# HG changeset patch
# User devteam
# Date 1396363861 14400
# Node ID 14e304b704259825cbdc3d4f4f6efa77ebcb8320
Imported from capsule None
diff -r 000000000000 -r 14e304b70425 count_covariates.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/count_covariates.xml Tue Apr 01 10:51:01 2014 -0400
@@ -0,0 +1,292 @@
+
+ on BAM files
+
+ gatk
+ samtools
+
+
+ gatk_macros.xml
+
+ gatk_wrapper.py
+ --max_jvm_heap_fraction "1"
+ --stdout "${output_log}"
+ -d "-I" "${reference_source.input_bam}" "${reference_source.input_bam.ext}" "gatk_input"
+ #if str( $reference_source.input_bam.metadata.bam_index ) != "None":
+ -d "" "${reference_source.input_bam.metadata.bam_index}" "bam_index" "gatk_input" ##hardcode galaxy ext type as bam_index
+ #end if
+ -p 'java
+ -jar "\$JAVA_JAR_PATH/GenomeAnalysisTK.jar"
+ -T "CountCovariates"
+ --num_threads \${GALAXY_SLOTS:-4}
+ -et "NO_ET" ##ET no phone home
+ ##-log "${output_log}" ##don't use this to log to file, instead directly capture stdout
+ #if $reference_source.reference_source_selector != "history":
+ -R "${reference_source.ref_file.fields.path}"
+ #end if
+ --recal_file "${output_recal}"
+ ${standard_covs}
+ #if str( $covariates ) != "None":
+ #for $cov in str( $covariates ).split( ',' ):
+ -cov "${cov}"
+ #end for
+ #end if
+ '
+
+ #set $snp_dataset_provided = False
+ #set $rod_binding_names = dict()
+ #for $rod_binding in $rod_bind:
+ #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'custom':
+ #set $rod_bind_name = $rod_binding.rod_bind_type.custom_rod_name
+ #else
+ #set $rod_bind_name = $rod_binding.rod_bind_type.rod_bind_type_selector
+ #end if
+ #if str( $rod_binding.rod_bind_type.rod_bind_type_selector ) == 'dbsnp':
+ #set $snp_dataset_provided = True
+ #end if
+ #set $rod_binding_names[$rod_bind_name] = $rod_binding_names.get( $rod_bind_name, -1 ) + 1
+ -d "--knownSites:${rod_bind_name},%(file_type)s" "${rod_binding.rod_bind_type.input_rod}" "${rod_binding.rod_bind_type.input_rod.ext}" "input_${rod_bind_name}_${rod_binding_names[$rod_bind_name]}"
+ #end for
+
+ #include source=$standard_gatk_options#
+
+ ##start analysis specific options
+ #if $analysis_param_type.analysis_param_type_selector == "advanced":
+ -p '
+ #if $analysis_param_type.default_read_group_type.default_read_group_type_selector == "set":
+ --default_read_group "${analysis_param_type.default_read_group_type.default_read_group}"
+ #end if
+ #if str( $analysis_param_type.default_platform ) != "default":
+ --default_platform "${analysis_param_type.default_platform}"
+ #end if
+ #if str( $analysis_param_type.force_read_group_type.force_read_group_type_selector ) == "set":
+ --force_read_group "${analysis_param_type.force_read_group_type.force_read_group}"
+ #end if
+ #if str( $analysis_param_type.force_platform ) != "default":
+ --force_platform "${analysis_param_type.force_platform}"
+ #end if
+ ${analysis_param_type.exception_if_no_tile}
+ #if str( $analysis_param_type.solid_options_type.solid_options_type_selector ) == "set":
+ #if str( $analysis_param_type.solid_options_type.solid_recal_mode ) != "default":
+ --solid_recal_mode "${analysis_param_type.solid_options_type.solid_recal_mode}"
+ #end if
+ #if str( $analysis_param_type.solid_options_type.solid_nocall_strategy ) != "default":
+ --solid_nocall_strategy "${analysis_param_type.solid_options_type.solid_nocall_strategy}"
+ #end if
+ #end if
+ --window_size_nqs "${analysis_param_type.window_size_nqs}"
+ --homopolymer_nback "${analysis_param_type.homopolymer_nback}"
+ '
+ #end if
+ #if not $snp_dataset_provided:
+ -p '--run_without_dbsnp_potentially_ruining_quality'
+ #end if
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+.. class:: warningmark
+
+"This calculation is critically dependent on being able to skip over known variant sites. Please provide a dbSNP ROD or a VCF file containing known sites of genetic variation."
+However, if you do not provide this file, the '--run_without_dbsnp_potentially_ruining_quality' flag will be automatically used, and the command will be allowed to run.
+
+**What it does**
+
+This walker is designed to work as the first pass in a two-pass processing step. It does a by-locus traversal operating only at sites that are not in dbSNP. We assume that all reference mismatches we see are therefore errors and indicative of poor base quality. This walker generates tables based on various user-specified covariates (such as read group, reported quality score, cycle, and dinucleotide) Since there is a large amount of data one can then calculate an empirical probability of error given the particular covariates seen at this site, where p(error) = num mismatches / num observations The output file is a CSV list of (the several covariate values, num observations, num mismatches, empirical quality score) The first non-comment line of the output file gives the name of the covariates that were used for this calculation. Note: ReadGroupCovariate and QualityScoreCovariate are required covariates and will be added for the user regardless of whether or not they were specified Note: This walker is designed to be used in conjunction with TableRecalibrationWalker.
+
+For more information on base quality score recalibration using the GATK, see this `tool specific page <http://www.broadinstitute.org/gsa/wiki/index.php/Base_quality_score_recalibration>`_.
+
+To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gsa/wiki/index.php/Best_Practice_Variant_Detection_with_the_GATK_v3>`_.
+
+If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gsa/wiki/index.php/Frequently_Asked_Questions>`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: CountCovariates accepts an aligned BAM input file.
+
+
+**Outputs**
+
+The output is in CSV format.
+
+
+Go `here <http://www.broadinstitute.org/gsa/wiki/index.php/Input_files_for_the_GATK>`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+
+ default_read_group If a read has no read group then default to the provided String.
+ default_platform If a read has no platform then default to the provided String. Valid options are illumina, 454, and solid.
+ force_read_group If provided, the read group ID of EVERY read will be forced to be the provided String. This is useful to collapse all data into a single read group.
+ force_platform If provided, the platform of EVERY read will be forced to be the provided String. Valid options are illumina, 454, and solid.
+ window_size_nqs The window size used by MinimumNQSCovariate for its calculation
+ homopolymer_nback The number of previous bases to look at in HomopolymerCovariate
+ exception_if_no_tile If provided, TileCovariate will throw an exception when no tile can be found. The default behavior is to use tile = -1
+ solid_recal_mode How should we recalibrate solid bases in whichthe reference was inserted? Options = DO_NOTHING, SET_Q_ZERO, SET_Q_ZERO_BASE_N, or REMOVE_REF_BIAS (DO_NOTHING|SET_Q_ZERO|SET_Q_ZERO_BASE_N|REMOVE_REF_BIAS)
+ solid_nocall_strategy Defines the behavior of the recalibrator when it encounters no calls in the color space. Options = THROW_EXCEPTION, LEAVE_READ_UNRECALIBRATED, or PURGE_READ (THROW_EXCEPTION|LEAVE_READ_UNRECALIBRATED|PURGE_READ)
+ recal_file Filename for the input covariates table recalibration .csv file
+ out The output CSV file
+ recal_file Filename for the outputted covariates table recalibration file
+ standard_covs Use the standard set of covariates in addition to the ones listed using the -cov argument
+ run_without_dbsnp_potentially_ruining_quality If specified, allows the recalibrator to be used without a dbsnp rod. Very unsafe and for expert users only.
+
+@CITATION_SECTION@
+
+
diff -r 000000000000 -r 14e304b70425 gatk_macros.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/gatk_macros.xml Tue Apr 01 10:51:01 2014 -0400
@@ -0,0 +1,305 @@
+
+
+ ##start standard gatk options
+ #if $gatk_param_type.gatk_param_type_selector == "advanced":
+ #for $pedigree in $gatk_param_type.pedigree:
+ -p '--pedigree "${pedigree.pedigree_file}"'
+ #end for
+ #for $pedigree_string in $gatk_param_type.pedigree_string_repeat:
+ -p '--pedigreeString "${pedigree_string.pedigree_string}"'
+ #end for
+ -p '--pedigreeValidationType "${gatk_param_type.pedigree_validation_type}"'
+ #for $read_filter in $gatk_param_type.read_filter:
+ -p '--read_filter "${read_filter.read_filter_type.read_filter_type_selector}"
+ ###raise Exception( str( dir( $read_filter ) ) )
+ #for $name, $param in $read_filter.read_filter_type.iteritems():
+ #if $name not in [ "__current_case__", "read_filter_type_selector" ]:
+ #if hasattr( $param.input, 'truevalue' ):
+ ${param}
+ #else:
+ --${name} "${param}"
+ #end if
+ #end if
+ #end for
+ '
+ #end for
+ #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_interval_repeat ):
+ -d "--intervals" "${input_intervals.input_intervals}" "${input_intervals.input_intervals.ext}" "input_intervals_${interval_count}"
+ #end for
+
+ #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_exclude_interval_repeat ):
+ -d "--excludeIntervals" "${input_intervals.input_exclude_intervals}" "${input_intervals.input_exclude_intervals.ext}" "input_exlude_intervals_${interval_count}"
+ #end for
+
+ -p '--interval_set_rule "${gatk_param_type.interval_set_rule}"'
+
+ -p '--downsampling_type "${gatk_param_type.downsampling_type.downsampling_type_selector}"'
+ #if str( $gatk_param_type.downsampling_type.downsampling_type_selector ) != "NONE":
+ -p '--${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_type_selector} "${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_value}"'
+ #end if
+ -p '
+ --baq "${gatk_param_type.baq}"
+ --baqGapOpenPenalty "${gatk_param_type.baq_gap_open_penalty}"
+ ${gatk_param_type.use_original_qualities}
+ --defaultBaseQualities "${gatk_param_type.default_base_qualities}"
+ --validation_strictness "${gatk_param_type.validation_strictness}"
+ --interval_merging "${gatk_param_type.interval_merging}"
+ ${gatk_param_type.disable_experimental_low_memory_sharding}
+ ${gatk_param_type.non_deterministic_random_seed}
+ '
+ #for $rg_black_list_count, $rg_black_list in enumerate( $gatk_param_type.read_group_black_list_repeat ):
+ #if $rg_black_list.read_group_black_list_type.read_group_black_list_type_selector == "file":
+ -d "--read_group_black_list" "${rg_black_list.read_group_black_list_type.read_group_black_list}" "txt" "input_read_group_black_list_${rg_black_list_count}"
+ #else
+ -p '--read_group_black_list "${rg_black_list.read_group_black_list_type.read_group_black_list}"'
+ #end if
+ #end for
+ #end if
+
+ #if str( $reference_source.reference_source_selector ) == "history":
+ -d "-R" "${reference_source.ref_file}" "${reference_source.ref_file.ext}" "gatk_input"
+ #end if
+ ##end standard gatk options
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ ------
+
+**Citation**
+
+For the underlying tool, please cite `DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011 May;43(5):491-8. <http://www.ncbi.nlm.nih.gov/pubmed/21478889>`_
+
+If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.*
+
+
+
\ No newline at end of file
diff -r 000000000000 -r 14e304b70425 gatk_wrapper.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/gatk_wrapper.py Tue Apr 01 10:51:01 2014 -0400
@@ -0,0 +1,126 @@
+#!/usr/bin/env python
+#Dan Blankenberg
+
+"""
+A wrapper script for running the GenomeAnalysisTK.jar commands.
+"""
+
+import sys, optparse, os, tempfile, subprocess, shutil
+from binascii import unhexlify
+from string import Template
+
+GALAXY_EXT_TO_GATK_EXT = { 'gatk_interval':'intervals', 'bam_index':'bam.bai', 'gatk_dbsnp':'dbSNP', 'picard_interval_list':'interval_list' } #items not listed here will use the galaxy extension as-is
+GALAXY_EXT_TO_GATK_FILE_TYPE = GALAXY_EXT_TO_GATK_EXT #for now, these are the same, but could be different if needed
+DEFAULT_GATK_PREFIX = "gatk_file"
+CHUNK_SIZE = 2**20 #1mb
+
+
+def cleanup_before_exit( tmp_dir ):
+ if tmp_dir and os.path.exists( tmp_dir ):
+ shutil.rmtree( tmp_dir )
+
+def gatk_filename_from_galaxy( galaxy_filename, galaxy_ext, target_dir = None, prefix = None ):
+ suffix = GALAXY_EXT_TO_GATK_EXT.get( galaxy_ext, galaxy_ext )
+ if prefix is None:
+ prefix = DEFAULT_GATK_PREFIX
+ if target_dir is None:
+ target_dir = os.getcwd()
+ gatk_filename = os.path.join( target_dir, "%s.%s" % ( prefix, suffix ) )
+ os.symlink( galaxy_filename, gatk_filename )
+ return gatk_filename
+
+def gatk_filetype_argument_substitution( argument, galaxy_ext ):
+ return argument % dict( file_type = GALAXY_EXT_TO_GATK_FILE_TYPE.get( galaxy_ext, galaxy_ext ) )
+
+def open_file_from_option( filename, mode = 'rb' ):
+ if filename:
+ return open( filename, mode = mode )
+ return None
+
+def html_report_from_directory( html_out, dir ):
+ html_out.write( '\n\nGalaxy - GATK Output\n\n\n\n\n' )
+ for fname in sorted( os.listdir( dir ) ):
+ html_out.write( '- %s
\n' % ( fname, fname ) )
+ html_out.write( '
\n\n\n' )
+
+def index_bam_files( bam_filenames, tmp_dir ):
+ for bam_filename in bam_filenames:
+ bam_index_filename = "%s.bai" % bam_filename
+ if not os.path.exists( bam_index_filename ):
+ #need to index this bam file
+ stderr_name = tempfile.NamedTemporaryFile( prefix = "bam_index_stderr" ).name
+ command = 'samtools index %s %s' % ( bam_filename, bam_index_filename )
+ proc = subprocess.Popen( args=command, shell=True, stderr=open( stderr_name, 'wb' ) )
+ return_code = proc.wait()
+ if return_code:
+ for line in open( stderr_name ):
+ print >> sys.stderr, line
+ os.unlink( stderr_name ) #clean up
+ cleanup_before_exit( tmp_dir )
+ raise Exception( "Error indexing BAM file" )
+ os.unlink( stderr_name ) #clean up
+
+def __main__():
+ #Parse Command Line
+ parser = optparse.OptionParser()
+ parser.add_option( '-p', '--pass_through', dest='pass_through_options', action='append', type="string", help='These options are passed through directly to GATK, without any modification.' )
+ parser.add_option( '-o', '--pass_through_options', dest='pass_through_options_encoded', action='append', type="string", help='These options are passed through directly to GATK, with decoding from binascii.unhexlify.' )
+ parser.add_option( '-d', '--dataset', dest='datasets', action='append', type="string", nargs=4, help='"-argument" "original_filename" "galaxy_filetype" "name_prefix"' )
+ parser.add_option( '', '--max_jvm_heap', dest='max_jvm_heap', action='store', type="string", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value.' )
+ parser.add_option( '', '--max_jvm_heap_fraction', dest='max_jvm_heap_fraction', action='store', type="int", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value as a fraction of total physical memory.' )
+ parser.add_option( '', '--stdout', dest='stdout', action='store', type="string", default=None, help='If specified, the output of stdout will be written to this file.' )
+ parser.add_option( '', '--stderr', dest='stderr', action='store', type="string", default=None, help='If specified, the output of stderr will be written to this file.' )
+ parser.add_option( '', '--html_report_from_directory', dest='html_report_from_directory', action='append', type="string", nargs=2, help='"Target HTML File" "Directory"')
+ (options, args) = parser.parse_args()
+
+ tmp_dir = tempfile.mkdtemp( prefix='tmp-gatk-' )
+ if options.pass_through_options:
+ cmd = ' '.join( options.pass_through_options )
+ else:
+ cmd = ''
+ if options.pass_through_options_encoded:
+ cmd = '%s %s' % ( cmd, ' '.join( map( unhexlify, options.pass_through_options_encoded ) ) )
+ if options.max_jvm_heap is not None:
+ cmd = cmd.replace( 'java ', 'java -Xmx%s ' % ( options.max_jvm_heap ), 1 )
+ elif options.max_jvm_heap_fraction is not None:
+ cmd = cmd.replace( 'java ', 'java -XX:DefaultMaxRAMFraction=%s -XX:+UseParallelGC ' % ( options.max_jvm_heap_fraction ), 1 )
+ bam_filenames = []
+ if options.datasets:
+ for ( dataset_arg, filename, galaxy_ext, prefix ) in options.datasets:
+ gatk_filename = gatk_filename_from_galaxy( filename, galaxy_ext, target_dir = tmp_dir, prefix = prefix )
+ if dataset_arg:
+ cmd = '%s %s "%s"' % ( cmd, gatk_filetype_argument_substitution( dataset_arg, galaxy_ext ), gatk_filename )
+ if galaxy_ext == "bam":
+ bam_filenames.append( gatk_filename )
+ index_bam_files( bam_filenames, tmp_dir )
+ #set up stdout and stderr output options
+ stdout = open_file_from_option( options.stdout, mode = 'wb' )
+ stderr = open_file_from_option( options.stderr, mode = 'wb' )
+ #if no stderr file is specified, we'll use our own
+ if stderr is None:
+ stderr = tempfile.NamedTemporaryFile( prefix="gatk-stderr-", dir=tmp_dir )
+
+ proc = subprocess.Popen( args=cmd, stdout=stdout, stderr=stderr, shell=True, cwd=tmp_dir )
+ return_code = proc.wait()
+
+ if return_code:
+ stderr_target = sys.stderr
+ else:
+ stderr_target = sys.stdout
+ stderr.flush()
+ stderr.seek(0)
+ while True:
+ chunk = stderr.read( CHUNK_SIZE )
+ if chunk:
+ stderr_target.write( chunk )
+ else:
+ break
+ stderr.close()
+ #generate html reports
+ if options.html_report_from_directory:
+ for ( html_filename, html_dir ) in options.html_report_from_directory:
+ html_report_from_directory( open( html_filename, 'wb' ), html_dir )
+
+ cleanup_before_exit( tmp_dir )
+
+if __name__=="__main__": __main__()
diff -r 000000000000 -r 14e304b70425 test-data/1.bam
Binary file test-data/1.bam has changed
diff -r 000000000000 -r 14e304b70425 test-data/a.tab
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/a.tab Tue Apr 01 10:51:01 2014 -0400
@@ -0,0 +1,15 @@
+CHR SNP BP A1 TEST NMISS BETA STAT P
+1 rs1181876 3671541 T DOMDEV 958 -1.415 -3.326 0.0009161
+1 rs10492923 5092886 C ADD 1007 5.105 4.368 1.382e-05
+1 rs10492923 5092886 C DOMDEV 1007 -5.612 -4.249 2.35e-05
+1 rs10492923 5092886 C GENO_2DF 1007 NA 19.9 4.775e-05
+1 rs1801133 11778965 T ADD 1022 1.23 3.97 7.682e-05
+1 rs1801133 11778965 T GENO_2DF 1022 NA 16.07 0.0003233
+1 rs1361912 12663121 A ADD 1021 12.69 4.093 4.596e-05
+1 rs1361912 12663121 A DOMDEV 1021 -12.37 -3.945 8.533e-05
+1 rs1361912 12663121 A GENO_2DF 1021 NA 17.05 0.0001982
+1 rs1009806 19373138 G ADD 1021 -1.334 -3.756 0.0001826
+1 rs1009806 19373138 G GENO_2DF 1021 NA 19.36 6.244e-05
+1 rs873654 29550948 A DOMDEV 1012 1.526 3.6 0.0003339
+1 rs10489527 36800027 C ADD 1016 12.67 4.114 4.211e-05
+1 rs10489527 36800027 C DOMDEV 1016 -13.05 -4.02 6.249e-05
diff -r 000000000000 -r 14e304b70425 test-data/gatk/fake_phiX_variant_locations.bed
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/fake_phiX_variant_locations.bed Tue Apr 01 10:51:01 2014 -0400
@@ -0,0 +1,2 @@
+phiX174 1442 1443
+phiX174 1445 1446
diff -r 000000000000 -r 14e304b70425 test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.csv Tue Apr 01 10:51:01 2014 -0400
@@ -0,0 +1,246 @@
+# Counted Sites 41
+# Counted Bases 340
+# Skipped Sites 2
+# Fraction Skipped 1 / 21 bp
+ReadGroup,QualityScore,Cycle,Dinuc,Homopolymer,MinimumNQS,Position,nObservations,nMismatches,Qempirical
+A Fake phiX Sample,26,1,NN,0,26,0,9,0,40
+A Fake phiX Sample,26,1,NN,1,26,0,1,0,40
+A Fake phiX Sample,26,2,AG,0,26,1,1,0,40
+A Fake phiX Sample,26,2,CC,0,26,1,1,0,40
+A Fake phiX Sample,26,2,CG,0,26,1,3,0,40
+A Fake phiX Sample,26,2,GC,0,26,1,2,0,40
+A Fake phiX Sample,26,2,GC,1,26,1,1,0,40
+A Fake phiX Sample,26,2,GT,0,26,1,1,0,40
+A Fake phiX Sample,26,2,TG,1,26,1,1,0,40
+A Fake phiX Sample,26,3,CC,0,26,2,1,0,40
+A Fake phiX Sample,26,3,CG,0,26,2,3,0,40
+A Fake phiX Sample,26,3,GC,0,26,2,1,0,40
+A Fake phiX Sample,26,3,GC,1,26,2,2,0,40
+A Fake phiX Sample,26,3,GG,0,26,2,1,0,40
+A Fake phiX Sample,26,3,GT,0,26,2,1,0,40
+A Fake phiX Sample,26,3,TG,1,26,2,1,0,40
+A Fake phiX Sample,26,4,CC,0,26,3,2,0,40
+A Fake phiX Sample,26,4,CG,0,26,3,2,0,40
+A Fake phiX Sample,26,4,GA,0,26,3,1,0,40
+A Fake phiX Sample,26,4,GC,1,26,3,2,0,40
+A Fake phiX Sample,26,4,GG,0,26,3,1,0,40
+A Fake phiX Sample,26,4,GT,0,26,3,1,0,40
+A Fake phiX Sample,26,4,TG,1,26,3,1,0,40
+A Fake phiX Sample,26,5,AT,0,26,4,1,0,40
+A Fake phiX Sample,26,5,CC,0,26,4,2,0,40
+A Fake phiX Sample,26,5,CG,0,26,4,2,0,40
+A Fake phiX Sample,26,5,GA,0,26,4,1,0,40
+A Fake phiX Sample,26,5,GC,1,26,4,1,0,40
+A Fake phiX Sample,26,5,GG,0,26,4,1,0,40
+A Fake phiX Sample,26,5,GT,0,26,4,1,0,40
+A Fake phiX Sample,26,5,TG,1,26,4,1,0,40
+A Fake phiX Sample,26,6,AT,0,26,5,1,0,40
+A Fake phiX Sample,26,6,CC,0,26,5,1,0,40
+A Fake phiX Sample,26,6,CG,0,26,5,2,0,40
+A Fake phiX Sample,26,6,GA,0,26,5,1,0,40
+A Fake phiX Sample,26,6,GG,0,26,5,1,0,40
+A Fake phiX Sample,26,6,GT,0,26,5,2,0,40
+A Fake phiX Sample,26,6,TG,0,26,5,1,0,40
+A Fake phiX Sample,26,6,TG,1,26,5,1,0,40
+A Fake phiX Sample,26,7,AT,0,26,6,1,0,40
+A Fake phiX Sample,26,7,CG,0,26,6,1,0,40
+A Fake phiX Sample,26,7,GA,0,26,6,2,1,3
+A Fake phiX Sample,26,7,GG,0,26,6,1,0,40
+A Fake phiX Sample,26,7,GT,0,26,6,2,0,40
+A Fake phiX Sample,26,7,TG,0,26,6,1,0,40
+A Fake phiX Sample,26,7,TG,1,26,6,2,0,40
+A Fake phiX Sample,26,8,AC,0,26,7,1,0,40
+A Fake phiX Sample,26,8,AT,0,26,7,1,0,40
+A Fake phiX Sample,26,8,GA,0,26,7,2,1,3
+A Fake phiX Sample,26,8,GG,0,26,7,2,0,40
+A Fake phiX Sample,26,8,GT,0,26,7,1,0,40
+A Fake phiX Sample,26,8,TG,0,26,7,1,0,40
+A Fake phiX Sample,26,8,TG,1,26,7,2,0,40
+A Fake phiX Sample,26,9,AC,0,26,8,1,0,40
+A Fake phiX Sample,26,9,AT,0,26,8,1,0,40
+A Fake phiX Sample,26,9,CT,0,26,8,1,0,40
+A Fake phiX Sample,26,9,GA,0,26,8,3,1,5
+A Fake phiX Sample,26,9,GG,0,26,8,2,0,40
+A Fake phiX Sample,26,9,TG,0,26,8,1,0,40
+A Fake phiX Sample,26,9,TG,1,26,8,1,0,40
+A Fake phiX Sample,26,10,AC,0,26,9,1,0,40
+A Fake phiX Sample,26,10,AT,0,26,9,2,0,40
+A Fake phiX Sample,26,10,CT,0,26,9,1,0,40
+A Fake phiX Sample,26,10,GA,0,26,9,3,1,5
+A Fake phiX Sample,26,10,GG,0,26,9,1,0,40
+A Fake phiX Sample,26,10,TG,0,26,9,2,0,40
+A Fake phiX Sample,26,11,AC,0,26,10,1,0,40
+A Fake phiX Sample,26,11,AT,0,26,10,2,0,40
+A Fake phiX Sample,26,11,CT,0,26,10,1,0,40
+A Fake phiX Sample,26,11,GA,0,26,10,3,1,5
+A Fake phiX Sample,26,11,TG,0,26,10,3,0,40
+A Fake phiX Sample,26,12,AC,0,26,11,1,0,40
+A Fake phiX Sample,26,12,AC,1,26,11,1,0,40
+A Fake phiX Sample,26,12,AT,0,26,11,1,0,40
+A Fake phiX Sample,26,12,CT,0,26,11,1,0,40
+A Fake phiX Sample,26,12,GA,0,26,11,2,1,3
+A Fake phiX Sample,26,12,GC,1,26,11,1,0,40
+A Fake phiX Sample,26,12,TG,0,26,11,3,0,40
+A Fake phiX Sample,26,13,AC,0,26,12,1,0,40
+A Fake phiX Sample,26,13,AC,1,26,12,1,0,40
+A Fake phiX Sample,26,13,CC,0,26,12,2,0,40
+A Fake phiX Sample,26,13,CT,0,26,12,1,0,40
+A Fake phiX Sample,26,13,GA,0,26,12,2,1,3
+A Fake phiX Sample,26,13,GC,1,26,12,1,0,40
+A Fake phiX Sample,26,13,TG,0,26,12,2,0,40
+A Fake phiX Sample,26,14,AC,0,26,13,1,0,40
+A Fake phiX Sample,26,14,AC,1,26,13,1,0,40
+A Fake phiX Sample,26,14,CC,0,26,13,2,0,40
+A Fake phiX Sample,26,14,CG,0,26,13,1,0,40
+A Fake phiX Sample,26,14,CT,0,26,13,2,0,40
+A Fake phiX Sample,26,14,GA,0,26,13,1,0,40
+A Fake phiX Sample,26,14,GC,1,26,13,1,0,40
+A Fake phiX Sample,26,14,TG,0,26,13,1,0,40
+A Fake phiX Sample,26,15,AC,1,26,14,1,0,40
+A Fake phiX Sample,26,15,CC,0,26,14,2,0,40
+A Fake phiX Sample,26,15,CG,0,26,14,1,0,40
+A Fake phiX Sample,26,15,CT,0,26,14,2,0,40
+A Fake phiX Sample,26,15,GA,0,26,14,1,0,40
+A Fake phiX Sample,26,15,GT,0,26,14,1,0,40
+A Fake phiX Sample,26,15,TG,0,26,14,2,0,40
+A Fake phiX Sample,26,16,AC,1,26,15,1,0,40
+A Fake phiX Sample,26,16,CC,0,26,15,1,0,40
+A Fake phiX Sample,26,16,CG,0,26,15,1,0,40
+A Fake phiX Sample,26,16,CT,0,26,15,1,0,40
+A Fake phiX Sample,26,16,GA,0,26,15,2,0,40
+A Fake phiX Sample,26,16,GT,0,26,15,1,0,40
+A Fake phiX Sample,26,16,TA,0,26,15,1,0,40
+A Fake phiX Sample,26,16,TG,0,26,15,2,0,40
+A Fake phiX Sample,26,17,AC,1,26,16,3,0,40
+A Fake phiX Sample,26,17,CC,0,26,16,1,0,40
+A Fake phiX Sample,26,17,CG,0,26,16,1,0,40
+A Fake phiX Sample,26,17,GA,0,26,16,2,0,40
+A Fake phiX Sample,26,17,GT,0,26,16,1,0,40
+A Fake phiX Sample,26,17,TA,0,26,16,1,0,40
+A Fake phiX Sample,26,17,TG,0,26,16,1,0,40
+A Fake phiX Sample,26,18,AC,1,26,17,3,0,40
+A Fake phiX Sample,26,18,CC,0,26,17,3,0,40
+A Fake phiX Sample,26,18,CG,0,26,17,1,0,40
+A Fake phiX Sample,26,18,GA,0,26,17,1,0,40
+A Fake phiX Sample,26,18,GT,0,26,17,1,0,40
+A Fake phiX Sample,26,18,TA,0,26,17,1,0,40
+A Fake phiX Sample,26,19,AC,1,26,18,2,0,40
+A Fake phiX Sample,26,19,CC,0,26,18,3,0,40
+A Fake phiX Sample,26,19,CG,0,26,18,3,0,40
+A Fake phiX Sample,26,19,GT,0,26,18,1,0,40
+A Fake phiX Sample,26,19,TA,0,26,18,1,0,40
+A Fake phiX Sample,26,20,AC,1,26,19,1,0,40
+A Fake phiX Sample,26,20,CC,0,26,19,2,0,40
+A Fake phiX Sample,26,20,CG,0,26,19,3,0,40
+A Fake phiX Sample,26,20,GA,0,26,19,1,0,40
+A Fake phiX Sample,26,20,GT,0,26,19,2,0,40
+A Fake phiX Sample,26,20,TA,0,26,19,1,0,40
+A Fake phiX Sample,26,21,AC,1,26,20,1,0,40
+A Fake phiX Sample,26,21,AG,1,26,20,1,0,40
+A Fake phiX Sample,26,21,CC,0,26,20,1,0,40
+A Fake phiX Sample,26,21,CG,0,26,20,2,0,40
+A Fake phiX Sample,26,21,GA,0,26,20,1,0,40
+A Fake phiX Sample,26,21,GT,0,26,20,2,0,40
+A Fake phiX Sample,26,21,TA,0,26,20,2,0,40
+A Fake phiX Sample,26,22,AC,1,26,21,2,0,40
+A Fake phiX Sample,26,22,AG,1,26,21,1,0,40
+A Fake phiX Sample,26,22,CC,0,26,21,1,0,40
+A Fake phiX Sample,26,22,CG,0,26,21,1,0,40
+A Fake phiX Sample,26,22,GA,0,26,21,1,0,40
+A Fake phiX Sample,26,22,GG,0,26,21,1,0,40
+A Fake phiX Sample,26,22,GT,0,26,21,1,0,40
+A Fake phiX Sample,26,22,TA,0,26,21,2,0,40
+A Fake phiX Sample,26,23,AC,1,26,22,2,0,40
+A Fake phiX Sample,26,23,AG,1,26,22,1,0,40
+A Fake phiX Sample,26,23,CC,0,26,22,2,0,40
+A Fake phiX Sample,26,23,CG,0,26,22,1,0,40
+A Fake phiX Sample,26,23,GA,0,26,22,1,0,40
+A Fake phiX Sample,26,23,GC,0,26,22,1,0,40
+A Fake phiX Sample,26,23,GG,0,26,22,1,0,40
+A Fake phiX Sample,26,23,TA,0,26,22,1,0,40
+A Fake phiX Sample,26,24,AC,1,26,23,1,0,40
+A Fake phiX Sample,26,24,AG,1,26,23,1,0,40
+A Fake phiX Sample,26,24,CC,0,26,23,2,0,40
+A Fake phiX Sample,26,24,CG,0,26,23,2,0,40
+A Fake phiX Sample,26,24,CT,0,26,23,1,0,40
+A Fake phiX Sample,26,24,GA,0,26,23,1,0,40
+A Fake phiX Sample,26,24,GC,0,26,23,1,0,40
+A Fake phiX Sample,26,24,GG,0,26,23,1,0,40
+A Fake phiX Sample,26,25,AG,1,26,24,1,0,40
+A Fake phiX Sample,26,25,CC,0,26,24,1,0,40
+A Fake phiX Sample,26,25,CG,0,26,24,2,0,40
+A Fake phiX Sample,26,25,CT,0,26,24,1,0,40
+A Fake phiX Sample,26,25,GA,0,26,24,2,0,40
+A Fake phiX Sample,26,25,GC,0,26,24,1,0,40
+A Fake phiX Sample,26,25,GG,0,26,24,1,0,40
+A Fake phiX Sample,26,25,TA,1,26,24,1,0,40
+A Fake phiX Sample,26,26,AG,1,26,25,2,0,40
+A Fake phiX Sample,26,26,CG,0,26,25,1,0,40
+A Fake phiX Sample,26,26,CT,0,26,25,1,0,40
+A Fake phiX Sample,26,26,GA,0,26,25,2,0,40
+A Fake phiX Sample,26,26,GC,0,26,25,1,0,40
+A Fake phiX Sample,26,26,GG,0,26,25,1,0,40
+A Fake phiX Sample,26,26,TA,1,26,25,1,0,40
+A Fake phiX Sample,26,27,AC,2,26,26,1,0,40
+A Fake phiX Sample,26,27,AG,1,26,26,2,0,40
+A Fake phiX Sample,26,27,CT,0,26,26,1,0,40
+A Fake phiX Sample,26,27,GA,0,26,26,1,0,40
+A Fake phiX Sample,26,27,GC,0,26,26,1,0,40
+A Fake phiX Sample,26,27,GG,0,26,26,2,0,40
+A Fake phiX Sample,26,27,TA,1,26,26,1,0,40
+A Fake phiX Sample,26,28,AC,2,26,27,1,0,40
+A Fake phiX Sample,26,28,AG,1,26,27,1,0,40
+A Fake phiX Sample,26,28,CC,1,26,27,1,0,40
+A Fake phiX Sample,26,28,CT,0,26,27,1,0,40
+A Fake phiX Sample,26,28,GC,0,26,27,2,0,40
+A Fake phiX Sample,26,28,GG,0,26,27,2,0,40
+A Fake phiX Sample,26,28,TA,1,26,27,1,0,40
+A Fake phiX Sample,26,29,AC,2,26,28,1,0,40
+A Fake phiX Sample,26,29,CC,1,26,28,1,0,40
+A Fake phiX Sample,26,29,CT,0,26,28,2,0,40
+A Fake phiX Sample,26,29,GC,0,26,28,2,0,40
+A Fake phiX Sample,26,29,GG,0,26,28,1,0,40
+A Fake phiX Sample,26,29,TA,1,26,28,1,0,40
+A Fake phiX Sample,26,30,AC,2,26,29,1,0,40
+A Fake phiX Sample,26,30,CC,1,26,29,1,0,40
+A Fake phiX Sample,26,30,CT,0,26,29,3,0,40
+A Fake phiX Sample,26,30,GC,0,26,29,1,0,40
+A Fake phiX Sample,26,30,TA,1,26,29,2,0,40
+A Fake phiX Sample,26,31,AC,2,26,30,1,0,40
+A Fake phiX Sample,26,31,CC,1,26,30,1,0,40
+A Fake phiX Sample,26,31,CT,0,26,30,2,0,40
+A Fake phiX Sample,26,31,TA,1,26,30,3,0,40
+A Fake phiX Sample,26,32,AA,0,26,31,1,0,40
+A Fake phiX Sample,26,32,AC,1,26,31,1,0,40
+A Fake phiX Sample,26,32,AC,2,26,31,1,0,40
+A Fake phiX Sample,26,32,CC,1,26,31,1,0,40
+A Fake phiX Sample,26,32,CT,0,26,31,1,0,40
+A Fake phiX Sample,26,32,TA,1,26,31,2,0,40
+A Fake phiX Sample,26,33,AA,0,26,32,1,0,40
+A Fake phiX Sample,26,33,AC,1,26,32,1,0,40
+A Fake phiX Sample,26,33,AC,2,26,32,1,0,40
+A Fake phiX Sample,26,33,AT,0,26,32,1,0,40
+A Fake phiX Sample,26,33,CC,1,26,32,1,0,40
+A Fake phiX Sample,26,33,CT,0,26,32,1,0,40
+A Fake phiX Sample,26,33,TA,1,26,32,1,0,40
+A Fake phiX Sample,26,34,AA,0,26,33,1,0,40
+A Fake phiX Sample,26,34,AC,1,26,33,1,0,40
+A Fake phiX Sample,26,34,AT,0,26,33,1,0,40
+A Fake phiX Sample,26,34,CC,1,26,33,1,0,40
+A Fake phiX Sample,26,34,CT,0,26,33,2,0,40
+A Fake phiX Sample,26,34,TA,1,26,33,1,0,40
+A Fake phiX Sample,26,34,TG,0,26,33,1,0,40
+A Fake phiX Sample,26,35,AA,0,26,34,1,0,40
+A Fake phiX Sample,26,35,AT,0,26,34,1,0,40
+A Fake phiX Sample,26,35,CT,0,26,34,2,0,40
+A Fake phiX Sample,26,35,GA,0,26,34,1,0,40
+A Fake phiX Sample,26,35,TA,1,26,34,2,0,40
+A Fake phiX Sample,26,35,TG,0,26,34,1,0,40
+A Fake phiX Sample,26,36,AA,0,26,35,2,0,40
+A Fake phiX Sample,26,36,AG,0,26,35,1,0,40
+A Fake phiX Sample,26,36,AT,0,26,35,1,0,40
+A Fake phiX Sample,26,36,CT,0,26,35,2,0,40
+A Fake phiX Sample,26,36,GA,0,26,35,1,0,40
+A Fake phiX Sample,26,36,TA,0,26,35,2,0,40
+A Fake phiX Sample,26,36,TG,0,26,35,1,0,40
+EOF
diff -r 000000000000 -r 14e304b70425 test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.log.contains
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_count_covariates/gatk_count_covariates_out_1.log.contains Tue Apr 01 10:51:01 2014 -0400
@@ -0,0 +1,13 @@
+GenomeAnalysisEngine - Strictness is SILENT
+CountCovariatesWalker - The covariates being used here:
+CountCovariatesWalker - ReadGroupCovariate
+CountCovariatesWalker - QualityScoreCovariate
+CountCovariatesWalker - CycleCovariate
+CountCovariatesWalker - DinucCovariate
+CountCovariatesWalker - HomopolymerCovariate
+CountCovariatesWalker - MinimumNQSCovariate
+CountCovariatesWalker - PositionCovariate
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING]
+CountCovariatesWalker - Writing raw recalibration data...
+CountCovariatesWalker - ...done!
+TraversalEngine - Total runtime
diff -r 000000000000 -r 14e304b70425 test-data/gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam
Binary file test-data/gatk/gatk_indel_realigner/gatk_indel_realigner_out_1.bam has changed
diff -r 000000000000 -r 14e304b70425 test-data/phiX.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phiX.fasta Tue Apr 01 10:51:01 2014 -0400
@@ -0,0 +1,79 @@
+>phiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
diff -r 000000000000 -r 14e304b70425 tool-data/gatk_sorted_picard_index.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/gatk_sorted_picard_index.loc.sample Tue Apr 01 10:51:01 2014 -0400
@@ -0,0 +1,26 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Picard dict and associated files. You will need
+#to create these data files and then create a picard_index.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The picard_index.loc
+#file has this format (longer white space is the TAB character):
+#
+#
+#
+#So, for example, if you had hg18 indexed and stored in
+#/depot/data2/galaxy/srma/hg18/,
+#then the srma_index.loc entry would look like this:
+#
+#hg18 hg18 hg18 Pretty /depot/data2/galaxy/picard/hg18/hg18.fa
+#
+#and your /depot/data2/galaxy/srma/hg18/ directory
+#would contain the following three files:
+#hg18.fa
+#hg18.dict
+#hg18.fa.fai
+#
+#The dictionary file for each reference (ex. hg18.dict) must be
+#created via Picard (http://picard.sourceforge.net). Note that
+#the dict file does not have the .fa extension although the
+#path list in the loc file does include it.
+#
diff -r 000000000000 -r 14e304b70425 tool_data_table_conf.xml.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample Tue Apr 01 10:51:01 2014 -0400
@@ -0,0 +1,8 @@
+
+
+
+
+ value, dbkey, name, path
+
+
+
diff -r 000000000000 -r 14e304b70425 tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Tue Apr 01 10:51:01 2014 -0400
@@ -0,0 +1,9 @@
+
+
+
+
+
+
+
+
+