Mercurial > repos > devteam > bowtie2
comparison bowtie2_wrapper.xml @ 15:43d12513224b draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bowtie2 commit cf554b9b69c32acb484c34fdc60384fa49c7c482
author | iuc |
---|---|
date | Thu, 01 Jun 2017 06:47:03 -0400 |
parents | 937aa69e715f |
children | 8ccbdbe9a695 |
comparison
equal
deleted
inserted
replaced
14:937aa69e715f | 15:43d12513224b |
---|---|
1 <tool id="bowtie2" name="Bowtie2" version="2.3.0.1" profile="17.01"> | 1 <tool id="bowtie2" name="Bowtie2" version="2.3.2.1" profile="17.01"> |
2 <description>- map reads against reference genome</description> | 2 <description>- map reads against reference genome</description> |
3 <macros> | 3 <macros> |
4 <import>read_group_macros.xml</import> | 4 <import>bowtie2_macros.xml</import> |
5 </macros> | 5 </macros> |
6 <requirements> | 6 <requirements> |
7 <requirement type="package" version="2.3.0">bowtie2</requirement> | 7 <requirement type="package" version="2.3.2">bowtie2</requirement> |
8 <requirement type="package" version="1.3.1">samtools</requirement> | 8 <requirement type="package" version="1.3.1">samtools</requirement> |
9 </requirements> | 9 </requirements> |
10 <version_command>bowtie2 --version</version_command> | 10 <version_command>bowtie2 --version</version_command> |
11 <command detect_errors="exit_code"><![CDATA[ | 11 <command detect_errors="exit_code"><![CDATA[ |
12 ## prepare bowtie2 index | 12 ## prepare bowtie2 index |
64 #set compressed = "BZ2" | 64 #set compressed = "BZ2" |
65 #else: | 65 #else: |
66 #set read2 = "input_r.fastq" | 66 #set read2 = "input_r.fastq" |
67 #end if | 67 #end if |
68 ln -s '${library.input_1.reverse}' ${read2} && | 68 ln -s '${library.input_1.reverse}' ${read2} && |
69 | |
70 #else if str($library.type) == 'paired_interleaved': | |
71 #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"): | |
72 #set read1 = "input_il.fastq.gz" | |
73 #set compressed = "GZ" | |
74 #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"): | |
75 #set read1 = "input_il.fastq.bz2" | |
76 #set compressed = "BZ2" | |
77 #else: | |
78 #set read1 = "input_il.fastq" | |
79 #end if | |
80 ln -s '${library.input_1}' ${read1} && | |
69 #else: | 81 #else: |
70 #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"): | 82 #if $library.input_1.is_of_type("fastq.gz", "fastqsanger.gz"): |
71 #set read1 = "input_f.fastq.gz" | 83 #set read1 = "input_f.fastq.gz" |
72 #set compressed = "GZ" | 84 #set compressed = "GZ" |
73 #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"): | 85 #else if $library.input_1.is_of_type("fastq.bz2", "fastqsanger.bz2"): |
90 -x '$index_path' | 102 -x '$index_path' |
91 | 103 |
92 ## Fastq inputs | 104 ## Fastq inputs |
93 #if str( $library.type ) == "single": | 105 #if str( $library.type ) == "single": |
94 -U '${read1}' | 106 -U '${read1}' |
107 #if str( $library.unaligned_file ) == "true": | |
108 #if $compressed == "GZ": | |
109 --un-gz '${output_unaligned_reads_l}' | |
110 #else if $compressed == "BZ2": | |
111 --un-bz2 '${output_unaligned_reads_l}' | |
112 #else: | |
113 --un '${output_unaligned_reads_l}' | |
114 #end if | |
115 #end if | |
116 #if str( $library.aligned_file ) == "true": | |
117 #if $compressed == "GZ": | |
118 --al-gz '${output_aligned_reads_l}' | |
119 #else if $compressed == "BZ2": | |
120 --al-bz2 '${output_aligned_reads_l}' | |
121 #else: | |
122 --al '${output_aligned_reads_l}' | |
123 #end if | |
124 #end if | |
125 | |
126 #elif str( $library.type ) == "paired_interleaved": | |
127 --interleaved '${read1}' | |
95 #if str( $library.unaligned_file ) == "true": | 128 #if str( $library.unaligned_file ) == "true": |
96 #if $compressed == "GZ": | 129 #if $compressed == "GZ": |
97 --un-gz '${output_unaligned_reads_l}' | 130 --un-gz '${output_unaligned_reads_l}' |
98 #else if $compressed == "BZ2": | 131 #else if $compressed == "BZ2": |
99 --un-bz2 '${output_unaligned_reads_l}' | 132 --un-bz2 '${output_unaligned_reads_l}' |
271 <conditional name="library"> | 304 <conditional name="library"> |
272 <param name="type" type="select" label="Is this single or paired library"> | 305 <param name="type" type="select" label="Is this single or paired library"> |
273 <option value="single">Single-end</option> | 306 <option value="single">Single-end</option> |
274 <option value="paired">Paired-end</option> | 307 <option value="paired">Paired-end</option> |
275 <option value="paired_collection">Paired-end Dataset Collection</option> | 308 <option value="paired_collection">Paired-end Dataset Collection</option> |
309 <option value="paired_interleaved">Paired-end data from single interleaved dataset</option> | |
276 </param> | 310 </param> |
277 | 311 |
278 <when value="single"> | 312 <when value="single"> |
279 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file" help="Must be of datatype "fastqsanger"" /> | 313 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file" help="Must be of datatype "fastqsanger"" /> |
280 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc (possibly with -gz or -bz2); This triggers --un parameter for single reads and --un-conc for paired reads" /> | 314 |
281 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc (possibly with -gz or -bz2); This triggers --al parameter for single reads and --al-conc for paired reads" /> | 315 <expand macro="align_unalign" /> |
316 | |
282 </when> | 317 </when> |
283 <when value="paired"> | 318 <when value="paired"> |
284 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #1" help="Must be of datatype "fastqsanger"" /> | 319 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #1" help="Must be of datatype "fastqsanger"" /> |
285 <param name="input_2" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #2" help="Must be of datatype "fastqsanger"" /> | 320 <param name="input_2" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="FASTQ file #2" help="Must be of datatype "fastqsanger"" /> |
286 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc (possibly with -gz or -bz2); This triggers --un parameter for single reads and --un-conc for paired reads" /> | 321 |
287 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc (possibly with -gz or -bz2); This triggers --al parameter for single reads and --al-conc for paired reads" /> | 322 <expand macro="align_unalign" /> |
288 <conditional name="paired_options"> | 323 <expand macro="paired_end_options" /> |
289 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See "Alignment Options" section of Help below for information"> | 324 |
290 <option value="no" selected="True">No</option> | |
291 <option value="yes">Yes</option> | |
292 </param> | |
293 <when value="yes"> | |
294 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/> | |
295 <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/> | |
296 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)"> | |
297 <option value="--fr" selected="True">--fr</option> | |
298 <option value="--rf">--rf</option> | |
299 <option value="--ff">--ff</option> | |
300 </param> | |
301 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/> | |
302 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/> | |
303 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/> | |
304 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Disallow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/> | |
305 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Disallow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/> | |
306 </when> | |
307 <when value="no"> | |
308 <!-- do nothing --> | |
309 </when> | |
310 </conditional> | |
311 </when> | 325 </when> |
312 <when value="paired_collection"> | 326 <when value="paired_collection"> |
313 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data_collection" collection_type="paired" label="FASTQ Paired Dataset" help="Must be of datatype "fastqsanger"" /> | 327 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data_collection" collection_type="paired" label="FASTQ Paired Dataset" help="Must be of datatype "fastqsanger"" /> |
314 <param name="unaligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write unaligned reads (in fastq format) to separate file(s)" help="--un/--un-conc (possibly with -gz or -bz2); This triggers --un parameter for single reads and --un-conc for paired reads" /> | 328 |
315 <param name="aligned_file" type="boolean" truevalue="true" falsevalue="false" checked="False" label="Write aligned reads (in fastq format) to separate file(s)" help="--al/--al-conc (possibly with -gz or -bz2); This triggers --al parameter for single reads and --al-conc for paired reads" /> | 329 <expand macro="align_unalign" /> |
316 <conditional name="paired_options"> | 330 <expand macro="paired_end_options" /> |
317 <param name="paired_options_selector" type="select" label="Do you want to set paired-end options?" help="See "Alignment Options" section of Help below for information"> | 331 |
318 <option value="no" selected="True">No</option> | 332 </when> |
319 <option value="yes">Yes</option> | 333 <when value="paired_interleaved"> |
320 </param> | 334 <param name="input_1" format="fastqsanger,fastqsanger.gz,fastqsanger.bz2" type="data" label="Interleaved FASTQ file" help="Must be of datatype "fastqsanger". --interleaved"/> |
321 <when value="yes"> | 335 |
322 <param name="I" type="integer" value="0" min="0" label="Set the minimum fragment length for valid paired-end alignments" help="-I/--minins; E.g. if `-I 60` is specified and a paired-end alignment consists of two 20-bp alignments in the appropriate orientation with a 20-bp gap between them, that alignment is considered valid (as long as `-X` is also satisfied). A 19-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-I` constraint is applied with respect to the untrimmed mates. The larger the difference between `-I` and `-X`, the slower Bowtie 2 will run. This is because larger differences bewteen `-I` and `-X` require that Bowtie 2 scan a larger window to determine if a concordant alignment exists. For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very efficient. Default=0"/> | 336 <expand macro="align_unalign" /> |
323 <param name="X" type="integer" value="500" min="0" label="Set the maximum fragment length for valid paired-end alignments" help="-X/--maxins; E.g. if `-X 100` is specified and a paired-end alignment consists of two 20-bp alignments in the proper orientation with a 60-bp gap between them, that alignment is considered valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in that case. If trimming options `-3` or `-5` are also used, the `-X` constraint is applied with respect to the untrimmed mates, not the trimmed mates; Default=500"/> | 337 <expand macro="paired_end_options" /> |
324 <param name="fr_rf_ff" type="select" display="radio" label="Select the upstream/downstream mate orientations for a valid paired-end alignment against the forward reference strand" help="--fr, --rf, or --ff; E.g., if `--fr` is specified and there is a candidate paired-end alignment where mate 1 appears upstream of the reverse complement of mate 2 and the fragment length constraints (`-I` and `-X`) are met, that alignment is valid. Also, if mate 2 appears upstream of the reverse complement of mate 1 and all other constraints are met, that too is valid. `--rf` likewise requires that an upstream mate1 be reverse-complemented and a downstream mate2 be forward-oriented. `--ff` requires both an upstream mate 1 and a downstream mate 2 to be forward-oriented; Default=--fr (appropriate for Illumina's Paired-end Sequencing Assay)"> | 338 |
325 <option value="--fr" selected="True">--fr</option> | |
326 <option value="--rf">--rf</option> | |
327 <option value="--ff">--ff</option> | |
328 </param> | |
329 <param name="no_mixed" type="boolean" truevalue="--no-mixed" falsevalue="" checked="False" label="Disable no-mixed behavior" help="--no-mixed; By default, when `bowtie2` cannot find a concordant or discordant alignment for a pair, it then tries to find alignments for the individual mates; default=False"/> | |
330 <param name="no_discordant" type="boolean" truevalue="--no-discordant" falsevalue="" checked="False" label="Disable no-discordant behavior" help="--no-discordant; By default, `bowtie2` looks for discordant alignments if it cannot find any concordant alignments. A discordant alignment is an alignment where both mates align uniquely, but that does not satisfy the paired-end constraints (`--fr`/`--rf`/`--ff`, `-I`, `-X`); default=False"/> | |
331 <param name="dovetail" type="boolean" truevalue="--dovetail" falsevalue="" checked="False" label="Allow mate dovetailing" help="--dovetail; If the mates `dovetail`, that is if one mate alignment extends past the beginning of the other such that the wrong mate begins upstream, consider that to be concordant. Default=False"/> | |
332 <param name="no_contain" type="boolean" truevalue="--no-contain" falsevalue="" checked="False" label="Disallow one mate alignment to contain another" help="--no-contain; If one mate alignment contains the other, consider that to be non-concordant. Default=False"/> | |
333 <param name="no_overlap" type="boolean" truevalue="--no-overlap" falsevalue="" checked="False" label="Disallow mate alignments to overlap" help="--no-overlap; If one mate alignment overlaps the other at all, consider that to be non-concordant. Default=False"/> | |
334 </when> | |
335 <when value="no"> | |
336 <!-- do nothing --> | |
337 </when> | |
338 </conditional> | |
339 </when> | 339 </when> |
340 </conditional> | 340 </conditional> |
341 | 341 |
342 <!-- reference genome --> | 342 <!-- reference genome --> |
343 <conditional name="reference_genome"> | 343 <conditional name="reference_genome"> |
646 | 646 |
647 <tests> | 647 <tests> |
648 <test> | 648 <test> |
649 <!-- basic test on single paired default run --> | 649 <!-- basic test on single paired default run --> |
650 <param name="type" value="paired"/> | 650 <param name="type" value="paired"/> |
651 <param name="selection" value="no"/> | |
652 <param name="paired_options_selector" value="no"/> | 651 <param name="paired_options_selector" value="no"/> |
653 <param name="unaligned_file" value="false"/> | 652 <param name="unaligned_file" value="false"/> |
654 <param name="analysis_type_selector" value="simple"/> | 653 <param name="analysis_type_selector" value="simple"/> |
655 <param name="source" value="history" /> | 654 <param name="source" value="history" /> |
656 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/> | 655 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/> |
659 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> | 658 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> |
660 </test> | 659 </test> |
661 <test> | 660 <test> |
662 <!-- basic test on single paired default run --> | 661 <!-- basic test on single paired default run --> |
663 <param name="type" value="paired"/> | 662 <param name="type" value="paired"/> |
664 <param name="selection" value="no"/> | |
665 <param name="paired_options_selector" value="no"/> | 663 <param name="paired_options_selector" value="no"/> |
666 <param name="unaligned_file" value="false"/> | 664 <param name="unaligned_file" value="false"/> |
667 <param name="analysis_type_selector" value="simple"/> | 665 <param name="analysis_type_selector" value="simple"/> |
668 <param name="rg_selector" value="set"/> | 666 <param name="rg_selector" value="set"/> |
669 <param name="ID" value="rg1"/> | 667 <param name="ID" value="rg1"/> |
675 <output name="output" file="bowtie2-test2.bam" ftype="bam" lines_diff="2"/> | 673 <output name="output" file="bowtie2-test2.bam" ftype="bam" lines_diff="2"/> |
676 </test> | 674 </test> |
677 <test> | 675 <test> |
678 <!-- basic test on single paired default run with stats--> | 676 <!-- basic test on single paired default run with stats--> |
679 <param name="type" value="paired"/> | 677 <param name="type" value="paired"/> |
680 <param name="selection" value="no"/> | |
681 <param name="paired_options_selector" value="no"/> | 678 <param name="paired_options_selector" value="no"/> |
682 <param name="unaligned_file" value="false"/> | 679 <param name="unaligned_file" value="false"/> |
683 <param name="analysis_type_selector" value="simple"/> | 680 <param name="analysis_type_selector" value="simple"/> |
684 <param name="source" value="history" /> | 681 <param name="source" value="history" /> |
685 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/> | 682 <param name="input_1" value="bowtie2-fq1.fq" ftype="fastqsanger"/> |
686 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/> | 683 <param name="input_2" value="bowtie2-fq2.fq" ftype="fastqsanger"/> |
687 <param name="own_file" value="bowtie2-ref.fasta" /> | 684 <param name="own_file" value="bowtie2-ref.fasta" /> |
688 <param name="save_mapping_stats" value="true" /> | 685 <param name="save_mapping_stats" value="true" /> |
689 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> | 686 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> |
690 <output name="mapping_stats" file="bowtie2-stats.out" ftype="txt"/> | 687 <output name="mapping_stats"> |
688 <assert_contents> | |
689 <has_text text="of these" /> | |
690 </assert_contents> | |
691 </output> | |
692 </test> | |
693 <test> | |
694 <!-- basic test on interleaved paired default run --> | |
695 <param name="type" value="paired_interleaved"/> | |
696 <!-- <param name="paired_options_selector" value="no"/> --> | |
697 <param name="unaligned_file" value="false"/> | |
698 <param name="analysis_type_selector" value="simple"/> | |
699 <param name="rg_selector" value="set"/> | |
700 <param name="ID" value="rg1"/> | |
701 <param name="PL" value="CAPILLARY"/> | |
702 <param name="source" value="history" /> | |
703 <param name="input_1" value="bowtie2-fq_il.fq" ftype="fastqsanger"/> | |
704 <param name="own_file" value="bowtie2-ref.fasta" /> | |
705 <output name="output" file="bowtie2-test_il.bam" ftype="bam" lines_diff="2"/> | |
691 </test> | 706 </test> |
692 <test> | 707 <test> |
693 <!-- test fastqsanger.gz input --> | 708 <!-- test fastqsanger.gz input --> |
694 <param name="type" value="paired"/> | 709 <param name="type" value="paired"/> |
695 <param name="selection" value="no"/> | |
696 <param name="paired_options_selector" value="no"/> | 710 <param name="paired_options_selector" value="no"/> |
697 <param name="unaligned_file" value="false"/> | 711 <param name="unaligned_file" value="false"/> |
698 <param name="analysis_type_selector" value="simple"/> | 712 <param name="analysis_type_selector" value="simple"/> |
699 <param name="source" value="history" /> | 713 <param name="source" value="history" /> |
700 <param name="input_1" value="bowtie2-fq1.fq.gz" ftype="fastqsanger.gz"/> | 714 <param name="input_1" value="bowtie2-fq1.fq.gz" ftype="fastqsanger.gz"/> |
703 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> | 717 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> |
704 </test> | 718 </test> |
705 <test> | 719 <test> |
706 <!-- test fastqsanger.bz2 input --> | 720 <!-- test fastqsanger.bz2 input --> |
707 <param name="type" value="paired"/> | 721 <param name="type" value="paired"/> |
708 <param name="selection" value="no"/> | |
709 <param name="paired_options_selector" value="no"/> | 722 <param name="paired_options_selector" value="no"/> |
710 <param name="unaligned_file" value="false"/> | 723 <param name="unaligned_file" value="false"/> |
711 <param name="analysis_type_selector" value="simple"/> | 724 <param name="analysis_type_selector" value="simple"/> |
712 <param name="source" value="history" /> | 725 <param name="source" value="history" /> |
713 <param name="input_1" value="bowtie2-fq1.fq.bz2" ftype="fastqsanger.bz2"/> | 726 <param name="input_1" value="bowtie2-fq1.fq.bz2" ftype="fastqsanger.bz2"/> |
752 | 765 |
753 ----- | 766 ----- |
754 | 767 |
755 **Inputs** | 768 **Inputs** |
756 | 769 |
757 Bowtie 2 accepts files in Sanger FASTQ format (single or pair-end). Use the FASTQ Groomer to prepare your files. | 770 Bowtie 2 accepts files in Sanger FASTQ format (single or paired-end). Paired-end data can represented as two individual (forward and reverse) datasets, as well as a single interleaved dataset (see an example at the end of the help section). |
758 | 771 |
759 ------ | 772 ------ |
760 | 773 |
761 **Input options**:: | 774 **Input options**:: |
775 | |
776 --interleaved | |
777 Reads interleaved FASTQ files where the first two records (8 lines) represent a mate pair. | |
762 | 778 |
763 -s/--skip <int> | 779 -s/--skip <int> |
764 Skip (i.e. do not align) the first `<int>` reads or pairs in the input. | 780 Skip (i.e. do not align) the first `<int>` reads or pairs in the input. |
765 | 781 |
766 -u/--qupto <int> | 782 -u/--qupto <int> |
1135 current time. This means that Bowtie 2 will not necessarily report the same | 1151 current time. This means that Bowtie 2 will not necessarily report the same |
1136 alignment for two identical reads. This is counter-intuitive for some users, | 1152 alignment for two identical reads. This is counter-intuitive for some users, |
1137 but might be more appropriate in situations where the input consists of many | 1153 but might be more appropriate in situations where the input consists of many |
1138 identical reads. | 1154 identical reads. |
1139 | 1155 |
1156 ----- | |
1157 | |
1158 | |
1159 **Paired-end (and mate-pair) data in fastq format** | |
1160 | |
1161 Paired end datasets can be represented as two individual datasets: | |
1162 | |
1163 First dataset:: | |
1164 | |
1165 @1/1 | |
1166 AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA | |
1167 + | |
1168 EGGEGGGDFGEEEAEECGDEGGFEEGEFGBEEDDECFEFDD@CDD<ED | |
1169 @2/1 | |
1170 AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA | |
1171 + | |
1172 HHHHHHEGFHEEFEEHEEHHGGEGGGGEFGFGGGGHHHHFBEEEEEFG | |
1173 | |
1174 Second dataset:: | |
1175 | |
1176 @1/2 | |
1177 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC | |
1178 + | |
1179 GHHHDFDFGFGEGFBGEGGEGEGGGHGFGHFHFHHHHHHHEF?EFEFF | |
1180 @2/2 | |
1181 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC | |
1182 + | |
1183 HHHHHHHHHHHHHGHHHHHHGHHHHHHHHHHHFHHHFHHHHHHHHHHH | |
1184 | |
1185 Or a single *interleaved* dataset:: | |
1186 | |
1187 @1/1 | |
1188 AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA | |
1189 + | |
1190 EGGEGGGDFGEEEAEECGDEGGFEEGEFGBEEDDECFEFDD@CDD<ED | |
1191 @1/2 | |
1192 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC | |
1193 + | |
1194 GHHHDFDFGFGEGFBGEGGEGEGGGHGFGHFHFHHHHHHHEF?EFEFF | |
1195 @2/1 | |
1196 AGGGATGTGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA | |
1197 + | |
1198 HHHHHHEGFHEEFEEHEEHHGGEGGGGEFGFGGGGHHHHFBEEEEEFG | |
1199 @2/2 | |
1200 CCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC | |
1201 + | |
1202 HHHHHHHHHHHHHGHHHHHHGHHHHHHHHHHHFHHHFHHHHHHHHHHH | |
1203 | |
1204 | |
1205 | |
1206 | |
1140 ]]></help> | 1207 ]]></help> |
1141 <citations> | 1208 <citations> |
1142 <citation type="doi">10.1186/gb-2009-10-3-r25</citation> | 1209 <citation type="doi">10.1186/gb-2009-10-3-r25</citation> |
1143 <citation type="doi">10.1038/nmeth.1923</citation> | 1210 <citation type="doi">10.1038/nmeth.1923</citation> |
1144 </citations> | 1211 </citations> |