #copied to $log location at the end
+title=$5
+include_fr1=$6
+functionality=$7
+unique=$8
+naive_output_ca=$9
+naive_output_cg=${10}
+naive_output_cm=${11}
+filter_unique=${12}
+class_filter=${13}
+empty_region_filter=${14}
+mkdir $outdir
+
+tar -xzf $dir/style.tar.gz -C $outdir
+
+echo "---------------- read parameters ----------------"
+echo "---------------- read parameters ----------------<br />" > $log
+
+echo "unpacking IMGT file"
+
+type="`file $input`"
+if [[ "$type" == *"Zip archive"* ]] ; then
+	echo "Zip archive"
+	echo "unzip $input -d $PWD/files/"
+	unzip $input -d $PWD/files/
+elif [[ "$type" == *"XZ compressed data"* ]] ; then
+	echo "ZX archive"
+	echo "tar -xJf $input -C $PWD/files/"
+	mkdir -p $PWD/files/$title
+	tar -xJf $input -C $PWD/files/$title
+fi
+
+cat `find $PWD/files/ -name "1_*"` > $PWD/summary.txt
+cat `find $PWD/files/ -name "3_*"` > $PWD/sequences.txt
+cat `find $PWD/files/ -name "5_*"` > $PWD/aa.txt
+cat `find $PWD/files/ -name "6_*"` > $PWD/junction.txt
+cat `find $PWD/files/ -name "7_*"` > $PWD/mutationanalysis.txt
+cat `find $PWD/files/ -name "8_*"` > $PWD/mutationstats.txt
+cat `find $PWD/files/ -name "10_*"` > $PWD/hotspots.txt
+
+if [[ ${#BLASTN_DIR} -ge 5 ]] ; then
+	echo "On server, using BLASTN_DIR env: ${BLASTN_DIR}"
+else
+	BLASTN_DIR="/home/galaxy/Downloads/ncbi-blast-2.4.0+/bin"
+	echo "Dev Galaxy set BLASTN_DIR to: ${BLASTN_DIR}"
+fi
+
+echo "---------------- class identification ----------------"
+echo "---------------- class identification ----------------<br />" >> $log
+
+python $dir/gene_identification.py --input $PWD/summary.txt --output $outdir/identified_genes.txt
+
+echo "---------------- merge_and_filter.r ----------------"
+echo "---------------- merge_and_filter.r ----------------<br />" >> $log
+
+Rscript $dir/merge_and_filter.r $PWD/summary.txt $PWD/sequences.txt $PWD/mutationanalysis.txt $PWD/mutationstats.txt $PWD/hotspots.txt $outdir/identified_genes.txt $outdir/merged.txt $outdir/before_unique_filter.txt $outdir/unmatched.txt $method $functionality $unique ${filter_unique} ${class_filter} ${empty_region_filter} 2>&1
+
+echo "---------------- creating new IMGT zips ----------------"
+echo "---------------- creating new IMGT zips ----------------<br />" >> $log
+
+mkdir $outdir/new_IMGT
+
+cat `find $PWD/files/ -name "1_*"` > "$outdir/new_IMGT/1_Summary.txt"
+cat `find $PWD/files/ -name "2_*"` > "$outdir/new_IMGT/2_IMGT-gapped-nt-sequences.txt"
+cat `find $PWD/files/ -name "3_*"` > "$outdir/new_IMGT/3_Nt-sequences.txt"
+cat `find $PWD/files/ -name "4_*"` > "$outdir/new_IMGT/4_IMGT-gapped-AA-sequences.txt"
+cat `find $PWD/files/ -name "5_*"` > "$outdir/new_IMGT/5_AA-sequences.txt"
+cat `find $PWD/files/ -name "6_*"` > "$outdir/new_IMGT/6_Junction.txt"
+cat `find $PWD/files/ -name "7_*"` > "$outdir/new_IMGT/7_V-REGION-mutation-and-AA-change-table.txt"
+cat `find $PWD/files/ -name "8_*"` > "$outdir/new_IMGT/8_V-REGION-nt-mutation-statistics.txt"
+cat `find $PWD/files/ -name "9_*"` > "$outdir/new_IMGT/9_V-REGION-AA-change-statistics.txt"
+cat `find $PWD/files/ -name "10_*"` > "$outdir/new_IMGT/10_V-REGION-mutation-hotspots.txt"
+
+mkdir $outdir/new_IMGT_IGA
+cp $outdir/new_IMGT/* $outdir/new_IMGT_IGA
+
+mkdir $outdir/new_IMGT_IGA1
+cp $outdir/new_IMGT/* $outdir/new_IMGT_IGA1
+
+mkdir $outdir/new_IMGT_IGA2
+cp $outdir/new_IMGT/* $outdir/new_IMGT_IGA2
+
+mkdir $outdir/new_IMGT_IGG
+cp $outdir/new_IMGT/* $outdir/new_IMGT_IGG
+
+mkdir $outdir/new_IMGT_IGG1
+cp $outdir/new_IMGT/* $outdir/new_IMGT_IGG1
+
+mkdir $outdir/new_IMGT_IGG2
+cp $outdir/new_IMGT/* $outdir/new_IMGT_IGG2
+
+mkdir $outdir/new_IMGT_IGG3
+cp $outdir/new_IMGT/* $outdir/new_IMGT_IGG3
+
+mkdir $outdir/new_IMGT_IGG4
+cp $outdir/new_IMGT/* $outdir/new_IMGT_IGG4
+
+mkdir $outdir/new_IMGT_IGM
+cp $outdir/new_IMGT/* $outdir/new_IMGT_IGM
+
+Rscript $dir/new_imgt.r $outdir/new_IMGT/ $outdir/merged.txt "-" 2>&1
+
+Rscript $dir/new_imgt.r $outdir/new_IMGT_IGA/ $outdir/merged.txt "IGA" 2>&1
+Rscript $dir/new_imgt.r $outdir/new_IMGT_IGA1/ $outdir/merged.txt "IGA1" 2>&1
+Rscript $dir/new_imgt.r $outdir/new_IMGT_IGA2/ $outdir/merged.txt "IGA2" 2>&1
+
+Rscript $dir/new_imgt.r $outdir/new_IMGT_IGG/ $outdir/merged.txt "IGG" 2>&1
+Rscript $dir/new_imgt.r $outdir/new_IMGT_IGG1/ $outdir/merged.txt "IGG1" 2>&1
+Rscript $dir/new_imgt.r $outdir/new_IMGT_IGG2/ $outdir/merged.txt "IGG2" 2>&1
+Rscript $dir/new_imgt.r $outdir/new_IMGT_IGG3/ $outdir/merged.txt "IGG3" 2>&1
+Rscript $dir/new_imgt.r $outdir/new_IMGT_IGG4/ $outdir/merged.txt "IGG4" 2>&1
+
+Rscript $dir/new_imgt.r $outdir/new_IMGT_IGM/ $outdir/merged.txt "IGM" 2>&1
+
+
+tmp="$PWD"
+cd $outdir/new_IMGT/ #tar weirdness...
+tar -cJf ../new_IMGT.txz *
+
+cd $outdir/new_IMGT_IGA/
+tar -cJf ../new_IMGT_IGA.txz *
+
+cd $outdir/new_IMGT_IGA1/
+tar -cJf ../new_IMGT_IGA1.txz *
+
+cd $outdir/new_IMGT_IGA2/
+tar -cJf ../new_IMGT_IGA2.txz *
+
+cd $outdir/new_IMGT_IGG/
+tar -cJf ../new_IMGT_IGG.txz *
+
+cd $outdir/new_IMGT_IGG1/
+tar -cJf ../new_IMGT_IGG1.txz *
+
+cd $outdir/new_IMGT_IGG2/
+tar -cJf ../new_IMGT_IGG2.txz *
+
+cd $outdir/new_IMGT_IGG3/
+tar -cJf ../new_IMGT_IGG3.txz *
+
+cd $outdir/new_IMGT_IGG4/
+tar -cJf ../new_IMGT_IGG4.txz *
+
+cd $outdir/new_IMGT_IGM/
+tar -cJf ../new_IMGT_IGM.txz *
+
+cd $tmp
+
+echo "---------------- shm_csr.r ----------------"
+echo "---------------- shm_csr.r ----------------<br />" >> $log
+
+classes="IGA,IGA1,IGA2,IGG,IGG1,IGG2,IGG3,IGG4,IGM,unmatched"
+echo "R mutation analysis"
+Rscript $dir/shm_csr.r $outdir/merged.txt $classes $outdir ${include_fr1} 2>&1
+
+
+echo "---------------- shm_csr.py ----------------"
+echo "---------------- shm_csr.py ----------------<br />" >> $log
+
+python $dir/shm_csr.py --input $outdir/merged.txt --genes $classes --includefr1 "${include_fr1}" --output $outdir/hotspot_analysis.txt
+
+echo "---------------- aa_histogram.r ----------------"
+echo "---------------- aa_histogram.r ----------------<br />" >> $log
+
+Rscript $dir/aa_histogram.r $outdir/aa_id_mutations.txt $outdir/absent_aa_id.txt "IGA,IGG,IGM" $outdir/ 2>&1
+if [ -e "$outdir/aa_histogram_.png" ]; then
+        mv $outdir/aa_histogram_.png $outdir/aa_histogram.png
+        mv $outdir/aa_histogram_.txt $outdir/aa_histogram.txt
+fi
+
+genes=(IGA IGA1 IGA2 IGG IGG1 IGG2 IGG3 IGG4 IGM)
+
+funcs=(sum mean median)
+funcs=(sum)
+
+echo "---------------- sequence_overview.r ----------------"
+echo "---------------- sequence_overview.r ----------------<br />" >> $log
+
+mkdir $outdir/sequence_overview
+
+Rscript $dir/sequence_overview.r $outdir/before_unique_filter.txt $outdir/merged.txt $outdir/sequence_overview $classes $outdir/hotspot_analysis_sum.txt 2>&1
+
+echo "<table border='1'>" > $outdir/base_overview.html
+
+while IFS=$'\t' read ID class seq A C G T
+do
+	echo "<tr><td>$ID</td><td>$seq</td><td>$class</td><td>$A</td><td>$C</td><td>$G</td><td>$T</td></tr>" >> $outdir/base_overview.html
+done < $outdir/sequence_overview/ntoverview.txt
+
+echo "<html><center><h1>$title</h1></center>" > $output
+echo "<meta name='viewport' content='width=device-width, initial-scale=1'>" >> $output
+echo "<script type='text/javascript' src='jquery-1.11.0.min.js'></script>" >> $output
+echo "<script type='text/javascript' src='tabber.js'></script>" >> $output
+echo "<script type='text/javascript' src='script.js'></script>" >> $output
+echo "<link rel='stylesheet' type='text/css' href='style.css'>" >> $output
+echo "<link rel='stylesheet' type='text/css' href='pure-min.css'>" >> $output
+
+matched_count="`cat $outdir/merged.txt | grep -v 'unmatched' | tail -n +2 | wc -l`"
+unmatched_count="`cat $outdir/unmatched.txt | tail -n +2 | wc -l`"
+total_count=$((matched_count + unmatched_count))
+perc_count=$((unmatched_count / total_count * 100))
+perc_count=`bc -l <<< "scale=2; ${unmatched_count} / ${total_count} * 100"`
+perc_count=`bc -l <<< "scale=2; (${unmatched_count} / ${total_count} * 100 ) / 1"`
+
+echo "<center><h2>Total: ${total_count}</h2></center>" >> $output
+echo "<center><h2>Matched: ${matched_count} Unmatched: ${unmatched_count}</h2></center>" >> $output
+echo "<center><h2>Percentage unmatched: ${perc_count}</h2></center>" >> $output
+
+echo "---------------- main tables ----------------"
+echo "---------------- main tables ----------------<br />" >> $log
+
+echo "<div class='tabber'>" >> $output
+echo "<div class='tabbertab' title='SHM Overview'>" >> $output
+
+for func in ${funcs[@]}
+do
+	
+	echo "---------------- $func table ----------------"
+	echo "---------------- $func table ----------------<br />" >> $log
+	
+	cat $outdir/mutations_${func}.txt $outdir/hotspot_analysis_${func}.txt > $outdir/data_${func}.txt
+	
+	echo "---------------- pattern_plots.r ----------------"
+	echo "---------------- pattern_plots.r ----------------<br />" >> $log
+
+	Rscript $dir/pattern_plots.r $outdir/data_${func}.txt $outdir/plot1 $outdir/plot2 $outdir/plot3 2>&1
+	
+	echo "<table class='pure-table pure-table-striped'>" >> $output
+	echo "<thead><tr><th>info</th>" >> $output
+	
+	if [ "${class_filter}" != "101_101" ] ; then
+	
+		for gene in ${genes[@]}
+		do
+			tmp=`cat $outdir/${gene}_${func}_n.txt`
+			echo "<th><a href='matched_${gene}_${func}.txt'>${gene} (N = $tmp)</a></th>" >> $output
+		done
+		
+		tmp=`cat $outdir/all_${func}_n.txt`
+		echo "<th><a href='matched_all_${func}.txt'>all (N = $tmp)</a></th>" >> $output
+		tmp=`cat $outdir/unmatched_${func}_n.txt`
+		echo "<th><a href='unmatched.txt'>unmatched (N = ${unmatched_count})</a></th><tr></thead>" >> $output
+
+		while IFS=, read name cax cay caz ca1x ca1y ca1z ca2x ca2y ca2z cgx cgy cgz cg1x cg1y cg1z cg2x cg2y cg2z cg3x cg3y cg3z cg4x cg4y cg4z cmx cmy cmz unx uny unz allx ally allz
+		do
+			if [ "$name" == "FR R/S (ratio)" ] || [ "$name" == "CDR R/S (ratio)" ] ; then #meh
+				echo "<tr><td>$name</td><td>${cax}/${cay} (${caz})</td><td>${ca1x}/${ca1y} (${ca1z})</td><td>${ca2x}/${ca2y} (${ca2z})</td><td>${cgx}/${cgy} (${cgz})</td><td>${cg1x}/${cg1y} (${cg1z})</td><td>${cg2x}/${cg2y} (${cg2z})</td><td>${cg3x}/${cg3y} (${cg3z})</td><td>${cg4x}/${cg4y} (${cg4z})</td><td>${cmx}/${cmy} (${cmz})</td><td>${allx}/${ally} (${allz})</td><td>${unx}/${uny} (${unz})</td></tr>" >> $output
+			elif [ "$name" == "Median of Number of Mutations (%)" ] ; then
+				echo "<tr><td>$name</td><td>${caz}%</td><td>${ca1z}%</td><td>${ca2z}%</td><td>${cgz}%</td><td>${cg1z}%</td><td>${cg2z}%</td><td>${cg3z}%</td><td>${cg4z}%</td><td>${cmz}%</td><td>${allz}%</td><td>${unz}%</td></tr>" >> $output
+			else
+				echo "<tr><td>$name</td><td>${cax}/${cay} (${caz}%)</td><td>${ca1x}/${ca1y} (${ca1z}%)</td><td>${ca2x}/${ca2y} (${ca2z}%)</td><td>${cgx}/${cgy} (${cgz}%)</td><td>${cg1x}/${cg1y} (${cg1z}%)</td><td>${cg2x}/${cg2y} (${cg2z}%)</td><td>${cg3x}/${cg3y} (${cg3z}%)</td><td>${cg4x}/${cg4y} (${cg4z}%)</td><td>${cmx}/${cmy} (${cmz}%)</td><td>${allx}/${ally} (${allz}%)</td><td>${unx}/${uny} (${unz}%)</td></tr>" >> $output
+			fi
+		done < $outdir/data_${func}.txt
+		
+	else
+		tmp=`cat $outdir/unmatched_${func}_n.txt`
+		echo "<th><a href='matched_all_${func}.txt'>all (N = $tmp)</a></th>" >> $output
+		
+		while IFS=, read name cax cay caz ca1x ca1y ca1z ca2x ca2y ca2z cgx cgy cgz cg1x cg1y cg1z cg2x cg2y cg2z cg3x cg3y cg3z cg4x cg4y cg4z cmx cmy cmz unx uny unz allx ally allz
+		do
+			if [ "$name" == "FR R/S (ratio)" ] || [ "$name" == "CDR R/S (ratio)" ] ; then #meh
+				echo "<tr><td>$name</td><td>${unx}/${uny}</td></tr>" >> $output
+			elif [ "$name" == "Median of Number of Mutations (%)" ] ; then
+				echo "<tr><td>$name</td><td>${unz}%</td></tr>" >> $output
+			else
+				echo "<tr><td>$name</td><td>${unx}/${uny} (${unz}%)</td></tr>" >> $output
+			fi
+		done < $outdir/data_${func}.txt
+		
+	fi
+	echo "</table>" >> $output
+	#echo "<a href='data_${func}.txt'>Download data</a>" >> $output
+done
+
+echo "<img src='plot1.png' /><br />" >> $output
+echo "<img src='plot2.png' /><br />" >> $output
+echo "<img src='plot3.png' /><br />" >> $output
+
+echo "</div>" >> $output #SHM overview tab end
+
+echo "---------------- images ----------------"
+echo "---------------- images ----------------<br />" >> $log
+
+echo "<div class='tabbertab' title='SHM Frequency'>" >> $output
+
+if [ -a $outdir/scatter.png ]
+then
+	echo "<img src='scatter.png'/><br />" >> $output
+fi
+if [ -a $outdir/frequency_ranges.png ]
+then
+	echo "<img src='frequency_ranges.png'/><br />" >> $output
+fi
+
+echo "</div>" >> $output #SHM frequency tab end
+
+echo "<div class='tabbertab' title='Transition tables'>" >> $output
+
+echo "<table border='0'>" >> $output
+
+for gene in ${genes[@]}
+do
+	echo "<tr>" >> $output
+	echo "<td><h1>${gene}</h1></td>" >> $output
+	echo "<td><img src='transitions_heatmap_${gene}.png' /></td>" >> $output
+	echo "<td><img src='transitions_stacked_${gene}.png' /></td>" >> $output
+	echo "<td><table style='border-left-width: 1;' class='pure-table transition-table pure-table-bordered'>" >> $output
+	echo "<tr><td></td><td colspan="5"><center>To</center></td></tr>" >> $output
+	first="true"
+	while IFS=, read from a c g t
+		do
+			if [ "$first" == "true" ] ; then
+				echo "<tr><td rowspan='5'>From</td><td>$from</td><td>$a</td><td>$c</td><td>$g</td><td>$t</td></tr>" >> $output
+				first="false"
+			else
+				echo "<tr><td>$from</td><td>$a</td><td>$c</td><td>$g</td><td>$t</td></tr>" >> $output
+			fi
+	done < $outdir/transitions_${gene}_sum.txt
+	echo "</table></td>" >> $output
+	
+	echo "</tr>" >> $output
+done
+
+echo "<tr>" >> $output
+echo "<td><h1>All</h1></td>" >> $output
+echo "<td><img src='transitions_heatmap_all.png' /></td>" >> $output
+echo "<td><img src='transitions_stacked_all.png' /></td>" >> $output
+echo "<td><table style='border-left-width: 1;' class='pure-table transition-table pure-table-bordered'>" >> $output
+echo "<tr><td></td><td colspan="5"><center>To</center></td></tr>" >> $output
+first="true"
+while IFS=, read from a c g t
+	do
+		if [ "$first" == "true" ] ; then
+			echo "<tr><td rowspan='5'>From</td><td>$from</td><td>$a</td><td>$c</td><td>$g</td><td>$t</td></tr>" >> $output
+			first="false"
+		else
+			echo "<tr><td>$from</td><td>$a</td><td>$c</td><td>$g</td><td>$t</td></tr>" >> $output
+		fi
+done < $outdir/transitions_all_sum.txt
+echo "</table></td>" >> $output
+
+echo "</tr>" >> $output
+
+echo "</table>" >> $output
+
+echo "</div>" >> $output #transition tables tab end
+
+echo "<div class='tabbertab' title='Antigen Selection'>" >> $output
+
+if [ -a $outdir/aa_histogram.png ]
+then
+	echo "<img src='aa_histogram.png'/><br />" >> $output
+	echo "<img src='aa_histogram_IGA.png'/><br />" >> $output
+	echo "<img src='aa_histogram_IGG.png'/><br />" >> $output
+	echo "<img src='aa_histogram_IGM.png'/><br />" >> $output
+fi
+
+echo "<embed src='baseline.pdf' width='700px' height='1000px'>" >> $output
+echo "<embed src='baseline_IGA.pdf' width='700px' height='1000px'>" >> $output
+echo "<embed src='baseline_IGG.pdf' width='700px' height='1000px'>" >> $output
+echo "<embed src='baseline_IGM.pdf' width='700px' height='1000px'>" >> $output
+
+echo "</div>" >> $output #antigen selection tab end
+
+echo "<div class='tabbertab' title='CSR'>" >> $output #CSR tab
+
+if [ -a $outdir/IGA.png ] 
+then
+	echo "<img src='IGA.png'/><br />" >> $output
+fi
+if [ -a $outdir/IGG.png ]
+then
+	echo "<img src='IGG.png'/><br />" >> $output
+fi
+
+echo "</div>" >> $output #CSR tab end
+
+echo "---------------- change-o MakeDB ----------------"
+
+mkdir $outdir/change_o
+
+tmp="$PWD"
+
+cd $outdir/change_o
+
+bash $dir/change_o/makedb.sh $outdir/new_IMGT.txz false false false $outdir/change_o/change-o-db.txt
+bash $dir/change_o/define_clones.sh bygroup $outdir/change_o/change-o-db.txt gene first ham none min complete 3.0 $outdir/change_o/change-o-db-defined_clones.txt $outdir/change_o/change-o-defined_clones-summary.txt
+
+Rscript $dir/merge.r $outdir/change_o/change-o-db-defined_clones.txt $outdir/merged.txt "all" "Sequence.ID,best_match" "SEQUENCE_ID" "Sequence.ID" $outdir/change_o/change-o-db-defined_clones.txt 2>&1
+
+echo "Rscript $dir/merge.r $outdir/change_o/change-o-db-defined_clones.txt $outdir/$outdir/merged.txt 'all' 'Sequence.ID,best_match' 'Sequence.ID' 'Sequence.ID' '\t' $outdir/change_o/change-o-db-defined_clones.txt 2>&1"
+
+if [[ $(wc -l < $outdir/new_IMGT_IGA/1_Summary.txt) -gt "1" ]]; then
+	bash $dir/change_o/makedb.sh $outdir/new_IMGT_IGA.txz false false false $outdir/change_o/change-o-db-IGA.txt
+	bash $dir/change_o/define_clones.sh bygroup $outdir/change_o/change-o-db-IGA.txt gene first ham none min complete 3.0 $outdir/change_o/change-o-db-defined_clones-IGA.txt $outdir/change_o/change-o-defined_clones-summary-IGA.txt
+else
+	echo "No IGA sequences" > "$outdir/change_o/change-o-db-defined_clones-IGA.txt"
+	echo "No IGA sequences" > "$outdir/change_o/change-o-defined_clones-summary-IGA.txt"
+fi
+
+if [[ $(wc -l < $outdir/new_IMGT_IGG/1_Summary.txt) -gt "1" ]]; then
+	bash $dir/change_o/makedb.sh $outdir/new_IMGT_IGG.txz false false false $outdir/change_o/change-o-db-IGG.txt
+	bash $dir/change_o/define_clones.sh bygroup $outdir/change_o/change-o-db-IGG.txt gene first ham none min complete 3.0 $outdir/change_o/change-o-db-defined_clones-IGG.txt $outdir/change_o/change-o-defined_clones-summary-IGG.txt
+else
+	echo "No IGG sequences" > "$outdir/change_o/change-o-db-defined_clones-IGG.txt"
+	echo "No IGG sequences" > "$outdir/change_o/change-o-defined_clones-summary-IGG.txt"
+fi
+
+if [[ $(wc -l < $outdir/new_IMGT_IGM/1_Summary.txt) -gt "1" ]]; then
+	bash $dir/change_o/makedb.sh $outdir/new_IMGT_IGM.txz false false false $outdir/change_o/change-o-db-IGM.txt
+	bash $dir/change_o/define_clones.sh bygroup $outdir/change_o/change-o-db-IGM.txt gene first ham none min complete 3.0 $outdir/change_o/change-o-db-defined_clones-IGM.txt $outdir/change_o/change-o-defined_clones-summary-IGM.txt
+else
+	echo "No IGM sequences" > "$outdir/change_o/change-o-db-defined_clones-IGM.txt"
+	echo "No IGM sequences" > "$outdir/change_o/change-o-defined_clones-summary-IGM.txt"
+fi
+
+PWD="$tmp"
+
+echo "<div class='tabbertab' title='Clonality'>" >> $output #clonality tab
+
+function clonality_table {
+	local infile=$1
+	local outfile=$2
+	
+	echo "<table class='pure-table pure-table-striped'>" >> $outfile
+	echo "<thead><tr><th>Clone size</th><th>Nr of clones</th><th>Nr of sequences</th></tr></thead>" >> $outfile
+	
+	first='true'
+	
+	while read size clones seqs
+	do
+		if [[ "$first" == "true" ]]; then
+			first="false"
+			continue
+		fi
+		echo "<tr><td>$size</td><td>$clones</td><td>$seqs</td></tr>" >> $outfile
+	done < $infile
+	
+	echo "</table>" >> $outfile
+}
+echo "<div class='tabber'>" >> $output
+
+echo "<div class='tabbertab' title='All'>" >> $output
+clonality_table $outdir/change_o/change-o-defined_clones-summary.txt $output
+echo "</div>" >> $output
+
+echo "<div class='tabbertab' title='Ca'>" >> $output
+clonality_table $outdir/change_o/change-o-defined_clones-summary-IGA.txt $output
+echo "</div>" >> $output
+
+echo "<div class='tabbertab' title='Cg'>" >> $output
+clonality_table $outdir/change_o/change-o-defined_clones-summary-IGG.txt $output
+echo "</div>" >> $output
+
+echo "<div class='tabbertab' title='Cm'>" >> $output
+clonality_table $outdir/change_o/change-o-defined_clones-summary-IGM.txt $output
+echo "</div>" >> $output
+
+echo "<div class='tabbertab' title='Overview'>" >> $output
+cat "$outdir/sequence_overview/index.html" >> $output
+echo "</div>" >> $output
+
+
+echo "</div>" >> $output #clonality tabber end
+
+echo "</div>" >> $output #clonality tab end
+
+echo "<div class='tabbertab' title='Downloads'>" >> $output
+
+echo "<table class='pure-table pure-table-striped'>" >> $output
+echo "<thead><tr><th>info</th><th>link</th></tr></thead>" >> $output
+echo "<tr><td>The complete dataset</td><td><a href='merged.txt' download='merged.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The filtered dataset</td><td><a href='filtered.txt' download='filtered.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The SHM Overview table as a dataset</td><td><a href='data_sum.txt' download='data_sum.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The data used to generate the first SHM Overview plot</td><td><a href='plot1.txt' download='plot1.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The data used to generate the second SHM Overview plot</td><td><a href='plot2.txt' download='plot2.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The data used to generate the third SHM Overview plot</td><td><a href='plot3.txt' download='plot3.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The alignment info on the unmatched sequences</td><td><a href='unmatched.txt' download='unmatched.txt' >Download</a></td></tr>" >> $output
+
+echo "<tr><td>The data  generate the frequency scatter plot</td><td><a href='scatter.txt' download='scatter.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The data used to generate the frequency by class plot</td><td><a href='frequency_ranges_classes.txt' download='frequency_ranges_classes.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The data for frequency by subclass</td><td><a href='frequency_ranges_subclasses.txt' download='frequency_ranges_subclasses.txt' >Download</a></td></tr>" >> $output
+
+
+echo "<tr><td>Motif data per sequence ID</td><td><a href='motif_per_seq.txt' download='motif_per_seq.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>Mutation data per sequence ID</td><td><a href='mutation_by_id.txt' download='mutation_by_id.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>AA mutation data per sequence ID</td><td><a href='aa_id_mutations.txt' download='aa_id_mutations.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>Absent AA location data per sequence ID</td><td><a href='absent_aa_id.txt' download='absent_aa_id.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>CDR1+FR2+CDR2+FR3+CDR3 sequences that show up more than once</td><td><a href='sequence_overview/index.html'>View</a></td></tr>" >> $output
+
+echo "<tr><td>Base count for every sequence</td><td><a href='base_overview.html'>View</a></td></tr>" >> $output
+
+echo "<tr><td>Baseline PDF (<a href='http://selection.med.yale.edu/baseline/'>http://selection.med.yale.edu/baseline/</a>)</td><td><a href='baseline.pdf' download='baseline.pdf' >Download</a></td></tr>" >> $output
+echo "<tr><td>Baseline data</td><td><a href='baseline.txt' download='baseline.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>Baseline IGA PDF</td><td><a href='baseline_IGA.pdf' download='baseline_IGA.pdf' >Download</a></td></tr>" >> $output
+echo "<tr><td>Baseline IGA data</td><td><a href='baseline_IGA.txt' download='baseline_IGA.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>Baseline IGG PDF</td><td><a href='baseline_IGG.pdf' download='baseline_IGG.pdf' >Download</a></td></tr>" >> $output
+echo "<tr><td>Baseline IGG data</td><td><a href='baseline_IGG.txt' download='baseline_IGG.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>Baseline IGM PDF</td><td><a href='baseline_IGM.pdf' download='baseline_IGM.pdf' >Download</a></td></tr>" >> $output
+echo "<tr><td>Baseline IGM data</td><td><a href='baseline_IGM.txt' download='baseline_IGM.txt' >Download</a></td></tr>" >> $output
+
+echo "<tr><td>An IMGT archive with just the matched and filtered sequences</td><td><a href='new_IMGT.txz' download='new_IMGT.txz' >Download</a></td></tr>" >> $output
+echo "<tr><td>An IMGT archive with just the matched and filtered IGA sequences</td><td><a href='new_IMGT_IGA.txz' download='new_IMGT_IGA.txz' >Download</a></td></tr>" >> $output
+echo "<tr><td>An IMGT archive with just the matched and filtered IGA1 sequences</td><td><a href='new_IMGT_IGA1.txz' download='new_IMGT_IGA1.txz' >Download</a></td></tr>" >> $output
+echo "<tr><td>An IMGT archive with just the matched and filtered IGA2 sequences</td><td><a href='new_IMGT_IGA2.txz' download='new_IMGT_IGA2.txz' >Download</a></td></tr>" >> $output
+echo "<tr><td>An IMGT archive with just the matched and filtered IGG sequences</td><td><a href='new_IMGT_IGG.txz' download='new_IMGT_IGG.txz' >Download</a></td></tr>" >> $output
+echo "<tr><td>An IMGT archive with just the matched and filtered IGG1 sequences</td><td><a href='new_IMGT_IGG1.txz' download='new_IMGT_IGG1.txz' >Download</a></td></tr>" >> $output
+echo "<tr><td>An IMGT archive with just the matched and filtered IGG2 sequences</td><td><a href='new_IMGT_IGG2.txz' download='new_IMGT_IGG2.txz' >Download</a></td></tr>" >> $output
+echo "<tr><td>An IMGT archive with just the matched and filtered IGG3 sequences</td><td><a href='new_IMGT_IGG3.txz' download='new_IMGT_IGG3.txz' >Download</a></td></tr>" >> $output
+echo "<tr><td>An IMGT archive with just the matched and filtered IGG4 sequences</td><td><a href='new_IMGT_IGG4.txz' download='new_IMGT_IGG4.txz' >Download</a></td></tr>" >> $output
+echo "<tr><td>An IMGT archive with just the matched and filtered IGM sequences</td><td><a href='new_IMGT_IGM.txz' download='new_IMGT_IGM.txz' >Download</a></td></tr>" >> $output
+
+echo "<tr><td>The Change-O DB file with defined clones and subclass annotation</td><td><a href='change_o/change-o-db-defined_clones.txt' download='change_o/change-o-db-defined_clones.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The Change-O DB defined clones summary file</td><td><a href='change_o/change-o-defined_clones-summary.txt' download='change_o/change-o-defined_clones-summary.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The Change-O DB file with defined clones of IGA</td><td><a href='change_o/change-o-db-defined_clones-IGA.txt' download='change_o/change-o-db-defined_clones-IGA.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The Change-O DB defined clones summary file of IGA</td><td><a href='change_o/change-o-defined_clones-summary-IGA.txt' download='change_o/change-o-defined_clones-summary-IGA.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The Change-O DB file with defined clones of IGG</td><td><a href='change_o/change-o-db-defined_clones-IGG.txt' download='change_o/change-o-db-defined_clones-IGG.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The Change-O DB defined clones summary file of IGG</td><td><a href='change_o/change-o-defined_clones-summary-IGG.txt' download='change_o/change-o-defined_clones-summary-IGG.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The Change-O DB file with defined clones of IGM</td><td><a href='change_o/change-o-db-defined_clones-IGM.txt' download='change_o/change-o-db-defined_clones-IGM.txt' >Download</a></td></tr>" >> $output
+echo "<tr><td>The Change-O DB defined clones summary file of IGM</td><td><a href='change_o/change-o-defined_clones-summary-IGM.txt' download='change_o/change-o-defined_clones-summary-IGM.txt' >Download</a></td></tr>" >> $output
+
+echo "</table>" >> $output
+
+echo "</div>" >> $output #downloads tab end
+
+echo "</div>" >> $output #tabs end 
+
+echo "</html>" >> $output
+
+echo "---------------- baseline ----------------"
+echo "---------------- baseline ----------------<br />" >> $log
+tmp="$PWD"
+
+mkdir $outdir/baseline
+
+
+mkdir $outdir/baseline/IGA_IGG_IGM
+if [[ $(wc -l < $outdir/new_IMGT/1_Summary.txt) -gt "1" ]]; then
+	cd $outdir/baseline/IGA_IGG_IGM
+	bash $dir/baseline/wrapper.sh 1 1 1 1 0 0 "25:26:38:55:65:104:-" $outdir/new_IMGT.txz "IGA_IGG_IGM" "$dir/baseline/IMGT-reference-seqs-IGHV-2015-11-05.fa" "$outdir/baseline.pdf" "Sequence.ID" "$outdir/baseline.txt"	
+else
+	echo "No sequences" > "$outdir/baseline.txt"
+fi
+
+mkdir $outdir/baseline/IGA
+if [[ $(wc -l < $outdir/new_IMGT_IGA/1_Summary.txt) -gt "1" ]]; then
+	cd $outdir/baseline/IGA
+	bash $dir/baseline/wrapper.sh 1 1 1 1 0 0 "25:26:38:55:65:104:-" $outdir/new_IMGT_IGA.txz "IGA" "$dir/baseline/IMGT-reference-seqs-IGHV-2015-11-05.fa" "$outdir/baseline_IGA.pdf" "Sequence.ID" "$outdir/baseline_IGA.txt"
+else
+	echo "No IGA sequences" > "$outdir/baseline_IGA.txt"
+fi
+
+mkdir $outdir/baseline/IGG
+if [[ $(wc -l < $outdir/new_IMGT_IGG/1_Summary.txt) -gt "1" ]]; then
+	cd $outdir/baseline/IGG
+	bash $dir/baseline/wrapper.sh 1 1 1 1 0 0 "25:26:38:55:65:104:-" $outdir/new_IMGT_IGG.txz "cg" "$dir/baseline/IMGT-reference-seqs-IGHV-2015-11-05.fa" "$outdir/baseline_IGG.pdf" "Sequence.ID" "$outdir/baseline_IGG.txt"
+else
+	echo "No IGG sequences" > "$outdir/baseline_IGG.txt"
+fi
+
+mkdir $outdir/baseline/IGM
+if [[ $(wc -l < $outdir/new_IMGT_IGM/1_Summary.txt) -gt "1" ]]; then
+	cd $outdir/baseline/IGM
+	bash $dir/baseline/wrapper.sh 1 1 1 1 0 0 "25:26:38:55:65:104:-" $outdir/new_IMGT_IGM.txz "IGM" "$dir/baseline/IMGT-reference-seqs-IGHV-2015-11-05.fa" "$outdir/baseline_IGM.pdf" "Sequence.ID" "$outdir/baseline_IGM.txt"
+else
+	echo "No IGM sequences" > "$outdir/baseline_IGM.txt"
+fi
+
+cd $tmp
+
+echo "---------------- naive_output.r ----------------"
+echo "---------------- naive_output.r ----------------<br />" >> $log
+
+if [[ "$naive_output" != "None" ]]
+then
+	cp $outdir/new_IMGT_IGA.txz ${naive_output_ca}
+	cp $outdir/new_IMGT_IGG.txz ${naive_output_cg}
+	cp $outdir/new_IMGT_IGM.txz ${naive_output_cm}
+fi
+
+echo "</table>" >> $outdir/base_overview.html
+
+mv $log $outdir/log.html
+
+echo "<html><center><h1><a href='index.html'>Click here for the results</a></h1>Tip: Open it in a new tab (middle mouse button or right mouse button -> 'open in new tab' on the link above)<br />" > $log
+echo "<table border = 1>" >> $log
+echo "<thead><tr><th>Info</th><th>Sequences</th><th>Percentage</th></tr></thead>" >> $log
+tIFS="$TMP"
+IFS=$'\t'
+while read step seq perc
+	do
+		echo "<tr>" >> $log
+		echo "<td>$step</td>" >> $log
+		echo "<td>$seq</td>" >> $log
+		echo "<td>${perc}%</td>" >> $log
+		echo "</tr>" >> $log
+done < $outdir/filtering_steps.txt
+echo "</table border></center></html>" >> $log
+
+IFS="$tIFS"
+
+
+echo "---------------- Done! ----------------"
+echo "---------------- Done! ----------------<br />" >> $outdir/log.html
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+