Mercurial > repos > dereeper > readseq
view readseq.xml @ 1:36e5445b7807 draft
Uploaded
author | dereeper |
---|---|
date | Tue, 08 Jan 2019 10:14:18 -0500 |
parents | 225031d5c818 |
children |
line wrap: on
line source
<tool id="sniplay_readseq" name="Readseq" version="2.0.0"> <!-- [REQUIRED] Tool description displayed after the tool name --> <description> Convert various alignment formats </description> <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work --> <requirements> <requirement type="binary">perl</requirement> <requirement type="package" version="2.1.30">readseq</requirement> </requirements> <!-- [STRONGLY RECOMMANDED] Exit code rules --> <stdio> <!-- [HELP] If no exit code rule is defined, the tool will stop if anything is written to STDERR --> <exit_code range="1:" level="fatal" /> </stdio> <!-- [REQUIRED] The command to execute --> <command> java -jar /home/galaxy/data/jars/readseq.jar $filein -f $format >> $fileout_log 2>&1 && #if str( $format ) == "1": mv ${filein}.ig $fileout #elif str( $format ) == "2" : mv ${filein}.gb $fileout #elif str( $format ) == "3" : mv ${filein}.nbrf $fileout #elif str( $format ) == "4" : mv ${filein}.embl $fileout #elif str( $format ) == "5" : mv ${filein}.gcg $fileout #elif str( $format ) == "6" : mv ${filein}.strider $fileout #elif str( $format ) == "8" : mv ${filein}.fasta $fileout #elif str( $format ) == "11" : mv ${filein}.phylip2 $fileout #elif str( $format ) == "12" : perl $__tool_directory__/complete_names.pl ${filein} ${filein}.phylip $fileout #elif str( $format ) == "13" : mv ${filein}.seq $fileout #elif str( $format ) == "14" : mv ${filein}.pir $fileout #elif str( $format ) == "15" : mv ${filein}.msf $fileout #elif str( $format ) == "17" : mv ${filein}.nexus $fileout #elif str( $format ) == "18" : mv ${filein}.pretty $fileout #elif str( $format ) == "19" : mv ${filein}.xml $fileout #elif str( $format ) == "22" : mv ${filein}.aln $fileout #elif str( $format ) == "25" : mv ${filein}.ace $fileout #end if </command> <!-- [REQUIRED] Input files and tool parameters --> <inputs> <param name="filein" type="data" format="fasta" optional="false" label="Fasta alignment input" /> <param name="fileout_label" type="text" value="phylip conversion" label="Output name" help="Output name for files" /> <param name="format" type="select" label="Output format" > <option value="1">1.IG|Stanford</option> <option value="2">2.GenBank|gb</option> <option value="3">3.NBRF</option> <option value="4">4.EMBL|em</option> <option value="5">5.GCG</option> <option value="6">6.DNAStrider</option> <option value="8">8.Pearson|Fasta|fa</option> <option value="11">11.Phylip3.2</option> <option value="12" selected="true">12.Phylip|Phylip4</option> <option value="13">13.Plain|Raw</option> <option value="14">14.PIR|CODATA</option> <option value="15">15.MSF</option> <option value="17">17.PAUP|NEXUS</option> <option value="18">18.Pretty</option> <option value="19">19.XML</option> <option value="22">22.Clustal</option> <option value="25">25.ACEDB</option> </param> </inputs> <!-- [REQUIRED] Output files --> <outputs> <data name="fileout_log" format="txt" label="${fileout_label}.log" /> <data name="fileout" format="txt" label="${fileout_label}" > <change_format> <when input="format" value="1" format="ig" /> <when input="format" value="2" format="genbank" /> <when input="format" value="4" format="embl" /> <when input="format" value="5" format="gcg" /> <when input="format" value="6" format="strider" /> <when input="format" value="8" format="fasta" /> <when input="format" value="11" format="phylip" /> <when input="format" value="12" format="phylip" /> <when input="format" value="14" format="pir" /> <when input="format" value="17" format="nexus" /> <when input="format" value="18" format="prettyseq" /> <when input="format" value="19" format="xml" /> <when input="format" value="22" format="clustal" /> <when input="format" value="25" format="acedb" /> </change_format> </data> </outputs> <!-- [OPTIONAL] Tests to be run manually by the Galaxy admin --> <tests> <!-- [HELP] Test files have to be in the ~/test-data directory --> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="1" /> <output name="fileout" file="readseq-standford" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="2" /> <output name="fileout" file="readseq-GenBank" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="3" /> <output name="fileout" file="readseq-NBRF" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="4" /> <output name="fileout" file="readseq-EMBL" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="5" /> <assert_command> <has_text text="-f 5" /> <has_text text=".gcg" /> </assert_command> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="6" /> <output name="fileout" file="readseq-DNAStrider" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="8" /> <output name="fileout" file="readseq-Pearson" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="11" /> <output name="fileout" file="readseq-phylip32" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="12" /> <output name="fileout" file="readseq-phylip" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="13" /> <output name="fileout" file="readseq-raw" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="14" /> <output name="fileout" file="readseq-PIR" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="15" /> <output name="fileout" file="readseq-MSF.txt" lines_diff="2" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="17" /> <output name="fileout" file="readseq-NEXUS" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="18" /> <output name="fileout" file="readseq-Pretty" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="19" /> <output name="fileout" file="readseq-XML" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="22" /> <output name="fileout" file="readseq-Clustal" /> </test> <test> <param name="filein" value="readseq-alignment.fa" /> <param name="format" value="25" /> <output name="fileout" file="readseq-ACEDB" /> </test> </tests> <!-- [OPTIONAL] Help displayed in Galaxy --> <help><![CDATA[ .. class:: infomark **Authors** Don Gilbert software@bio.indiana.edu | **Please cite** If you use this tool, please cite Don Gilbert software@bio.indiana.edu .. class:: infomark **Galaxy integration** Provided by Southgreen & Andres Gwendoline (Institut Français de Bioinformatique) & Marcon Valentin (IFB & INRA) .. class:: infomark **Support** For any questions about Galaxy integration, please send an e-mail to alexis.dereeper@ird.fr --------------------------------------------------- ======= Readseq ======= ----------- Description ----------- | Compute a phylip tree from a fasta alignment. ------------ Dependencies ------------ ReadSeq readseq_ 2.1.30, Conda version .. _readseq: https://anaconda.org/bioconda/readseq ---------- Input file ---------- Fasta file The input data file contains sequence alignment(s) --------- Parameter --------- Output name Output base name for the ouput files ------------ Output files ------------ Output_name Resulting tree in phylip format Output_name.log Log file --------------------------------------------------- --------------- Working example --------------- Input file ========== Fasta file ----------- :: >IRAT112 GAGAACCGTCCTGTAAGTACTCTTGCTTTAAGTAATAAAGTAATACTAATCCATGACGCTTAAGTCGAAGAGAGAATAAGTCAATATTTAATTGGACTCATCGCTTATTATCATTATGAATCAATAAACAACTTGATGTTGTGCTCCATGTACGATATATAAAGACAGATA >KARASUKARASURANKASU GAGAACCGTCCTGTAAGTACTCTTGCTTTAAATACGAAAGTAATACTAATCCATGACGCTTAAGTCGAAGAGAGAATAAGTCAATATTTAATTGGACTCATCGCTTATGTTCATCATGAATCTATAGTTAACTTGATGTTGTGCTCCATGTACGATATAAAAAGTTAGATA Parameters ========== Output name -> phylip conversion Output file =========== phylip conversion ----------------- :: 168 5125 IRAT112 GAGAACCGTC CTGTAAGTAC TCTTGCTTTA AGTAATAAAG TAATACTAAT KARASUKARA GAGAACCGTC CTGTAAGTAC TCTTGCTTTA AATACGAAAG TAATACTAAT ]]></help> <citations> <citation type="doi" >10.1002/0471250953.bia01es00</citation> </citations> </tool>