Mercurial > repos > dereeper > sniplay
comparison AnnotationStatsFromVCF/annotationStatsFromVCF_wrapper.xml @ 10:c6640c49fd01 draft
planemo upload commit 475f4d7d8442a0d75e103af326ae5881c4d2a4ac
author | dereeper |
---|---|
date | Mon, 16 Apr 2018 09:00:24 -0400 |
parents | 98c37a5d67f4 |
children |
comparison
equal
deleted
inserted
replaced
9:98c37a5d67f4 | 10:c6640c49fd01 |
---|---|
1 <tool id="annotationStatsFromVCF" name="Get annotation statistics" version="1.0.0"> | 1 <tool id="annotationStatsFromVCF" name="Get VCF annotation statistics" version="2.0.0"> |
2 <description> from VCF file </description> | 2 <description>Get annotation fromi a VCF file annotated by snpeff</description> |
3 <requirements> | 3 <requirements> |
4 <requirement type="binary">perl</requirement> | 4 <requirement type="binary">perl</requirement> |
5 <requirement type="package" version="0.1.12b">vcftools</requirement> | 5 <requirement type="package" version="1.6.924">perl-bioperl</requirement> |
6 <requirement type="package" version="0.1.14">vcftools</requirement> | |
6 </requirements> | 7 </requirements> |
7 <stdio> | 8 <stdio> |
8 <exit_code range="1:" /> | 9 <exit_code range="1:" /> |
9 </stdio> | 10 </stdio> |
10 <command interpreter="perl"> | 11 <command interpreter="perl"> |
11 AnnotationStatsFromVCF.pl -v $input -o $output_label -s $step && mv ${output_label} $output_count && mv ${output_label}.effect $output_stats_effect && mv ${output_label}.location $output_stats_location | 12 AnnotationStatsFromVCF.pl -v $input -o $output_label -s $step && mv ${output_label} $output_count && mv ${output_label}.effect $output_stats_effect && mv ${output_label}.location $output_stats_location |
12 </command> | 13 </command> |
13 <inputs> | 14 <inputs> |
14 <param type="data" name="input" format="vcf" label="VCF file" /> | 15 <param type="data" name="input" format="vcf" label="VCF file" /> |
15 <param type="text" name="output_label" label="Output_label" value='VCF_stats' /> | 16 <param name="step" type="integer" value="200000" label="Step" help="Step in bp"/> |
17 <param type="text" name="output_label" label="Output_label" value='VCF_stats' optional='false' /> | |
16 </inputs> | 18 </inputs> |
17 <outputs> | 19 <outputs> |
18 <data name="output_count" format="txt" label="${output_label}."/> | 20 <data name="output_count" format="txt" label="${output_label}"/> |
19 <data name="output_stats_effect" format="txt" label="${output_label}."/> | 21 <data name="output_stats_effect" format="txt" label="${output_label}.effect"/> |
20 <data name="output_stats_location" format="txt" label="${output_label}."/> | 22 <data name="output_stats_location" format="txt" label="${output_label}.location"/> |
21 </outputs> | 23 </outputs> |
22 <tests> | 24 <tests> |
23 <test> | 25 <test> |
24 <param name="input" value="vcf2fastaAndHapmap-sample.vcf"/> | 26 <param name="input" value="annotationStatsFromVCF.vcf"/> |
25 <output name="output_count" file="vcf2fastaAndHapmap-sample.vcf"/> | 27 <param name="step" value="50000"/> |
26 <output name="output_stats_effect" file="vcf2fastaAndHapmap-sample.vcf"/> | 28 <output name="output_count" file="annotationStatsFromVCF.txt"/> |
27 <output name="output_stats_location" file="vcf2fastaAndHapmap-sample.vcf"/> | 29 <output name="output_stats_effect" file="annotationStatsFromVCF.effect"/> |
30 <output name="output_stats_location" file="annotationStatsFromVCF.location"/> | |
28 </test> | 31 </test> |
29 </tests> | 32 </tests> |
30 <help><![CDATA[ | 33 <help><![CDATA[ |
31 | 34 |
32 .. class:: infomark | 35 .. class:: infomark |
35 | 38 |
36 | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1). | 39 | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1). |
37 | 40 |
38 .. class:: infomark | 41 .. class:: infomark |
39 | 42 |
40 **Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique. | 43 **Galaxy integration** Provided by Southgreen & Andres Gwendoline (Institut Français de Bioinformatique) & Marcon Valentin (IFB & INRA) |
41 | 44 |
42 .. class:: infomark | 45 .. class:: infomark |
43 | 46 |
44 **Support** For any questions, please send an e-mail to support.abims@sb-roscoff.fr | 47 **Support** For any questions about Galaxy integration, please send an e-mail to alexis.dereeper@ird.fr |
45 | 48 |
46 --------------------------------------------------- | 49 --------------------------------------------------- |
47 | 50 |
48 ============================== | 51 ========================= |
49 Get Haplotypes From Phased VCF | 52 Get annotation statistics |
50 ============================== | 53 ========================= |
51 | 54 |
52 ----------- | 55 ----------- |
53 Description | 56 Description |
54 ----------- | 57 ----------- |
55 | 58 |
56 | Get Haplotype from phased VCF | 59 | Get annotation statistics from VCF |
57 | 60 |
58 ----------------- | 61 ------------ |
59 Workflow position | 62 Dependencies |
60 ----------------- | 63 ------------ |
64 VCFtools | |
65 vcftools_ 0.1.14, Conda version | |
66 Bioperl | |
67 perl-bioperl_ 1.6.924, Conda version | |
61 | 68 |
62 **Upstream tool** | 69 .. _vcftools: https://anaconda.org/bioconda/vcftools |
63 | 70 .. _perl-bioperl: https://anaconda.org/bioconda/perl-bioperl |
64 =============== ========================== ======= | |
65 Name output file(s) format | |
66 =============== ========================== ======= | |
67 Beagle Phased VCF file VCF | |
68 =============== ========================== ======= | |
69 | |
70 | |
71 **Downstream tool** | |
72 | |
73 =============== ========================== =========== | |
74 Name input file(s) format | |
75 =============== ========================== =========== | |
76 =============== ========================== =========== | |
77 | |
78 | 71 |
79 ---------- | 72 ---------- |
80 Input file | 73 Input file |
81 ---------- | 74 ---------- |
82 | 75 |
83 VCF file | 76 VCF file |
84 Phased VCF file | 77 VCF file |
85 | 78 |
86 ---------- | 79 ---------- |
87 Parameters | 80 Parameters |
88 ---------- | 81 ---------- |
89 | 82 |
90 Output file basename | 83 Step |
91 Prefix for the output VCF file | 84 Step in bp |
85 | |
86 Output label | |
87 Prefix for the ouput files | |
92 | 88 |
93 ------------ | 89 ------------ |
94 Output files | 90 Output files |
95 ------------ | 91 ------------ |
96 | 92 |
93 Output_name | |
97 | 94 |
98 Text file | 95 Output_name.effect file |
99 File describing haplotypes | |
100 | 96 |
101 Fasta file | 97 Output_name.location file |
102 Fasta file with haplotypes | |
103 | 98 |
104 --------------------------------------------------- | 99 --------------------------------------------------- |
105 | 100 |
106 --------------- | 101 --------------- |
107 Working example | 102 Working example |
108 --------------- | 103 --------------- |
109 | 104 |
110 Input files | 105 Input file |
111 =========== | 106 ========== |
112 | 107 |
113 VCF file | 108 VCF file |
114 --------- | 109 --------- |
115 | 110 |
116 :: | 111 :: |
124 | 119 |
125 | 120 |
126 Parameters | 121 Parameters |
127 ========== | 122 ========== |
128 | 123 |
129 Output name -> haplotypes | 124 Step -> 50000 |
125 Output label -> VCF_stats | |
130 | 126 |
131 | 127 |
132 Output files | 128 Output files |
133 ============ | 129 ============ |
134 | 130 |
135 haplotypes.distinct_haplotypes.txt | 131 VCF_stats |
136 ---------------------------------- | 132 ---------------------------------- |
137 | 133 |
138 :: | 134 :: |
139 | 135 |
140 ===Chr10=== | 136 Chrom Bin dN/dS ratio |
141 haplo1:2:CIRAD403_1,CIRAD403_2, | 137 chr1 50000 0.791666666666667 |
142 TTTAAGAAATTCCTATATAGGTCTTCTAAGCGTATCTATTAACAT | 138 chr1 100000 0.981132075471698 |
143 haplo2:2:MAHAE_1,MAHAE_2, | 139 chr1 150000 2.08333333333333 |
144 TAAATCTTGGTGCTGATCTGATATTTAATGCGT | |
145 | 140 |
146 | 141 |
147 haplotypes.haplo.fas | 142 VCF_stats.effect |
148 -------------------- | 143 -------------------- |
149 | 144 |
150 :: | 145 :: |
151 | 146 |
152 >Chr10_AZUCENA_1 | 147 Intron 960 Intron:960 |
153 TTTAAGAAATTCCTATATAGGTCTTCTAAGCGTATCTATTAACAT | 148 UTR 281 UTR:281 |
154 >Chr10_AZUCENA_2 | 149 Exon 3248 Synonym:124 Non-syn:120 |
155 TAAATCTTGGTGCTGATCTGATATTTAATGCGT | 150 |
151 VCF_stats.location | |
152 -------------------- | |
153 | |
154 :: | |
155 | |
156 Intergenic 466 Intergenic:466 | |
157 Genic 4489 Exon:3248 Intron:960 UTR:281 | |
158 | |
156 | 159 |
157 ]]></help> | 160 ]]></help> |
158 <citations> | 161 <citations> |
159 <!-- [HELP] As DOI or BibTex entry --> | 162 <!-- [HELP] As DOI or BibTex entry --> |
160 <citation type="bibtex">@article{Dereeper03062015, | 163 <citation type="bibtex">@article{Dereeper03062015, |