Mercurial > repos > dereeper > sniplay
comparison VCF2Hapmap/vcf2FastaAndHapmap.xml @ 10:c6640c49fd01 draft
planemo upload commit 475f4d7d8442a0d75e103af326ae5881c4d2a4ac
author | dereeper |
---|---|
date | Mon, 16 Apr 2018 09:00:24 -0400 |
parents | 98c37a5d67f4 |
children |
comparison
equal
deleted
inserted
replaced
9:98c37a5d67f4 | 10:c6640c49fd01 |
---|---|
1 <tool id="sniplay_vcf2fastaandhapmap" name="VCF to Hapmap" version="1.1.0"> | 1 <tool id="sniplay_vcf2fastaandhapmap" name="VCF to Hapmap" version="2.0.0"> |
2 | 2 |
3 <!-- [REQUIRED] Tool description displayed after the tool name --> | 3 <!-- [REQUIRED] Tool description displayed after the tool name --> |
4 <description> Convert VCF to Hapmap </description> | 4 <description> Convert VCF to Hapmap </description> |
5 | 5 |
6 <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work --> | 6 <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work --> |
84 <param name="file_opt" value="fasta_gff" /> | 84 <param name="file_opt" value="fasta_gff" /> |
85 <param name="filefasta" value="vcf2fastaAndHapmap-reference.fa" /> | 85 <param name="filefasta" value="vcf2fastaAndHapmap-reference.fa" /> |
86 <param name="filegff" value="vcf2fastaAndHapmap-reference.gff" /> | 86 <param name="filegff" value="vcf2fastaAndHapmap-reference.gff" /> |
87 <output name="fileout" file="vcf2fastaAndHapmap-result3.hapmap" /> | 87 <output name="fileout" file="vcf2fastaAndHapmap-result3.hapmap" /> |
88 <output name="fileout_seq" file="vcf2fastaAndHapmap-result3.flanking.txt" /> | 88 <output name="fileout_seq" file="vcf2fastaAndHapmap-result3.flanking.txt" /> |
89 <output name="fileout_fa1" file="vcf2fastaAndHapmap-result3.gene_alignment.fas" /> | 89 <output name="fileout_fa1" file="vcf2fastaAndHapmap-result3.gene_alignment.fas" compare="sim_size" delta="0"/> |
90 </test> | 90 </test> |
91 </tests> | 91 </tests> |
92 | 92 |
93 <!-- [OPTIONAL] Help displayed in Galaxy --> | 93 <!-- [OPTIONAL] Help displayed in Galaxy --> |
94 <help> | 94 <help><![CDATA[ |
95 | 95 |
96 | 96 |
97 .. class:: infomark | 97 .. class:: infomark |
98 | 98 |
99 **Authors** Dereeper Alexis (alexis.dereeper@ird.fr), IRD, South Green platform | 99 **Authors** Dereeper Alexis (alexis.dereeper@ird.fr), IRD, South Green platform |
100 | 100 |
101 | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1). | 101 | **Please cite** "SNiPlay3: a web-based application for exploration and large scale analyses of genomic variations", **Dereeper A. et al.**, Nucl. Acids Res. (1 july 2015) 43 (W1). |
102 | 102 |
103 .. class:: infomark | 103 .. class:: infomark |
104 | 104 |
105 **Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique. | 105 **Galaxy integration** Provided by Southgreen & Andres Gwendoline (Institut Français de Bioinformatique) & Marcon Valentin (IFB & INRA) |
106 | 106 |
107 .. class:: infomark | 107 .. class:: infomark |
108 | 108 |
109 **Support** For any questions, please send an e-mail to support.abims@sb-roscoff.fr | 109 **Support** For any questions about Galaxy integration, please send an e-mail to alexis.dereeper@ird.fr |
110 | 110 |
111 --------------------------------------------------- | 111 --------------------------------------------------- |
112 | 112 |
113 ======================= | 113 ======================= |
114 VCF to Hapmap | 114 VCF to Hapmap |
118 Description | 118 Description |
119 ----------- | 119 ----------- |
120 | 120 |
121 | Convert VCF to Hapmap. Additionnaly it creates flanking sequences of variants if fasta reference is provided. | 121 | Convert VCF to Hapmap. Additionnaly it creates flanking sequences of variants if fasta reference is provided. |
122 | Furthermore it also creates fasta alignment of genes if GFF annotation is provided | 122 | Furthermore it also creates fasta alignment of genes if GFF annotation is provided |
123 | |
124 ----------------- | |
125 Workflow position | |
126 ----------------- | |
127 | |
128 **Upstream tool** | |
129 | |
130 =============== ========================== ======= | |
131 Name output file(s) format | |
132 =============== ========================== ======= | |
133 VCFtools Filter VCF file VCF | |
134 =============== ========================== ======= | |
135 | |
136 | |
137 **Downstream tool** | |
138 | |
139 =============== ========================== =========== | |
140 Name input file(s) format | |
141 =============== ========================== =========== | |
142 SNP density Hapmap file tabular | |
143 =============== ========================== =========== | |
144 | |
145 | 123 |
146 ---------- | 124 ---------- |
147 Input file | 125 Input file |
148 ---------- | 126 ---------- |
149 | 127 |
235 | 213 |
236 >chr1_CATB1_1 | 214 >chr1_CATB1_1 |
237 TCCTCAAACTTTCTTCAGCGCCTATGAATACAGCGTGCTATAGTTACGTGGGGCGTTT | 215 TCCTCAAACTTTCTTCAGCGCCTATGAATACAGCGTGCTATAGTTACGTGGGGCGTTT |
238 | 216 |
239 | 217 |
240 </help> | 218 ]]></help> |
241 | 219 |
242 <citations> | 220 <citations> |
243 <!-- [HELP] As DOI or BibTex entry --> | 221 <!-- [HELP] As DOI or BibTex entry --> |
244 <citation type="bibtex">@article{Dereeper03062015, | 222 <citation type="bibtex">@article{Dereeper03062015, |
245 author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel}, | 223 author = {Dereeper, Alexis and Homa, Felix and Andres, Gwendoline and Sempere, Guilhem and Sarah, Gautier and Hueber, Yann and Dufayard, Jean-François and Ruiz, Manuel}, |