Mercurial > repos > dereeper > haplophyle
view Haplophyle.xml @ 0:6f11162b6fa2 draft
planemo upload commit 11382afe87364aaafb19973470d5066229a6e34f
author | dereeper |
---|---|
date | Tue, 14 Aug 2018 08:04:23 -0400 |
parents | |
children | d6281dc90e20 |
line wrap: on
line source
<tool id="haplophyle" name="Haplophyle" version="1.0.0"> <!-- [REQUIRED] Tool description displayed after the tool name --> <description>Generates haplotype network</description> <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work --> <requirements> <requirement type="binary">perl</requirement> <requirement type="package" version="1.6.924">perl-bioperl</requirement> </requirements> <!-- [STRONGLY RECOMMANDED] Exit code rules --> <stdio> <!-- [HELP] If no exit code rule is defined, the tool will stop if anything is written to STDERR --> <exit_code range="1:" level="fatal" /> </stdio> <!-- [REQUIRED] The command to execute --> <command interpreter="perl"> Haplophyle.sh $input $fileout $dotfile $filelog #if str( $color.choice ) == "yes": $color.input2 $color.groups #end if </command> <!-- [REQUIRED] Input files and tool parameters --> <inputs> <param name="input" type="data" format="fasta" optional="false" label="Haplotype sequences in Fasta" /> <conditional name="color"> <param name="choice" type="boolean" truevalue="yes" falsevalue="no" label="Group colorization?"/> <when value="no"> </when> <when value="yes"> <param name="input2" type="data" format="txt" optional="true" label="Haplotype sequences and individuals carrying the haplotype" help="See example below"/> <param name="groups" type="data" format="txt" optional="true" label="Groups" help="Semicolon separated file (ind;group)"/> </when> </conditional> </inputs> <!-- [REQUIRED] Output files --> <outputs> <data name="fileout" format="json" label="JSON for Cytoscape" /> <data name="dotfile" format="txt" label="Dot file" /> <data name="filelog" format="txt" label="Logfile" /> </outputs> <!-- [OPTIONAL] Tests to be run manually by the Galaxy admin --> <tests> <!-- [HELP] Test files have to be in the ~/test-data directory --> <test> <param name="input" value="haplotype.fasta" /> <conditional name="color"> <param name="choice" value="yes" /> <param name="input2" value="haplotype.txt" /> <!--param name="groups" value="" /--> </conditional> <output name="fileout" file="output.json" compare="sim_size" delta="0"/> <output name="dotfile" file="dotfile.txt" compare="sim_size" delta="0"/> </test> <test> <param name="input" value="haplotype.fasta" /> <conditional name="color"> <param name="choice" value="no" /> </conditional> <output name="fileout" file="output.json" compare="sim_size" delta="20" /> <output name="dotfile" file="dotfile.txt" compare="sim_size" delta="0" /> </test> </tests> <!-- [OPTIONAL] Help displayed in Galaxy --> <help><![CDATA[ .. class:: infomark **Authors** Gautier Sarah : Haplophyle_ .. _Haplophyle: http://haplophyle.cirad.fr/Haplophyle/ .. class:: infomark **Galaxy integration** Provided by Southgreen & Dereeper Alexis (IRD) & Marcon Valentin (IFB & INRA) .. class:: infomark **Support** For any questions about Galaxy integration, please send an e-mail to alexis.dereeper@ird.fr --------------------------------------------------- ================ Haplophyle ================ ----------- Description ----------- | Create haplotype network from haplotype sequences ---------- Input file ---------- Haplotype fasta file Haplotype fasta file with haplotype sequences and proportion Haplotype sequences and their individuals Haplotype sequences and list of individuals holding the haplotype Groups ------------ Output files ------------ JSON file for Cytoscape Dot file Log file --------------------------------------------------- --------------- Working example --------------- Input files =========== Haplotype fasta file ---------------------------- :: >haplo1|1 AGAGGCCCATT >haplo2|1 CGAGGTCCATT >haplo3|1 CGGAGCCCATT >haplo4|2 AGAGGTCTATT >haplo5|1 CGAGGTCTATT >haplo6|7 AGAGGTCCATT >haplo7|3 CAAGATCCATC >haplo8|1 CGAGGTTCATT >haplo9|1 CGGAGCCCGTT >haplo10|1 CGAGGCCCATT >haplo11|1 AGAGGTTCATT >haplo12|38 CAAGGTCCATT >haplo13|3 CAAGGTCCACT >haplo14|1 AGGAGCCCATT Haplotype sequences and their individuals ---------------------------------------------- :: haplo4:2:RS10_1,RS10_2, GAGTGGGTTGCTTCCTTGCGTAGCCATCCGCCAACGACTGT haplo5:2:RC3_1,RC3_2, AGGTATACTGCCTGCTCGCGTAGTCAGCCGCCGACGGCTGG haplo6:2:RS8_1,RS8_2, GAGTGGGTTGCTTCCTTGCGTAGCCATCCACCAACGACTGT haplo7:2:sativa_1,sativa_2, GAGTGGGCTGCTTCCTCGCGTAGTCAGCCGCCGACAGCTGG Output files ============ output.json ---------------------------- :: {"elements": {"nodes": [{ "data": { "id": "MV1", "width": 0.1} }, { "data": { "id": "MV2", "width": 0.1} }, { "data": { "id": "MV3", "width": 0.1} }, { "data": { "id": "haplo6", "width": 0.8 } }, { "data": { "id": "haplo7", "width": 0.8 } }, { "data": { "id": "haplo8", "width": 0.8 } }], "edges": [ { "data": { "id": "haplo4MV1", "weight": 1, "source": "haplo4", "target": "MV1"} }, { "data": { "id": "haplo3haplo4", "weight": 1, "source": "haplo3", "target": "haplo4"} }, { "data": { "id": "haplo5MV3", "weight": 1, "source": "haplo5", "target": "MV3"} }, { "data": { "id": "MV1MV2", "weight": 1, "source": "MV1", "target": "MV2"} }, { "data": { "id": "haplo8MV3", "weight": 1, "source": "haplo8", "target": "MV3"} }]}} dotfile.txt ---------------------------- :: graph G { overlap="scale"; outputMode="nodesfirst"; MV1 [shape="circle", color="red", width=0.1, height=0.1,fixedsize=true]; MV2 [shape="circle", color="red", width=0.1, height=0.1,fixedsize=true]; haplo2 [shape="circle",style="filled", color="green" , imagescale="both", width=0.8, height=0.8,fixedsize=true]; haplo4 [shape="circle",style="filled", color="green" , imagescale="both", width=0.8, height=0.8,fixedsize=true]; haplo8 [shape="circle",style="filled", color="green" , imagescale="both", width=0.8, height=0.8,fixedsize=true]; haplo7 -- MV2 [len=0.2]; haplo1 -- haplo2 [len=0.2]; haplo4 -- MV1 [len=0.2]; MV2 -- MV3 [len=0.6]; haplo5 -- MV3 [len=0.8]; haplo8 -- MV3 [len=1,label="length: 24.0",color="red"]; } ]]></help> </tool>