Mercurial > repos > devteam > convert_solid_color2nuc
view convert_SOLiD_color2nuc.xml @ 0:ab28e7de2db3 draft default tip
Imported from capsule None
author | devteam |
---|---|
date | Mon, 19 May 2014 12:33:14 -0400 |
parents | |
children |
line wrap: on
line source
<tool id="color2nuc" name="Convert Color Space" version="1.0.0"> <description> to Nucleotides </description> <command interpreter="python">convert_SOLiD_color2nuc.py $input1 $input2 $output1 </command> <inputs> <param name="input1" type="data" format="txt" label="SOLiD color coding file" /> <param name="input2" type="select" label="Keep prefix nucleotide"> <option value="yes">Yes</option> <option value="no">No</option> </param> </inputs> <outputs> <data name="output1" format="fasta" /> </outputs> <!-- <tests> <test> <param name="input1" value="convert_SOLiD_color2nuc_test1.txt" ftype="txt" /> <param name="input2" value="no" /> <output name="output1" file="convert_SOLiD_color2nuc_test1.out" /> </test> </tests> --> <help> .. class:: warningmark The tool was designed for color space files generated from an ABI SOLiD sequencer. The file format must be fasta-like: the title starts with a ">" character, and each color space sequence starts with a leading nucleotide. ----- **What it does** This tool converts a color space sequence to nucleotides. The leading character must be a nucleotide: A, C, G, or T. ----- **Example** - If the color space file looks like this:: >seq1 A013 >seq2 T011213122200221123032111221021210131332222101 - If you would like to **keep** the leading nucleotide:: >seq1 AACG >seq2 TTGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT - If you **do not want to keep** the leading nucleotide (the length of nucleotide sequence will be one less than the color-space sequence):: >seq1 ACG >seq2 TGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT ----- **ABI SOLiD Color Coding Alignment matrix** Each di-nucleotide is represented by a single digit: 0 to 3. The matrix is symmetric, thus the leading nucleotide is necessary to determine the sequence (otherwise there are four possibilities). .. image:: dualcolorcode.png </help> </tool>