Mercurial > repos > devteam > bowtie2
comparison bowtie2_wrapper.xml @ 11:b4e9cf5f2ae8 draft
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/bowtie2 commit d0e857ba2691ca15b6239890baf98dbe7bc3ccbd
author | devteam |
---|---|
date | Tue, 03 Jan 2017 10:51:03 -0500 |
parents | a9d4f71dbfb0 |
children | 781e3a3b9d31 |
comparison
equal
deleted
inserted
replaced
10:a9d4f71dbfb0 | 11:b4e9cf5f2ae8 |
---|---|
1 <tool id="bowtie2" name="Bowtie2" version="2.2.6.2"> | 1 <tool id="bowtie2" name="Bowtie2" version="2.2.8"> |
2 <description>- map reads against reference genome</description> | 2 <description>- map reads against reference genome</description> |
3 <macros> | 3 <macros> |
4 <import>read_group_macros.xml</import> | 4 <import>read_group_macros.xml</import> |
5 </macros> | 5 </macros> |
6 <requirements> | |
7 <requirement type="package" version="2.2.8">bowtie2</requirement> | |
8 <requirement type="package" version="1.3.1">samtools</requirement> | |
9 </requirements> | |
6 <version_command>bowtie2 --version</version_command> | 10 <version_command>bowtie2 --version</version_command> |
7 <requirements> | 11 <command detect_errors="exit_code"><![CDATA[ |
8 <requirement type="package" version="2.2.6">bowtie2</requirement> | |
9 <requirement type="package" version="1.2">samtools</requirement> | |
10 </requirements> | |
11 <command> | |
12 ## prepare bowtie2 index | 12 ## prepare bowtie2 index |
13 #set index_path = '' | 13 #set index_path = '' |
14 #if str($reference_genome.source) == "history": | 14 #if str($reference_genome.source) == "history": |
15 bowtie2-build "$reference_genome.own_file" genome && | 15 bowtie2-build --threads \${GALAXY_SLOTS:-4} '$reference_genome.own_file' genome && |
16 ln -s "$reference_genome.own_file" genome.fa && | 16 ln -s -f '$reference_genome.own_file' genome.fa && |
17 #set index_path = 'genome' | 17 #set index_path = 'genome' |
18 #else: | 18 #else: |
19 #set index_path = $reference_genome.index.fields.path | 19 #set index_path = '$reference_genome.index.fields.path' |
20 #end if | 20 #end if |
21 | 21 |
22 ## execute bowtie2 | 22 ## execute bowtie2 |
23 | 23 |
24 bowtie2 | 24 bowtie2 |
25 | 25 |
26 ## number of threads | 26 ## number of threads |
27 -p \${GALAXY_SLOTS:-4} | 27 -p \${GALAXY_SLOTS:-4} |
28 | 28 |
29 ## index file path | 29 ## index file path |
30 -x $index_path | 30 -x '$index_path' |
31 | 31 |
32 ## Fastq inputs | 32 ## Fastq inputs |
33 #if str( $library.type ) == "single": | 33 #if str( $library.type ) == "single": |
34 -U "${library.input_1}" | 34 -U '${library.input_1}' |
35 #if str( $library.unaligned_file ) == "true": | 35 #if str( $library.unaligned_file ) == "true": |
36 --un $output_unaligned_reads_l | 36 --un '$output_unaligned_reads_l' |
37 #end if | 37 #end if |
38 #if str( $library.aligned_file ) == "true": | 38 #if str( $library.aligned_file ) == "true": |
39 --al $output_aligned_reads_l | 39 --al '$output_aligned_reads_l' |
40 #end if | 40 #end if |
41 #elif str( $library.type ) == "paired": | 41 #elif str( $library.type ) == "paired": |
42 -1 "${library.input_1}" | 42 -1 '${library.input_1}' |
43 -2 "${library.input_2}" | 43 -2 '${library.input_2}' |
44 #if str( $library.paired_options.paired_options_selector ) == "yes": | 44 #if str( $library.paired_options.paired_options_selector ) == "yes": |
45 -I "${library.paired_options.I}" | 45 -I "${library.paired_options.I}" |
46 -X "${library.paired_options.X}" | 46 -X "${library.paired_options.X}" |
47 ${library.paired_options.fr_rf_ff} | 47 ${library.paired_options.fr_rf_ff} |
48 ${library.paired_options.no_mixed} | 48 ${library.paired_options.no_mixed} |
70 ${library.paired_options.dovetail} | 70 ${library.paired_options.dovetail} |
71 ${library.paired_options.no_contain} | 71 ${library.paired_options.no_contain} |
72 ${library.paired_options.no_overlap} | 72 ${library.paired_options.no_overlap} |
73 #end if | 73 #end if |
74 #if str( $library.unaligned_file ) == "true": | 74 #if str( $library.unaligned_file ) == "true": |
75 --un-conc $output_unaligned_reads_l | 75 --un-conc '$output_unaligned_reads_l' |
76 #end if | 76 #end if |
77 #end if | 77 #end if |
78 | 78 |
79 ## Read group information. | 79 ## Read group information. |
80 @define_read_group_helpers@ | 80 @define_read_group_helpers@ |
172 ${analysis_type.cline} | 172 ${analysis_type.cline} |
173 #end if | 173 #end if |
174 | 174 |
175 ## mapping stats (i.e. stderr from bowtie2) | 175 ## mapping stats (i.e. stderr from bowtie2) |
176 #if $save_mapping_stats | 176 #if $save_mapping_stats |
177 2> "$mapping_stats" | 177 2> '$mapping_stats' |
178 #end if | 178 #end if |
179 | 179 |
180 ## output file | 180 ## output file |
181 #if ( str( $analysis_type.analysis_type_selector ) != "full" or str( $analysis_type.sam_opt ) != "true" ): | 181 #if ( str( $analysis_type.analysis_type_selector ) != "full" or str( $analysis_type.sam_opt ) != "true" ): |
182 | samtools view -Su - | samtools sort -o - - > $output | 182 | samtools sort -O bam -o '$output' |
183 #else | 183 #else |
184 > $output_sam | 184 > '$output_sam' |
185 #end if | 185 #end if |
186 | 186 |
187 ## rename unaligned sequence files | 187 ## rename unaligned sequence files |
188 #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r: | 188 #if $library.type == "paired" and $output_unaligned_reads_l and $output_unaligned_reads_r: |
189 #from os.path import splitext | 189 #from os.path import splitext |
190 #set _unaligned_root, _unaligned_ext = splitext( str( $output_unaligned_reads_l ) ) | 190 #set _unaligned_root, _unaligned_ext = splitext( str( $output_unaligned_reads_l ) ) |
191 && mv "${ _unaligned_root }.1${_unaligned_ext}" "${ output_unaligned_reads_l }" | 191 && mv "${ _unaligned_root }.1${_unaligned_ext}" '$output_unaligned_reads_l' |
192 && mv "${ _unaligned_root }.2${_unaligned_ext}" "${ output_unaligned_reads_r }" | 192 && mv "${ _unaligned_root }.2${_unaligned_ext}" '$output_unaligned_reads_r' |
193 #end if | 193 #end if |
194 #if $library.type == "paired" and $output_aligned_reads_l and $output_aligned_reads_r: | 194 #if $library.type == "paired" and $output_aligned_reads_l and $output_aligned_reads_r: |
195 #from os.path import splitext | 195 #from os.path import splitext |
196 #set _aligned_root, _aligned_ext = splitext( str( $output_aligned_reads_l ) ) | 196 #set _aligned_root, _aligned_ext = splitext( str( $output_aligned_reads_l ) ) |
197 && mv "${ _aligned_root }.1${_aligned_ext}" "${ output_aligned_reads_l }" | 197 && mv "${ _aligned_root }.1${_aligned_ext}" '$output_aligned_reads_l' |
198 && mv "${ _aligned_root }.2${_aligned_ext}" "${ output_aligned_reads_r }" | 198 && mv "${ _aligned_root }.2${_aligned_ext}" '$output_aligned_reads_r' |
199 #end if | 199 #end if |
200 | 200 |
201 </command> | 201 ]]></command> |
202 <!-- basic error handling --> | |
203 <stdio> | |
204 <exit_code range="1:" level="fatal" description="Tool exception" /> | |
205 </stdio> | |
206 | |
207 <inputs> | 202 <inputs> |
208 <!-- single/paired --> | 203 <!-- single/paired --> |
209 <conditional name="library"> | 204 <conditional name="library"> |
210 <param name="type" type="select" label="Is this single or paired library"> | 205 <param name="type" type="select" label="Is this single or paired library"> |
211 <option value="single">Single-end</option> | 206 <option value="single">Single-end</option> |
274 <!-- do nothing --> | 269 <!-- do nothing --> |
275 </when> | 270 </when> |
276 </conditional> | 271 </conditional> |
277 </when> | 272 </when> |
278 </conditional> | 273 </conditional> |
279 | 274 |
280 <!-- reference genome --> | 275 <!-- reference genome --> |
281 <conditional name="reference_genome"> | 276 <conditional name="reference_genome"> |
282 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options. See `Indexes` section of help below"> | 277 <param name="source" type="select" label="Will you select a reference genome from your history or use a built-in index?" help="Built-ins were indexed using default options. See `Indexes` section of help below"> |
283 <option value="indexed">Use a built-in genome index</option> | 278 <option value="indexed">Use a built-in genome index</option> |
284 <option value="history">Use a genome from the history and build index</option> | 279 <option value="history">Use a genome from the history and build index</option> |
290 <validator type="no_options" message="No indexes are available for the selected input dataset"/> | 285 <validator type="no_options" message="No indexes are available for the selected input dataset"/> |
291 </options> | 286 </options> |
292 </param> | 287 </param> |
293 </when> | 288 </when> |
294 <when value="history"> | 289 <when value="history"> |
295 <param name="own_file" type="data" format="fasta" metadata_name="dbkey" label="Select reference genome" /> | 290 <param name="own_file" type="data" format="fasta" label="Select reference genome" /> |
296 </when> | 291 </when> |
297 </conditional> | 292 </conditional> |
298 | 293 |
299 <!-- read group settings --> | 294 <!-- read group settings --> |
300 <expand macro="read_group_conditional" /> | 295 <expand macro="read_group_conditional" /> |
301 <conditional name="analysis_type"> | 296 <conditional name="analysis_type"> |
302 <param name="analysis_type_selector" type="select" label="Select analysis mode"> | 297 <param name="analysis_type_selector" type="select" label="Select analysis mode"> |
303 <option value="simple">1: Default setting only</option> | 298 <option value="simple">1: Default setting only</option> |
348 <param name="L" type="integer" min="0" max="32" value="22" label="Sets the length of the seed substrings to align during multiseed alignment (see `Multiseed alignment` section of help below)" help="-L; Smaller values make alignment slower but more sensitive. Default=22"/> | 343 <param name="L" type="integer" min="0" max="32" value="22" label="Sets the length of the seed substrings to align during multiseed alignment (see `Multiseed alignment` section of help below)" help="-L; Smaller values make alignment slower but more sensitive. Default=22"/> |
349 <param name="i" type="text" value="S,1,1.15" label="Set a function governing the interval between seed substrings to use during multiseed alignment (see `Multiseed alignment` section of help below). Also see description of this option below in the help section" help="-i; Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. If the function returns a result less than 1, it is rounded up to 1. Default=`S,1,1.15`"/> | 344 <param name="i" type="text" value="S,1,1.15" label="Set a function governing the interval between seed substrings to use during multiseed alignment (see `Multiseed alignment` section of help below). Also see description of this option below in the help section" help="-i; Since it's best to use longer intervals for longer reads, this parameter sets the interval as a function of the read length, rather than a single one-size-fits-all number. For instance, specifying `-i S,1,2.5` sets the interval function `f` to `f(x) = 1 + 2.5 * sqrt(x)`, where x is the read length. If the function returns a result less than 1, it is rounded up to 1. Default=`S,1,1.15`"/> |
350 <param name="n_ceil" type="text" value="L,0,0.15" label="Set a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length" help="--n-ceil; For instance, specifying `L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, where x is the read length. Reads exceeding this ceiling are filtered out. Default=`L,0,0.15`"/> | 345 <param name="n_ceil" type="text" value="L,0,0.15" label="Set a function governing the maximum number of ambiguous characters (usually `N`s and/or `.`s) allowed in a read as a function of read length" help="--n-ceil; For instance, specifying `L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, where x is the read length. Reads exceeding this ceiling are filtered out. Default=`L,0,0.15`"/> |
351 <param name="dpad" type="integer" min="0" value="15" label="Pad dynamic programming problems by that many columns on either side to allow gaps" help="--dpad; default=15"/> | 346 <param name="dpad" type="integer" min="0" value="15" label="Pad dynamic programming problems by that many columns on either side to allow gaps" help="--dpad; default=15"/> |
352 <param name="gbar" type="integer" min="0" value="4" label="Disallow gaps within that many positions of the beginning or end of the read" help="--gbar; default=4"/> | 347 <param name="gbar" type="integer" min="0" value="4" label="Disallow gaps within that many positions of the beginning or end of the read" help="--gbar; default=4"/> |
353 <param name="ignore_quals" type="boolean" truevalue="--ignore-quals" falsevalue="" selected="False" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/> | 348 <param name="ignore_quals" type="boolean" truevalue="--ignore-quals" falsevalue="" label="When calculating a mismatch penalty, always consider the quality value at the mismatched position to be the highest possible, regardless of the actual value" help="--ignore-quals; input is treated as though all quality values are high; default=False"/> |
354 <param name="nofw" type="boolean" truevalue="--nofw" falsevalue="" selected="False" label="Do not attempt to align unpaired reads to the forward (Watson) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/> | 349 <param name="nofw" type="boolean" truevalue="--nofw" falsevalue="" label="Do not attempt to align unpaired reads to the forward (Watson) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/> |
355 <param name="norc" type="boolean" truevalue="--norc" falsevalue="" selected="False" label="Do not attempt to align unpaired reads to the reverse (Crick) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/> | 350 <param name="norc" type="boolean" truevalue="--norc" falsevalue="" label="Do not attempt to align unpaired reads to the reverse (Crick) reference strand" help="In paired-end mode, `--nofw` and `--norc` pertain to the fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those paired-end configurations corresponding to fragments from the reverse-complement (Crick) strand. Default=False"/> |
356 <param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" selected="False" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help below)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read *before* trying the multiseed heuristic. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected alignments when the user also sets options governing the multiseed heuristic, like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the multiseed heuristic, which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/> | 351 <param name="no_1mm_upfront" type="boolean" truevalue="--no-1mm-upfront" falsevalue="" label="Prevent searching for 1-mismatch end-to-end alignments before using the multiseed heuristic (see `Multiseed alignment` section of help below)" help="--no-1mm-upfront; By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch end-to-end alignment for the read *before* trying the multiseed heuristic. Such alignments can be found very quickly, and many short read alignments have exact or near-exact end-to-end alignments. However, this can lead to unexpected alignments when the user also sets options governing the multiseed heuristic, like `-L` and `-N`. For instance, if the user specifies `-N 0` and `-L` equal to the length of the read, the user will be surprised to find 1-mismatch alignments reported. This option prevents Bowtie 2 from searching for 1-mismatch end-to-end alignments before using the multiseed heuristic, which leads to the expected behavior when combined with options such as `-L` and `-N`. This comes at the expense of speed; Default=False"/> |
357 <conditional name="align_mode"> | 352 <conditional name="align_mode"> |
358 <param name="align_mode_selector" type="select" display="radio" label="Select between `--local` and `--end-to-end` alignment modes" help="--local and --end-to-end; see help below for detailed explanation; default=--end-to-end"> | 353 <param name="align_mode_selector" type="select" display="radio" label="Select between `--local` and `--end-to-end` alignment modes" help="--local and --end-to-end; see help below for detailed explanation; default=--end-to-end"> |
359 <option value="end-to-end" selected="True">End to End (--end-to-end)</option> | 354 <option value="end-to-end" selected="True">End to End (--end-to-end)</option> |
360 <option value="local">Local (--local)</option> | 355 <option value="local">Local (--local)</option> |
361 </param> | 356 </param> |
416 </when> | 411 </when> |
417 <when value="no"> | 412 <when value="no"> |
418 <!-- do nothing --> | 413 <!-- do nothing --> |
419 </when> | 414 </when> |
420 </conditional> | 415 </conditional> |
421 | 416 |
422 <conditional name="sam_options"> | 417 <conditional name="sam_options"> |
423 <param name="sam_options_selector" type="select" label="Do you want to tweak SAM/BAM Options?" help="See "Output Options" section of Help below for information"> | 418 <param name="sam_options_selector" type="select" label="Do you want to tweak SAM/BAM Options?" help="See "Output Options" section of Help below for information"> |
424 <option value="yes">Yes</option> | 419 <option value="yes">Yes</option> |
425 <option value="no" selected="true">No</option> | 420 <option value="no" selected="true">No</option> |
426 </param> | 421 </param> |
451 </conditional> | 446 </conditional> |
452 <param name="save_mapping_stats" type="boolean" checked="False" label="Save the bowtie2 mapping statistics to the history" /> | 447 <param name="save_mapping_stats" type="boolean" checked="False" label="Save the bowtie2 mapping statistics to the history" /> |
453 </inputs> | 448 </inputs> |
454 | 449 |
455 <!-- define outputs --> | 450 <!-- define outputs --> |
456 | 451 |
457 <outputs> | 452 <outputs> |
458 | 453 |
459 <data format="fastqsanger" name="output_unaligned_reads_l" label="${tool.name} on ${on_string}: unaligned reads (L)" > | 454 <data format="fastqsanger" name="output_unaligned_reads_l" label="${tool.name} on ${on_string}: unaligned reads (L)" > |
460 <filter>library['unaligned_file'] is True</filter> | 455 <filter>library['unaligned_file'] is True</filter> |
461 <actions> | 456 <actions> |
462 <conditional name="library.type"> | 457 <conditional name="library.type"> |
463 <when value="single"> | 458 <when value="single"> |
532 </action> | 527 </action> |
533 </when> | 528 </when> |
534 </conditional> | 529 </conditional> |
535 </actions> | 530 </actions> |
536 </data> | 531 </data> |
537 | 532 |
538 <data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads (sorted BAM)"> | 533 <data format="bam" name="output" label="${tool.name} on ${on_string}: aligned reads (sorted BAM)"> |
539 <filter>analysis_type['analysis_type_selector'] == "simple" or analysis_type['sam_opt'] is False</filter> | 534 <filter>analysis_type['analysis_type_selector'] == "simple" or analysis_type['sam_opt'] is False</filter> |
540 <actions> | 535 <actions> |
541 <conditional name="reference_genome.source"> | 536 <conditional name="reference_genome.source"> |
542 <when value="indexed"> | 537 <when value="indexed"> |
627 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> | 622 <output name="output" file="bowtie2-test1.bam" ftype="bam" lines_diff="2"/> |
628 <output name="mapping_stats" file="bowtie2-stats.out" ftype="txt"/> | 623 <output name="mapping_stats" file="bowtie2-stats.out" ftype="txt"/> |
629 </test> | 624 </test> |
630 </tests> | 625 </tests> |
631 | 626 |
632 <help> | 627 <help><![CDATA[ |
633 | 628 |
634 **Bowtie2 Overview** | 629 **Bowtie2 Overview** |
635 | 630 |
636 Bowtie2_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Galaxy wrapper for Bowtie 2 outputs alignments in `BAM format`_, enabling interoperation with a large number of other tools available at this site. | 631 Bowtie2_ is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes. Bowtie 2 supports gapped, local, and paired-end alignment modes. Galaxy wrapper for Bowtie 2 outputs alignments in `BAM format`_, enabling interoperation with a large number of other tools available at this site. |
637 Majority of information in this page is derived from an excellent `Bowtie2 manual`_ written by Ben Langmead. | 632 Majority of information in this page is derived from an excellent `Bowtie2 manual`_ written by Ben Langmead. |
638 | 633 |
639 .. _Bowtie2: http://bowtie-bio.sourceforge.net/bowtie2/ | 634 .. _Bowtie2: http://bowtie-bio.sourceforge.net/bowtie2/ |
640 .. _`Bowtie2 manual`: http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml | 635 .. _`Bowtie2 manual`: http://bowtie-bio.sourceforge.net/bowtie2/manual.shtml |
644 | 639 |
645 **Selecting reference genomes for Bowtie2** | 640 **Selecting reference genomes for Bowtie2** |
646 | 641 |
647 Galaxy wrapper for Bowtie2 allows you select between precomputed and user-defined indices for reference genomes using **Will you select a reference genome from your history or use a built-in index?** flag. This flag has two options: | 642 Galaxy wrapper for Bowtie2 allows you select between precomputed and user-defined indices for reference genomes using **Will you select a reference genome from your history or use a built-in index?** flag. This flag has two options: |
648 | 643 |
649 1. **Use a built-in genome index** - when selected (this is default), Galaxy provides the user with **Select reference genome index** dropdown. Genomes listed in this dropdown have been pre-indexed with bowtie2-build utility and are ready to be mapped against. | 644 1. **Use a built-in genome index** - when selected (this is default), Galaxy provides the user with **Select reference genome index** dropdown. Genomes listed in this dropdown have been pre-indexed with bowtie2-build utility and are ready to be mapped against. |
650 2. **Use a genome from the history and build index** - when selected, Galaxy provides the user with **Select reference genome sequence** dropdown. This dropdown is populated by all FASTA formatted files listed in your current history. If your genome of interest is uploaded into history it will be shown there. Selecting a genome from this dropdown will cause Galaxy to first transparently index it using bowtie2-build command, and then run mapping with bowtie2. | 645 2. **Use a genome from the history and build index** - when selected, Galaxy provides the user with **Select reference genome sequence** dropdown. This dropdown is populated by all FASTA formatted files listed in your current history. If your genome of interest is uploaded into history it will be shown there. Selecting a genome from this dropdown will cause Galaxy to first transparently index it using bowtie2-build command, and then run mapping with bowtie2. |
651 | 646 |
652 If your genome of interest is not listed here you have two choices: | 647 If your genome of interest is not listed here you have two choices: |
653 | 648 |
654 1. Contact galaxy team using **Help->Support** link at the top of the interface and let us know that an index needs to be added | 649 1. Contact galaxy team using **Help->Support** link at the top of the interface and let us know that an index needs to be added |
655 2. Upload your genome of interest as a FASTA file to Galaxy history and selected **Use a genome from the history and build index** option. | 650 2. Upload your genome of interest as a FASTA file to Galaxy history and selected **Use a genome from the history and build index** option. |
656 | 651 |
670 | 665 |
671 ------ | 666 ------ |
672 | 667 |
673 **Input options**:: | 668 **Input options**:: |
674 | 669 |
675 -s/--skip <int> | 670 -s/--skip <int> |
676 Skip (i.e. do not align) the first `<int>` reads or pairs in the input. | 671 Skip (i.e. do not align) the first `<int>` reads or pairs in the input. |
677 | 672 |
678 -u/--qupto <int> | 673 -u/--qupto <int> |
679 Align the first `<int>` reads or read pairs from the input (after the | 674 Align the first `<int>` reads or read pairs from the input (after the |
680 `-s`/`--skip` reads or pairs have been skipped), then stop. Default: no limit. | 675 `-s`/`--skip` reads or pairs have been skipped), then stop. Default: no limit. |
681 | 676 |
682 -5/--trim5 <int> | 677 -5/--trim5 <int> |
683 Trim `<int>` bases from 5' (left) end of each read before alignment (default: 0). | 678 Trim `<int>` bases from 5' (left) end of each read before alignment (default: 0). |
684 | 679 |
685 -3/--trim3 <int> | 680 -3/--trim3 <int> |
686 Trim `<int>` bases from 3' (right) end of each read before alignment (default: 0). | 681 Trim `<int>` bases from 3' (right) end of each read before alignment (default: 0). |
687 | 682 |
688 --phred33 | 683 --phred33 |
689 Input qualities are ASCII chars equal to the Phred quality plus 33. This is | 684 Input qualities are ASCII chars equal to the Phred quality plus 33. This is |
690 also called the "Phred+33" encoding, which is used by the very latest Illumina | 685 also called the "Phred+33" encoding, which is used by the very latest Illumina |
691 pipelines. | 686 pipelines. |
701 | 696 |
702 --int-quals | 697 --int-quals |
703 Quality values are represented in the read input file as space-separated ASCII integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`.... | 698 Quality values are represented in the read input file as space-separated ASCII integers, e.g., `40 40 30 40`..., rather than ASCII characters, e.g., `II?I`.... |
704 Integers are treated as being on the Phred quality scale unless | 699 Integers are treated as being on the Phred quality scale unless |
705 `--solexa-quals` is also specified. Default: off. | 700 `--solexa-quals` is also specified. Default: off. |
706 | 701 |
707 ------ | 702 ------ |
708 | 703 |
709 **Presets in `--end-to-end` mode**:: | 704 **Presets in `--end-to-end` mode**:: |
710 | 705 |
711 --very-fast | 706 --very-fast |
712 Same as: `-D 5 -R 1 -N 0 -L 22 -i S,0,2.50` | 707 Same as: `-D 5 -R 1 -N 0 -L 22 -i S,0,2.50` |
713 | 708 |
714 --fast | 709 --fast |
715 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,0,2.50` | 710 Same as: `-D 10 -R 2 -N 0 -L 22 -i S,0,2.50` |
716 | 711 |
717 --sensitive | 712 --sensitive |
718 Same as: `-D 15 -R 2 -L 22 -i S,1,1.15` (default in `--end-to-end` mode) | 713 Same as: `-D 15 -R 2 -L 22 -i S,1,1.15` (default in `--end-to-end` mode) |
719 | 714 |
720 --very-sensitive | 715 --very-sensitive |
721 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50` | 716 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50` |
733 --sensitive-local | 728 --sensitive-local |
734 Same as: `-D 15 -R 2 -N 0 -L 20 -i S,1,0.75` (default in `--local` mode) | 729 Same as: `-D 15 -R 2 -N 0 -L 20 -i S,1,0.75` (default in `--local` mode) |
735 | 730 |
736 --very-sensitive-local | 731 --very-sensitive-local |
737 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50` | 732 Same as: `-D 20 -R 3 -N 0 -L 20 -i S,1,0.50` |
738 | 733 |
739 ------ | 734 ------ |
740 | 735 |
741 **Alignment options**:: | 736 **Alignment options**:: |
742 | 737 |
743 -N <int> | 738 -N <int> |
744 Sets the number of mismatches to allowed in a seed alignment during multiseed | 739 Sets the number of mismatches to allowed in a seed alignment during multiseed |
745 alignment. Can be set to 0 or 1. Setting this higher makes alignment slower | 740 alignment. Can be set to 0 or 1. Setting this higher makes alignment slower |
746 (often much slower) but increases sensitivity. Default: 0. | 741 (often much slower) but increases sensitivity. Default: 0. |
747 | 742 |
748 -L <int> | 743 -L <int> |
749 Sets the length of the seed substrings to align during multiseed alignment. | 744 Sets the length of the seed substrings to align during multiseed alignment. |
750 Smaller values make alignment slower but more sensitive. Default: the | 745 Smaller values make alignment slower but more sensitive. Default: the |
751 `--sensitive` preset is used by default, which sets `-L` to 22 in | 746 `--sensitive` preset is used by default, which sets `-L` to 22 in |
752 `--end-to-end` mode and to 20 in `--local` mode. | 747 `--end-to-end` mode and to 20 in `--local` mode. |
753 | 748 |
754 -i <func> | 749 -i <func> |
755 Sets a function governing the interval between seed substrings to use during | 750 Sets a function governing the interval between seed substrings to use during |
756 multiseed alignment. For instance, if the read has 30 characers, and seed | 751 multiseed alignment. For instance, if the read has 30 characers, and seed |
757 length is 10, and the seed interval is 6, the seeds extracted will be: | 752 length is 10, and the seed interval is 6, the seeds extracted will be: |
758 | 753 |
759 Read: TAGCTACGCTCTACGCTATCATGCATAAAC | 754 Read: TAGCTACGCTCTACGCTATCATGCATAAAC |
773 If the function returns a result less than | 768 If the function returns a result less than |
774 1, it is rounded up to 1. Default: the `--sensitive` preset is used by | 769 1, it is rounded up to 1. Default: the `--sensitive` preset is used by |
775 default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75` | 770 default, which sets `-i` to `S,1,1.15` in `--end-to-end` mode to `-i S,1,0.75` |
776 in `--local` mode. | 771 in `--local` mode. |
777 | 772 |
778 --n-ceil <func> | 773 --n-ceil <func> |
779 Sets a function governing the maximum number of ambiguous characters (usually | 774 Sets a function governing the maximum number of ambiguous characters (usually |
780 `N`s and/or `.`s) allowed in a read as a function of read length. For instance, | 775 `N`s and/or `.`s) allowed in a read as a function of read length. For instance, |
781 specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, | 776 specifying `-L,0,0.15` sets the N-ceiling function `f` to `f(x) = 0 + 0.15 * x`, |
782 where x is the read length. Reads exceeding this ceiling are filtered out. | 777 where x is the read length. Reads exceeding this ceiling are filtered out. |
783 Default: `L,0,0.15`. | 778 Default: `L,0,0.15`. |
784 | 779 |
785 --dpad <int> | 780 --dpad <int> |
786 "Pads" dynamic programming problems by `<int>` columns on either side to allow | 781 "Pads" dynamic programming problems by `<int>` columns on either side to allow |
787 gaps. Default: 15. | 782 gaps. Default: 15. |
788 | 783 |
789 --gbar <int> | 784 --gbar <int> |
790 Disallow gaps within `<int>` positions of the beginning or end of the read. | 785 Disallow gaps within `<int>` positions of the beginning or end of the read. |
791 Default: 4. | 786 Default: 4. |
792 | 787 |
793 --ignore-quals | 788 --ignore-quals |
794 When calculating a mismatch penalty, always consider the quality value at the | 789 When calculating a mismatch penalty, always consider the quality value at the |
795 mismatched position to be the highest possible, regardless of the actual value. | 790 mismatched position to be the highest possible, regardless of the actual value. |
796 I.e. input is treated as though all quality values are high. This is also the | 791 I.e. input is treated as though all quality values are high. This is also the |
797 default behavior when the input doesn't specify quality values (e.g. in `-f`, | 792 default behavior when the input doesn't specify quality values (e.g. in `-f`, |
798 `-r`, or `-c` modes). | 793 `-r`, or `-c` modes). |
799 | 794 |
800 --nofw/--norc | 795 --nofw/--norc |
802 the forward (Watson) reference strand. If `--norc` is specified, `bowtie2` will | 797 the forward (Watson) reference strand. If `--norc` is specified, `bowtie2` will |
803 not attempt to align unpaired reads against the reverse-complement (Crick) | 798 not attempt to align unpaired reads against the reverse-complement (Crick) |
804 reference strand. In paired-end mode, `--nofw` and `--norc` pertain to the | 799 reference strand. In paired-end mode, `--nofw` and `--norc` pertain to the |
805 fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those | 800 fragments; i.e. specifying `--nofw` causes `bowtie2` to explore only those |
806 paired-end configurations corresponding to fragments from the reverse-complement | 801 paired-end configurations corresponding to fragments from the reverse-complement |
807 (Crick) strand. Default: both strands enabled. | 802 (Crick) strand. Default: both strands enabled. |
808 | 803 |
809 --no-1mm-upfront | 804 --no-1mm-upfront |
810 By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch | 805 By default, Bowtie 2 will attempt to find either an exact or a 1-mismatch |
811 end-to-end alignment for the read *before* trying the multiseed heuristic. Such | 806 end-to-end alignment for the read *before* trying the multiseed heuristic. Such |
812 alignments can be found very quickly, and many short read alignments have exact or | 807 alignments can be found very quickly, and many short read alignments have exact or |
833 `--ma` is used in this mode, and the best possible alignment score is equal to | 828 `--ma` is used in this mode, and the best possible alignment score is equal to |
834 the match bonus (`--ma`) times the length of the read. Specifying `--local` | 829 the match bonus (`--ma`) times the length of the read. Specifying `--local` |
835 and one of the presets (e.g. `--local --very-fast`) is equivalent to specifying | 830 and one of the presets (e.g. `--local --very-fast`) is equivalent to specifying |
836 the local version of the preset (`--very-fast-local`). This is mutually | 831 the local version of the preset (`--very-fast-local`). This is mutually |
837 exclusive with `--end-to-end`. `--end-to-end` is the default mode. | 832 exclusive with `--end-to-end`. `--end-to-end` is the default mode. |
838 | 833 |
839 ----- | 834 ----- |
840 | 835 |
841 **Scoring options**:: | 836 **Scoring options**:: |
842 | 837 |
843 --ma <int> | 838 --ma <int> |
844 Sets the match bonus. In `--local` mode `<int>` is added to the alignment | 839 Sets the match bonus. In `--local` mode `<int>` is added to the alignment |
845 score for each position where a read character aligns to a reference character | 840 score for each position where a read character aligns to a reference character |
846 and the characters match. Not used in `--end-to-end` mode. Default: 2. | 841 and the characters match. Not used in `--end-to-end` mode. Default: 2. |
847 | 842 |
848 --mp MX,MN | 843 --mp MX,MN |
849 Sets the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers. A | 844 Sets the maximum (`MX`) and minimum (`MN`) mismatch penalties, both integers. A |
852 aligns to a reference character, the characters do not match, and neither is an | 847 aligns to a reference character, the characters do not match, and neither is an |
853 `N`. If `--ignore-quals` is specified, the number subtracted quals `MX`. | 848 `N`. If `--ignore-quals` is specified, the number subtracted quals `MX`. |
854 Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )` | 849 Otherwise, the number subtracted is `MN + floor( (MX-MN)(MIN(Q, 40.0)/40.0) )` |
855 where Q is the Phred quality value. Default: `MX` = 6, `MN` = 2. | 850 where Q is the Phred quality value. Default: `MX` = 6, `MN` = 2. |
856 | 851 |
857 --np <int> | 852 --np <int> |
858 Sets penalty for positions where the read, reference, or both, contain an | 853 Sets penalty for positions where the read, reference, or both, contain an |
859 ambiguous character such as `N`. Default: 1. | 854 ambiguous character such as `N`. Default: 1. |
860 | 855 |
861 --rdg <int1>,<int2> | 856 --rdg <int1>,<int2> |
862 Sets the read gap open (`<int1>`) and extend (`<int2>`) penalties. A read gap of | 857 Sets the read gap open (`<int1>`) and extend (`<int2>`) penalties. A read gap of |
863 length N gets a penalty of `<int1>` + N * `<int2>`. Default: 5, 3. | 858 length N gets a penalty of `<int1>` + N * `<int2>`. Default: 5, 3. |
864 | 859 |
865 --rfg <int1>,<int2> | 860 --rfg <int1>,<int2> |
866 Sets the reference gap open (`<int1>`) and extend (`<int2>`) penalties. A | 861 Sets the reference gap open (`<int1>`) and extend (`<int2>`) penalties. A |
867 reference gap of length N gets a penalty of `<int1>` + N * `<int2>`. Default: | 862 reference gap of length N gets a penalty of `<int1>` + N * `<int2>`. Default: |
868 5, 3. | 863 5, 3. |
869 | 864 |
870 --score-min <func> | 865 --score-min <func> |
871 Sets a function governing the minimum alignment score needed for an alignment to | 866 Sets a function governing the minimum alignment score needed for an alignment to |
872 be considered "valid" (i.e. good enough to report). This is a function of read | 867 be considered "valid" (i.e. good enough to report). This is a function of read |
873 length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` | 868 length. For instance, specifying `L,0,-0.6` sets the minimum-score function `f` |
874 to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and | 869 to `f(x) = 0 + -0.6 * x`, where `x` is the read length. The default in `--end-to-end` mode is `L,-0.6,-0.6` and |
875 the default in `--local` mode is `G,20,8`. | 870 the default in `--local` mode is `G,20,8`. |
876 | 871 |
877 ----- | 872 ----- |
878 | 873 |
879 **Reporting options**:: | 874 **Reporting options**:: |
880 | 875 |
881 -k <int> | 876 -k <int> |
882 By default, `bowtie2` searches for distinct, valid alignments for each read. | 877 By default, `bowtie2` searches for distinct, valid alignments for each read. |
883 When it finds a valid alignment, it continues looking for alignments that are | 878 When it finds a valid alignment, it continues looking for alignments that are |
884 nearly as good or better. The best alignment found is reported (randomly | 879 nearly as good or better. The best alignment found is reported (randomly |
885 selected from among best if tied). Information about the best alignments is | 880 selected from among best if tied). Information about the best alignments is |
886 used to estimate mapping quality and to set SAM optional fields, such as | 881 used to estimate mapping quality and to set SAM optional fields, such as |
887 `AS:i` and `XS:i`. | 882 `AS:i` and `XS:i`. |
888 | 883 |
889 When `-k` is specified, however, `bowtie2` behaves differently. Instead, it | 884 When `-k` is specified, however, `bowtie2` behaves differently. Instead, it |
890 searches for at most `<int>` distinct, valid alignments for each read. The | 885 searches for at most `<int>` distinct, valid alignments for each read. The |
891 search terminates when it can't find more distinct valid alignments, or when it | 886 search terminates when it can't find more distinct valid alignments, or when it |
892 finds `<int>`, whichever happens first. All alignments found are reported in | 887 finds `<int>`, whichever happens first. All alignments found are reported in |
893 descending order by alignment score. The alignment score for a paired-end | 888 descending order by alignment score. The alignment score for a paired-end |
894 alignment equals the sum of the alignment scores of the individual mates. Each | 889 alignment equals the sum of the alignment scores of the individual mates. Each |
895 reported read or pair alignment beyond the first has the SAM 'secondary' bit | 890 reported read or pair alignment beyond the first has the SAM 'secondary' bit |
896 (which equals 256) set in its FLAGS field. For reads that have more than | 891 (which equals 256) set in its FLAGS field. For reads that have more than |
897 `<int>` distinct, valid alignments, `bowtie2` does not guarantee that the | 892 `<int>` distinct, valid alignments, `bowtie2` does not guarantee that the |
898 `<int>` alignments reported are the best possible in terms of alignment score. | 893 `<int>` alignments reported are the best possible in terms of alignment score. |
899 `-k` is mutually exclusive with `-a`. | 894 `-k` is mutually exclusive with `-a`. |
900 | 895 |
901 Note: Bowtie 2 is not designed with large values for `-k` in mind, and when | 896 Note: Bowtie 2 is not designed with large values for `-k` in mind, and when |
902 aligning reads to long, repetitive genomes large `-k` can be very, very slow. | 897 aligning reads to long, repetitive genomes large `-k` can be very, very slow. |
903 | 898 |
905 Like `-k` but with no upper limit on number of alignments to search for. `-a` | 900 Like `-k` but with no upper limit on number of alignments to search for. `-a` |
906 is mutually exclusive with `-k`. | 901 is mutually exclusive with `-k`. |
907 | 902 |
908 Note: Bowtie 2 is not designed with `-a` mode in mind, and when | 903 Note: Bowtie 2 is not designed with `-a` mode in mind, and when |
909 aligning reads to long, repetitive genomes this mode can be very, very slow. | 904 aligning reads to long, repetitive genomes this mode can be very, very slow. |
910 | 905 |
911 ----- | 906 ----- |
912 | 907 |
913 **Effort options**:: | 908 **Effort options**:: |
914 | 909 |
915 -D <int> | 910 -D <int> |
916 Up to `<int>` consecutive seed extension attempts can "fail" before Bowtie 2 | 911 Up to `<int>` consecutive seed extension attempts can "fail" before Bowtie 2 |
917 moves on, using the alignments found so far. A seed extension "fails" if it | 912 moves on, using the alignments found so far. A seed extension "fails" if it |
918 does not yield a new best or a new second-best alignment. This limit is | 913 does not yield a new best or a new second-best alignment. This limit is |
919 automatically adjusted up when -k or -a are specified. Default: 15. | 914 automatically adjusted up when -k or -a are specified. Default: 15. |
920 | 915 |
921 -R <int> | 916 -R <int> |
922 `<int>` is the maximum number of times Bowtie 2 will "re-seed" reads with | 917 `<int>` is the maximum number of times Bowtie 2 will "re-seed" reads with |
923 repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set of reads | 918 repetitive seeds. When "re-seeding," Bowtie 2 simply chooses a new set of reads |
924 (same length, same number of mismatches allowed) at different offsets and | 919 (same length, same number of mismatches allowed) at different offsets and |
925 searches for more alignments. A read is considered to have repetitive seeds if | 920 searches for more alignments. A read is considered to have repetitive seeds if |
926 the total number of seed hits divided by the number of seeds that aligned at | 921 the total number of seed hits divided by the number of seeds that aligned at |
927 least once is greater than 300. Default: 2. | 922 least once is greater than 300. Default: 2. |
928 | 923 |
929 ----- | 924 ----- |
930 | 925 |
931 **Paired-end options**:: | 926 **Paired-end options**:: |
932 | 927 |
933 -I/--minins <int> | 928 -I/--minins <int> |
934 The minimum fragment length for valid paired-end alignments. E.g. if `-I 60` is | 929 The minimum fragment length for valid paired-end alignments. E.g. if `-I 60` is |
935 specified and a paired-end alignment consists of two 20-bp alignments in the | 930 specified and a paired-end alignment consists of two 20-bp alignments in the |
936 appropriate orientation with a 20-bp gap between them, that alignment is | 931 appropriate orientation with a 20-bp gap between them, that alignment is |
937 considered valid (as long as `-X` is also satisfied). A 19-bp gap would not | 932 considered valid (as long as `-X` is also satisfied). A 19-bp gap would not |
938 be valid in that case. If trimming options `-3` or `-5` are also used, the | 933 be valid in that case. If trimming options `-3` or `-5` are also used, the |
942 run. This is because larger differences bewteen `-I` and `-X` require that | 937 run. This is because larger differences bewteen `-I` and `-X` require that |
943 Bowtie 2 scan a larger window to determine if a concordant alignment exists. | 938 Bowtie 2 scan a larger window to determine if a concordant alignment exists. |
944 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very | 939 For typical fragment length ranges (200 to 400 nucleotides), Bowtie 2 is very |
945 efficient. | 940 efficient. |
946 | 941 |
947 Default: 0 (essentially imposing no minimum) | 942 Default: 0 (essentially imposing no minimum) |
948 | 943 |
949 -X/--maxins <int> | 944 -X/--maxins <int> |
950 The maximum fragment length for valid paired-end alignments. E.g. if `-X 100` | 945 The maximum fragment length for valid paired-end alignments. E.g. if `-X 100` |
951 is specified and a paired-end alignment consists of two 20-bp alignments in the | 946 is specified and a paired-end alignment consists of two 20-bp alignments in the |
952 proper orientation with a 60-bp gap between them, that alignment is considered | 947 proper orientation with a 60-bp gap between them, that alignment is considered |
953 valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in | 948 valid (as long as `-I` is also satisfied). A 61-bp gap would not be valid in |
954 that case. If trimming options `-3` or `-5` are also used, the `-X` | 949 that case. If trimming options `-3` or `-5` are also used, the `-X` |
996 Default: a mate can contain the other in a concordant alignment. | 991 Default: a mate can contain the other in a concordant alignment. |
997 | 992 |
998 --no-overlap | 993 --no-overlap |
999 If one mate alignment overlaps the other at all, consider that to be | 994 If one mate alignment overlaps the other at all, consider that to be |
1000 non-concordant. Default: mates can overlap in a concordant alignment. | 995 non-concordant. Default: mates can overlap in a concordant alignment. |
1001 | 996 |
1002 ------ | 997 ------ |
1003 | 998 |
1004 **SAM options**:: | 999 **SAM options**:: |
1005 | 1000 |
1006 --rg-id <text> | 1001 --rg-id <text> |
1007 Set the read group ID to `<text>`. This causes the SAM `@RG` header line to be | 1002 Set the read group ID to `<text>`. This causes the SAM `@RG` header line to be |
1008 printed, with `<text>` as the value associated with the `ID:` tag. It also | 1003 printed, with `<text>` as the value associated with the `ID:` tag. It also |
1009 causes the `RG:Z:` extra field to be attached to each SAM output record, with | 1004 causes the `RG:Z:` extra field to be attached to each SAM output record, with |
1010 value set to `<text>`. | 1005 value set to `<text>`. |
1011 | 1006 |
1012 --rg <text> | 1007 --rg <text> |
1013 Add `<text>` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the | 1008 Add `<text>` (usually of the form `TAG:VAL`, e.g. `SM:Pool1`) as a field on the |
1014 `@RG` header line. Note: in order for the `@RG` line to appear, `--rg-id` | 1009 `@RG` header line. Note: in order for the `@RG` line to appear, `--rg-id` |
1015 must also be specified. This is because the `ID` tag is required by the SAM | 1010 must also be specified. This is because the `ID` tag is required by the SAM |
1016 Specification. Specify `--rg` multiple times to set multiple fields. See the | 1011 Specification. Specify `--rg` multiple times to set multiple fields. See the |
1017 SAM Specification for details about what fields are legal. | 1012 SAM Specification for details about what fields are legal. |
1018 | 1013 |
1019 --omit-sec-seq | 1014 --omit-sec-seq |
1020 When printing secondary alignments, Bowtie 2 by default will write out the `SEQ` | 1015 When printing secondary alignments, Bowtie 2 by default will write out the `SEQ` |
1021 and `QUAL` strings. Specifying this option causes Bowtie 2 to print an asterix | 1016 and `QUAL` strings. Specifying this option causes Bowtie 2 to print an asterix |
1022 in those fields instead. | 1017 in those fields instead. |
1023 | 1018 |
1024 ----- | 1019 ----- |
1025 | 1020 |
1026 **Other options**:: | 1021 **Other options**:: |
1027 | 1022 |
1028 --reorder | 1023 --reorder |
1031 than 1. Specifying `--reorder` and setting `-p` greater than 1 causes Bowtie | 1026 than 1. Specifying `--reorder` and setting `-p` greater than 1 causes Bowtie |
1032 2 to run somewhat slower and use somewhat more memory then if `--reorder` were | 1027 2 to run somewhat slower and use somewhat more memory then if `--reorder` were |
1033 not specified. Has no effect if `-p` is set to 1, since output order will | 1028 not specified. Has no effect if `-p` is set to 1, since output order will |
1034 naturally correspond to input order in that case. | 1029 naturally correspond to input order in that case. |
1035 | 1030 |
1036 --seed <int> | 1031 --seed <int> |
1037 Use `<int>` as the seed for pseudo-random number generator. Default: 0. | 1032 Use `<int>` as the seed for pseudo-random number generator. Default: 0. |
1038 | 1033 |
1039 --non-deterministic | 1034 --non-deterministic |
1040 Normally, Bowtie 2 re-initializes its pseudo-random generator for each read. It | 1035 Normally, Bowtie 2 re-initializes its pseudo-random generator for each read. It |
1041 seeds the generator with a number derived from (a) the read name, (b) the | 1036 seeds the generator with a number derived from (a) the read name, (b) the |
1042 nucleotide sequence, (c) the quality sequence, (d) the value of the `--seed` | 1037 nucleotide sequence, (c) the quality sequence, (d) the value of the `--seed` |
1047 current time. This means that Bowtie 2 will not necessarily report the same | 1042 current time. This means that Bowtie 2 will not necessarily report the same |
1048 alignment for two identical reads. This is counter-intuitive for some users, | 1043 alignment for two identical reads. This is counter-intuitive for some users, |
1049 but might be more appropriate in situations where the input consists of many | 1044 but might be more appropriate in situations where the input consists of many |
1050 identical reads. | 1045 identical reads. |
1051 | 1046 |
1052 </help> | 1047 ]]></help> |
1053 <citations> | 1048 <citations> |
1054 <citation type="doi">10.1186/gb-2009-10-3-r25</citation> | 1049 <citation type="doi">10.1186/gb-2009-10-3-r25</citation> |
1055 <citation type="doi">10.1038/nmeth.1923</citation> | 1050 <citation type="doi">10.1038/nmeth.1923</citation> |
1056 </citations> | 1051 </citations> |
1057 </tool> | 1052 </tool> |