Mercurial > repos > devteam > convert_solid_color2nuc
comparison convert_SOLiD_color2nuc.xml @ 0:ab28e7de2db3 draft default tip
Imported from capsule None
author | devteam |
---|---|
date | Mon, 19 May 2014 12:33:14 -0400 |
parents | |
children |
comparison
equal
deleted
inserted
replaced
-1:000000000000 | 0:ab28e7de2db3 |
---|---|
1 <tool id="color2nuc" name="Convert Color Space" version="1.0.0"> | |
2 <description> to Nucleotides </description> | |
3 <command interpreter="python">convert_SOLiD_color2nuc.py $input1 $input2 $output1 </command> | |
4 | |
5 <inputs> | |
6 <param name="input1" type="data" format="txt" label="SOLiD color coding file" /> | |
7 <param name="input2" type="select" label="Keep prefix nucleotide"> | |
8 <option value="yes">Yes</option> | |
9 <option value="no">No</option> | |
10 </param> | |
11 </inputs> | |
12 <outputs> | |
13 <data name="output1" format="fasta" /> | |
14 </outputs> | |
15 <!-- | |
16 <tests> | |
17 <test> | |
18 <param name="input1" value="convert_SOLiD_color2nuc_test1.txt" ftype="txt" /> | |
19 <param name="input2" value="no" /> | |
20 <output name="output1" file="convert_SOLiD_color2nuc_test1.out" /> | |
21 </test> | |
22 </tests> | |
23 --> | |
24 <help> | |
25 | |
26 .. class:: warningmark | |
27 | |
28 The tool was designed for color space files generated from an ABI SOLiD sequencer. The file format must be fasta-like: the title starts with a ">" character, and each color space sequence starts with a leading nucleotide. | |
29 | |
30 ----- | |
31 | |
32 **What it does** | |
33 | |
34 This tool converts a color space sequence to nucleotides. The leading character must be a nucleotide: A, C, G, or T. | |
35 | |
36 ----- | |
37 | |
38 **Example** | |
39 | |
40 - If the color space file looks like this:: | |
41 | |
42 >seq1 | |
43 A013 | |
44 >seq2 | |
45 T011213122200221123032111221021210131332222101 | |
46 | |
47 - If you would like to **keep** the leading nucleotide:: | |
48 | |
49 >seq1 | |
50 AACG | |
51 >seq2 | |
52 TTGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT | |
53 | |
54 - If you **do not want to keep** the leading nucleotide (the length of nucleotide sequence will be one less than the color-space sequence):: | |
55 | |
56 >seq1 | |
57 ACG | |
58 >seq2 | |
59 TGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT | |
60 | |
61 ----- | |
62 | |
63 **ABI SOLiD Color Coding Alignment matrix** | |
64 | |
65 Each di-nucleotide is represented by a single digit: 0 to 3. The matrix is symmetric, thus the leading nucleotide is necessary to determine the sequence (otherwise there are four possibilities). | |
66 | |
67 | |
68 .. image:: dualcolorcode.png | |
69 | |
70 | |
71 </help> | |
72 </tool> |