Mercurial > repos > dereeper > sniplay
diff AnnotationStatsFromVCF/annotationStatsFromVCF_wrapper.xml @ 10:c6640c49fd01 draft
planemo upload commit 475f4d7d8442a0d75e103af326ae5881c4d2a4ac
| author | dereeper |
|---|---|
| date | Mon, 16 Apr 2018 09:00:24 -0400 |
| parents | 98c37a5d67f4 |
| children |
line wrap: on
line diff
--- a/AnnotationStatsFromVCF/annotationStatsFromVCF_wrapper.xml Wed Feb 07 22:08:47 2018 -0500 +++ b/AnnotationStatsFromVCF/annotationStatsFromVCF_wrapper.xml Mon Apr 16 09:00:24 2018 -0400 @@ -1,8 +1,9 @@ -<tool id="annotationStatsFromVCF" name="Get annotation statistics" version="1.0.0"> - <description> from VCF file </description> +<tool id="annotationStatsFromVCF" name="Get VCF annotation statistics" version="2.0.0"> + <description>Get annotation fromi a VCF file annotated by snpeff</description> <requirements> <requirement type="binary">perl</requirement> - <requirement type="package" version="0.1.12b">vcftools</requirement> + <requirement type="package" version="1.6.924">perl-bioperl</requirement> + <requirement type="package" version="0.1.14">vcftools</requirement> </requirements> <stdio> <exit_code range="1:" /> @@ -12,19 +13,21 @@ </command> <inputs> <param type="data" name="input" format="vcf" label="VCF file" /> - <param type="text" name="output_label" label="Output_label" value='VCF_stats' /> + <param name="step" type="integer" value="200000" label="Step" help="Step in bp"/> + <param type="text" name="output_label" label="Output_label" value='VCF_stats' optional='false' /> </inputs> <outputs> - <data name="output_count" format="txt" label="${output_label}."/> - <data name="output_stats_effect" format="txt" label="${output_label}."/> - <data name="output_stats_location" format="txt" label="${output_label}."/> + <data name="output_count" format="txt" label="${output_label}"/> + <data name="output_stats_effect" format="txt" label="${output_label}.effect"/> + <data name="output_stats_location" format="txt" label="${output_label}.location"/> </outputs> <tests> <test> - <param name="input" value="vcf2fastaAndHapmap-sample.vcf"/> - <output name="output_count" file="vcf2fastaAndHapmap-sample.vcf"/> - <output name="output_stats_effect" file="vcf2fastaAndHapmap-sample.vcf"/> - <output name="output_stats_location" file="vcf2fastaAndHapmap-sample.vcf"/> + <param name="input" value="annotationStatsFromVCF.vcf"/> + <param name="step" value="50000"/> + <output name="output_count" file="annotationStatsFromVCF.txt"/> + <output name="output_stats_effect" file="annotationStatsFromVCF.effect"/> + <output name="output_stats_location" file="annotationStatsFromVCF.location"/> </test> </tests> <help><![CDATA[ @@ -37,69 +40,61 @@ .. class:: infomark -**Galaxy integration** Andres Gwendoline, Institut Français de Bioinformatique. +**Galaxy integration** Provided by Southgreen & Andres Gwendoline (Institut Français de Bioinformatique) & Marcon Valentin (IFB & INRA) .. class:: infomark -**Support** For any questions, please send an e-mail to support.abims@sb-roscoff.fr +**Support** For any questions about Galaxy integration, please send an e-mail to alexis.dereeper@ird.fr --------------------------------------------------- -============================== -Get Haplotypes From Phased VCF -============================== +========================= +Get annotation statistics +========================= ----------- Description ----------- - | Get Haplotype from phased VCF - ------------------ -Workflow position ------------------ - -**Upstream tool** + | Get annotation statistics from VCF -=============== ========================== ======= -Name output file(s) format -=============== ========================== ======= -Beagle Phased VCF file VCF -=============== ========================== ======= - +------------ +Dependencies +------------ +VCFtools + vcftools_ 0.1.14, Conda version +Bioperl + perl-bioperl_ 1.6.924, Conda version -**Downstream tool** - -=============== ========================== =========== -Name input file(s) format -=============== ========================== =========== -=============== ========================== =========== - +.. _vcftools: https://anaconda.org/bioconda/vcftools +.. _perl-bioperl: https://anaconda.org/bioconda/perl-bioperl ---------- Input file ---------- VCF file - Phased VCF file + VCF file ---------- Parameters ---------- -Output file basename - Prefix for the output VCF file +Step + Step in bp + +Output label + Prefix for the ouput files ------------ Output files ------------ +Output_name -Text file - File describing haplotypes +Output_name.effect file -Fasta file - Fasta file with haplotypes +Output_name.location file --------------------------------------------------- @@ -107,8 +102,8 @@ Working example --------------- -Input files -=========== +Input file +========== VCF file --------- @@ -126,33 +121,41 @@ Parameters ========== -Output name -> haplotypes +Step -> 50000 +Output label -> VCF_stats Output files ============ -haplotypes.distinct_haplotypes.txt +VCF_stats ---------------------------------- :: - ===Chr10=== - haplo1:2:CIRAD403_1,CIRAD403_2, - TTTAAGAAATTCCTATATAGGTCTTCTAAGCGTATCTATTAACAT - haplo2:2:MAHAE_1,MAHAE_2, - TAAATCTTGGTGCTGATCTGATATTTAATGCGT + Chrom Bin dN/dS ratio + chr1 50000 0.791666666666667 + chr1 100000 0.981132075471698 + chr1 150000 2.08333333333333 -haplotypes.haplo.fas +VCF_stats.effect -------------------- :: - >Chr10_AZUCENA_1 - TTTAAGAAATTCCTATATAGGTCTTCTAAGCGTATCTATTAACAT - >Chr10_AZUCENA_2 - TAAATCTTGGTGCTGATCTGATATTTAATGCGT + Intron 960 Intron:960 + UTR 281 UTR:281 + Exon 3248 Synonym:124 Non-syn:120 + +VCF_stats.location +-------------------- + +:: + + Intergenic 466 Intergenic:466 + Genic 4489 Exon:3248 Intron:960 UTR:281 + ]]></help> <citations>