comparison bowtie2_wrapper.xml @ 15:43d12513224b draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bowtie2 commit cf554b9b69c32acb484c34fdc60384fa49c7c482

14:937aa69e715f

<tool id="bowtie2" name="Bowtie2" version="2.3.0.1" profile="17.01">
    <description>- map reads against reference genome</description>
    <macros>
        <import>read_group_macros.xml</import>
    </macros>
    <requirements>
        <requirement type="package" version="2.3.0">bowtie2</requirement>
        <requirement type="package" version="1.3.1">samtools</requirement>
    </requirements>
    <version_command>bowtie2 --version</version_command>
    <command detect_errors="exit_code"><![CDATA[
        ## prepare bowtie2 index

                #set compressed = "BZ2"
            #else:
                #set read2 = "input_r.fastq"
            #end if
            ln -s '${library.input_1.reverse}' ${read2} &&
        #else:
            #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
                #set read1 = "input_f.fastq.gz"
                #set compressed = "GZ"
            #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):

        -x '$index_path'

        ## Fastq inputs
        #if str( $library.type ) == "single":
            -U '${read1}'
            #if str( $library.unaligned_file ) == "true":
                #if $compressed == "GZ":
                    --un-gz '${output_unaligned_reads_l}'
                #else if $compressed == "BZ2":
                    --un-bz2 '${output_unaligned_reads_l}'

        <conditional name="library">
            <param name="type" type="select" label="Is this single or paired library">
              <option value="single">Single-end</option>
              <option value="paired">Paired-end</option>
              <option value="paired_collection">Paired-end Dataset Collection</option>
            </param>

            <when value="single">
                <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file" help="Must be of datatype &quot;fastqsanger&quot;" />
                <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc (possibly with -gz or -bz2); This triggers --un parameter for single reads and --un-conc for paired reads" />
                <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc (possibly with -gz or -bz2); This triggers --al parameter for single reads and --al-conc for paired reads" />
            </when>
            <when value="paired">
                <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #1" help="Must be of datatype &quot;fastqsanger&quot;" />
                <param name="input_2" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #2" help="Must be of datatype &quot;fastqsanger&quot;" />
                <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc (possibly with -gz or -bz2); This triggers --un parameter for single reads and --un-conc for paired reads" />
                <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc (possibly with -gz or -bz2); This triggers --al parameter for single reads and --al-conc for paired reads" />
                <conditional name="paired_options">
                    <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See &quot;Alignment Options&quot; section of Help below for information">
                        <option value="no" selected="True">No</option>
                        <option value="yes">Yes</option>
                    </param>
                    <when value="yes">
                        <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins;  E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied).  A 19-bp gap would not be valid in that case.  If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run.  This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/>
                        <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied).  A 61-bp gap would not be valid in that case.  If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/>
                        <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid.  Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)">
                            <option value="--fr" selected="True">--fr</option>
                            <option value="--rf">--rf</option>
                            <option value="--ff">--ff</option>
                        </param>
                        <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
                        <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
                        <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/>
                        <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Disallow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/>
                        <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Disallow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/>
                    </when>
                    <when value="no">
                        <!-- do nothing -->
                    </when>
                </conditional>
            </when>
            <when value="paired_collection">
                <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data_collection" collection_type="paired" label="FASTQ Paired Dataset" help="Must be of datatype &quot;fastqsanger&quot;" />
                <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc (possibly with -gz or -bz2); This triggers --un parameter for single reads and --un-conc for paired reads" />
                <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc (possibly with -gz or -bz2); This triggers --al parameter for single reads and --al-conc for paired reads" />
                <conditional name="paired_options">
                    <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See &quot;Alignment Options&quot; section of Help below for information">
                        <option value="no" selected="True">No</option>
                        <option value="yes">Yes</option>
                    </param>
                    <when value="yes">
                        <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins;  E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied).  A 19-bp gap would not be valid in that case.  If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run.  This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/>
                        <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied).  A 61-bp gap would not be valid in that case.  If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/>
                        <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid.  Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)">
                            <option value="--fr" selected="True">--fr</option>
                            <option value="--rf">--rf</option>
                            <option value="--ff">--ff</option>
                        </param>
                        <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/>
                        <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/>
                        <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/>
                        <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Disallow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/>
                        <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Disallow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/>
                    </when>
                    <when value="no">
                        <!-- do nothing -->
                    </when>
                </conditional>
            </when>
        </conditional>

        <!-- reference genome -->
        <conditional name="reference_genome">

    <tests>
        <test>
            <!-- basic test on single paired default run -->
            <param name="type" value="paired"/>
            <param name="selection" value="no"/>
            <param name="paired_options_selector" value="no"/>
            <param name="unaligned_file" value="false"/>
            <param name="analysis_type_selector" value="simple"/>
            <param name="source" value="history" />
            <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>

            <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
        </test>
        <test>
            <!-- basic test on single paired default run -->
            <param name="type" value="paired"/>
            <param name="selection" value="no"/>
            <param name="paired_options_selector" value="no"/>
            <param name="unaligned_file" value="false"/>
            <param name="analysis_type_selector" value="simple"/>
            <param name="rg_selector" value="set"/>
            <param name="ID" value="rg1"/>

            <output name="output" file="bowtie2-test2.bam" ftype="bam" lines_diff="2"/>
        </test>
        <test>
            <!-- basic test on single paired default run with stats-->
            <param name="type" value="paired"/>
            <param name="selection" value="no"/>
            <param name="paired_options_selector" value="no"/>
            <param name="unaligned_file" value="false"/>
            <param name="analysis_type_selector" value="simple"/>
            <param name="source" value="history" />
            <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
            <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
            <param name="own_file" value="bowtie2-ref.fasta" />
            <param name="save_mapping_stats" value="true" />
            <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
            <output name="mapping_stats" file="bowtie2-stats.out" ftype="txt"/>
        </test>
        <test>
            <!-- test fastqsanger.gz input -->
            <param name="type" value="paired"/>
            <param name="selection" value="no"/>
            <param name="paired_options_selector" value="no"/>
            <param name="unaligned_file" value="false"/>
            <param name="analysis_type_selector" value="simple"/>
            <param name="source" value="history" />
            <param name="input_1" value="bowtie2-fq1.fq.gz" ftype="fastqsanger.gz"/>

            <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
        </test>
        <test>
            <!-- test fastqsanger.bz2 input -->
            <param name="type" value="paired"/>
            <param name="selection" value="no"/>
            <param name="paired_options_selector" value="no"/>
            <param name="unaligned_file" value="false"/>
            <param name="analysis_type_selector" value="simple"/>
            <param name="source" value="history" />
            <param name="input_1" value="bowtie2-fq1.fq.bz2" ftype="fastqsanger.bz2"/>

-----

**Inputs**

Bowtie 2 accepts files in Sanger FASTQ format (single or pair-end). Use the FASTQ Groomer to prepare your files.

------

**Input options**::

    -s/--skip <int>
            Skip (i.e. do not align) the first `<int>` reads or pairs in the input.

    -u/--qupto <int>

            current time.  This means that Bowtie 2 will not necessarily report the same
            alignment for two identical reads.  This is counter-intuitive for some users,
            but might be more appropriate in situations where the input consists of many
            identical reads.

    ]]></help>
    <citations>
    <citation type="doi">10.1186/gb-2009-10-3-r25</citation>
    <citation type="doi">10.1038/nmeth.1923</citation>
  </citations>

15:43d12513224b

<tool id="bowtie2" name="Bowtie2" version="2.3.2.1" profile="17.01">
    <description>- map reads against reference genome</description>
    <macros>
        <import>bowtie2_macros.xml</import>
    </macros>
    <requirements>
        <requirement type="package" version="2.3.2">bowtie2</requirement>
        <requirement type="package" version="1.3.1">samtools</requirement>
    </requirements>
    <version_command>bowtie2 --version</version_command>
    <command detect_errors="exit_code"><![CDATA[
        ## prepare bowtie2 index

                #set compressed = "BZ2"
            #else:
                #set read2 = "input_r.fastq"
            #end if
            ln -s '${library.input_1.reverse}' ${read2} &&

        #else if str($library.type) == 'paired_interleaved':
            #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
                #set read1 = "input_il.fastq.gz"
                #set compressed = "GZ"
            #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):
                #set read1 = "input_il.fastq.bz2"
                #set compressed = "BZ2"
            #else:
                #set read1 = "input_il.fastq"
            #end if
            ln -s '${library.input_1}' ${read1} &&
        #else:
            #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"):
                #set read1 = "input_f.fastq.gz"
                #set compressed = "GZ"
            #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"):

        -x '$index_path'

        ## Fastq inputs
        #if str( $library.type ) == "single":
            -U '${read1}'
            #if str( $library.unaligned_file ) == "true":
                #if $compressed == "GZ":
                    --un-gz '${output_unaligned_reads_l}'
                #else if $compressed == "BZ2":
                    --un-bz2 '${output_unaligned_reads_l}'
                #else:
                    --un '${output_unaligned_reads_l}'
                #end if
            #end if
            #if str( $library.aligned_file ) == "true":
                #if $compressed == "GZ":
                    --al-gz '${output_aligned_reads_l}'
                #else if $compressed == "BZ2":
                    --al-bz2 '${output_aligned_reads_l}'
                #else:
                    --al '${output_aligned_reads_l}'
                #end if
            #end if

        #elif str( $library.type ) == "paired_interleaved":
            --interleaved '${read1}'
            #if str( $library.unaligned_file ) == "true":
                #if $compressed == "GZ":
                    --un-gz '${output_unaligned_reads_l}'
                #else if $compressed == "BZ2":
                    --un-bz2 '${output_unaligned_reads_l}'

        <conditional name="library">
            <param name="type" type="select" label="Is this single or paired library">
              <option value="single">Single-end</option>
              <option value="paired">Paired-end</option>
              <option value="paired_collection">Paired-end Dataset Collection</option>
              <option value="paired_interleaved">Paired-end data from single interleaved dataset</option>
            </param>

            <when value="single">
                <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file" help="Must be of datatype &quot;fastqsanger&quot;" />

                <expand macro="align_unalign" />

            </when>
            <when value="paired">
                <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #1" help="Must be of datatype &quot;fastqsanger&quot;" />
                <param name="input_2" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #2" help="Must be of datatype &quot;fastqsanger&quot;" />

                <expand macro="align_unalign" />
                <expand macro="paired_end_options" />

            </when>
            <when value="paired_collection">
                <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data_collection" collection_type="paired" label="FASTQ Paired Dataset" help="Must be of datatype &quot;fastqsanger&quot;" />

                <expand macro="align_unalign" />
                <expand macro="paired_end_options" />

            </when>
            <when value="paired_interleaved">
                <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="Interleaved FASTQ file" help="Must be of datatype &quot;fastqsanger&quot;. --interleaved"/>
               
                <expand macro="align_unalign" />
                <expand macro="paired_end_options" />

            </when>
        </conditional>

        <!-- reference genome -->
        <conditional name="reference_genome">

    <tests>
        <test>
            <!-- basic test on single paired default run -->
            <param name="type" value="paired"/>
            <param name="paired_options_selector" value="no"/>
            <param name="unaligned_file" value="false"/>
            <param name="analysis_type_selector" value="simple"/>
            <param name="source" value="history" />
            <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>

            <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
        </test>
        <test>
            <!-- basic test on single paired default run -->
            <param name="type" value="paired"/>
            <param name="paired_options_selector" value="no"/>
            <param name="unaligned_file" value="false"/>
            <param name="analysis_type_selector" value="simple"/>
            <param name="rg_selector" value="set"/>
            <param name="ID" value="rg1"/>

            <output name="output" file="bowtie2-test2.bam" ftype="bam" lines_diff="2"/>
        </test>
        <test>
            <!-- basic test on single paired default run with stats-->
            <param name="type" value="paired"/>
            <param name="paired_options_selector" value="no"/>
            <param name="unaligned_file" value="false"/>
            <param name="analysis_type_selector" value="simple"/>
            <param name="source" value="history" />
            <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/>
            <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/>
            <param name="own_file" value="bowtie2-ref.fasta" />
            <param name="save_mapping_stats" value="true" />
            <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
            <output name="mapping_stats">
                <assert_contents>
                    <has_text text="of these" />
                </assert_contents>
            </output>
        </test>
        <test>
            <!-- basic test on interleaved paired default run -->
            <param name="type" value="paired_interleaved"/>
            <!-- <param name="paired_options_selector" value="no"/> -->
            <param name="unaligned_file" value="false"/>
            <param name="analysis_type_selector" value="simple"/>
            <param name="rg_selector" value="set"/>
            <param name="ID" value="rg1"/>
            <param name="PL" value="CAPILLARY"/>
            <param name="source" value="history" />
            <param name="input_1" value="bowtie2-fq_il.fq" ftype="fastqsanger"/>
            <param name="own_file" value="bowtie2-ref.fasta" />
            <output name="output" file="bowtie2-test_il.bam" ftype="bam" lines_diff="2"/>
        </test>
        <test>
            <!-- test fastqsanger.gz input -->
            <param name="type" value="paired"/>
            <param name="paired_options_selector" value="no"/>
            <param name="unaligned_file" value="false"/>
            <param name="analysis_type_selector" value="simple"/>
            <param name="source" value="history" />
            <param name="input_1" value="bowtie2-fq1.fq.gz" ftype="fastqsanger.gz"/>

            <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/>
        </test>
        <test>
            <!-- test fastqsanger.bz2 input -->
            <param name="type" value="paired"/>
            <param name="paired_options_selector" value="no"/>
            <param name="unaligned_file" value="false"/>
            <param name="analysis_type_selector" value="simple"/>
            <param name="source" value="history" />
            <param name="input_1" value="bowtie2-fq1.fq.bz2" ftype="fastqsanger.bz2"/>

-----

**Inputs**

Bowtie 2 accepts files in Sanger FASTQ format (single or paired-end). Paired-end data can represented as two individual (forward and reverse) datasets, as well as a single interleaved dataset (see an example at the end of the help section).

------

**Input options**::

    --interleaved
            Reads interleaved FASTQ files where the first two records (8 lines) represent a mate pair.

    -s/--skip <int>
            Skip (i.e. do not align) the first `<int>` reads or pairs in the input.

    -u/--qupto <int>

            current time.  This means that Bowtie 2 will not necessarily report the same
            alignment for two identical reads.  This is counter-intuitive for some users,
            but might be more appropriate in situations where the input consists of many
            identical reads.

-----


**Paired-end (and mate-pair) data in fastq format**

Paired end datasets can be represented as two individual datasets:

First dataset::

 @1/1
 AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA
 +
 EGGEGGGDFGEEEAEECGDEGGFEEGEFGBEEDDECFEFDD@CDD<ED
 @2/1
 AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA
 +
 HHHHHHEGFHEEFEEHEEHHGGEGGGGEFGFGGGGHHHHFBEEEEEFG

Second dataset::

 @1/2
 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
 +
 GHHHDFDFGFGEGFBGEGGEGEGGGHGFGHFHFHHHHHHHEF?EFEFF
 @2/2
 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
 +
 HHHHHHHHHHHHHGHHHHHHGHHHHHHHHHHHFHHHFHHHHHHHHHHH

Or a single *interleaved* dataset::

 @1/1
 AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA
 +
 EGGEGGGDFGEEEAEECGDEGGFEEGEFGBEEDDECFEFDD@CDD<ED
 @1/2
 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
 +
 GHHHDFDFGFGEGFBGEGGEGEGGGHGFGHFHFHHHHHHHEF?EFEFF
 @2/1
 AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA
 +
 HHHHHHEGFHEEFEEHEEHHGGEGGGGEFGFGGGGHHHHFBEEEEEFG
 @2/2
 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
 +
 HHHHHHHHHHHHHGHHHHHHGHHHHHHHHHHHFHHHFHHHHHHHHHHH




    ]]></help>
    <citations>
    <citation type="doi">10.1186/gb-2009-10-3-r25</citation>
    <citation type="doi">10.1038/nmeth.1923</citation>
  </citations>