Mercurial > repos > devteam > data_manager_twobit_builder

changeset 3:5c77d4091880 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/data_managers/data_manager_twobit_builder commit 82ad45497a7b2277a710c634378a4122fb75ce1f"
author iuc
date Mon, 18 Nov 2019 17:43:27 -0500
parents 9946bc39c834
children 16c0c73b28ad
files data_manager/twobit_builder.py data_manager/twobit_builder.xml test-data/alignseq.loc test-data/all_fasta.loc test-data/data_manager_twobit.json test-data/lastz_seqs.loc test-data/sacCer2.2bit test-data/sacCer2.fa test-data/twobit.loc tool_data_table_conf.xml.test
diffstat 10 files changed, 172 insertions(+), 34 deletions(-) [+]
line wrap: on
line diff
--- a/data_manager/twobit_builder.py	Tue Apr 04 18:16:29 2017 -0400
+++ b/data_manager/twobit_builder.py	Mon Nov 18 17:43:27 2019 -0500
@@ -12,7 +12,7 @@
 CHUNK_SIZE = 2**20  # 1mb
 
 
-def get_id_name( params, dbkey, fasta_description=None):
+def get_id_name(params, dbkey, fasta_description=None):
     # TODO: ensure sequence_id is unique and does not already appear in location file
     sequence_id = params['param_dict']['sequence_id']
     if not sequence_id:
@@ -26,73 +26,73 @@
     return sequence_id, sequence_name
 
 
-def build_twobit( data_manager_dict, fasta_filename, params, target_directory, dbkey, sequence_id, sequence_name ):
-    twobit_base_name = "%s.2bit" % ( sequence_id )
-    twobit_filename = os.path.join( target_directory, twobit_base_name )
+def build_twobit(data_manager_dict, fasta_filename, params, target_directory, dbkey, sequence_id, sequence_name):
+    twobit_base_name = "%s.2bit" % (sequence_id)
+    twobit_filename = os.path.join(target_directory, twobit_base_name)
 
-    args = [ 'faToTwoBit', fasta_filename, twobit_filename ]
-    tmp_stderr = tempfile.NamedTemporaryFile( prefix="tmp-data-manager-twobit-builder-stderr" )
-    proc = subprocess.Popen( args=args, shell=False, cwd=target_directory, stderr=tmp_stderr.fileno() )
+    args = ['faToTwoBit', fasta_filename, twobit_filename]
+    tmp_stderr = tempfile.NamedTemporaryFile(prefix="tmp-data-manager-twobit-builder-stderr")
+    proc = subprocess.Popen(args=args, shell=False, cwd=target_directory, stderr=tmp_stderr.fileno())
     return_code = proc.wait()
     if return_code:
         tmp_stderr.flush()
         tmp_stderr.seek(0)
         print("Error building index:", file=sys.stderr)
         while True:
-            chunk = tmp_stderr.read( CHUNK_SIZE )
+            chunk = tmp_stderr.read(CHUNK_SIZE)
             if not chunk:
                 break
-            sys.stderr.write( chunk )
-        sys.exit( return_code )
+            sys.stderr.write(chunk)
+        sys.exit(return_code)
     tmp_stderr.close()
     # lastz_seqs
-    data_table_entry = dict( value=sequence_id, name=sequence_name, path=twobit_base_name )
+    data_table_entry = dict(value=sequence_id, name=sequence_name, path=twobit_base_name)
 
-    _add_data_table_entry( data_manager_dict, "lastz_seqs", data_table_entry )
+    _add_data_table_entry(data_manager_dict, "lastz_seqs", data_table_entry)
     # twobit.loc
-    data_table_entry = dict( value=sequence_id, path=twobit_base_name )
+    data_table_entry = dict(value=sequence_id, path=twobit_base_name)
 
-    _add_data_table_entry( data_manager_dict, "twobit", data_table_entry )
+    _add_data_table_entry(data_manager_dict, "twobit", data_table_entry)
     # alignseq
-    data_table_entry = dict( type="seq", value=sequence_id, path=twobit_base_name )
+    data_table_entry = dict(type="seq", value=sequence_id, path=twobit_base_name)
 
-    _add_data_table_entry( data_manager_dict, "alignseq_seq", data_table_entry )
+    _add_data_table_entry(data_manager_dict, "alignseq_seq", data_table_entry)
 
 
-def _add_data_table_entry( data_manager_dict, data_table_name, data_table_entry ):
-    data_manager_dict['data_tables'] = data_manager_dict.get( 'data_tables', {} )
-    data_manager_dict['data_tables'][ data_table_name ] = data_manager_dict['data_tables'].get( data_table_name, [] )
-    data_manager_dict['data_tables'][ data_table_name ].append( data_table_entry )
+def _add_data_table_entry(data_manager_dict, data_table_name, data_table_entry):
+    data_manager_dict['data_tables'] = data_manager_dict.get('data_tables', {})
+    data_manager_dict['data_tables'][data_table_name] = data_manager_dict['data_tables'].get(data_table_name, [])
+    data_manager_dict['data_tables'][data_table_name].append(data_table_entry)
     return data_manager_dict
 
 
 def main():
     parser = optparse.OptionParser()
-    parser.add_option( '-f', '--fasta_filename', dest='fasta_filename', action='store', type="string", default=None, help='fasta_filename' )
-    parser.add_option( '-d', '--fasta_dbkey', dest='fasta_dbkey', action='store', type="string", default=None, help='fasta_dbkey' )
-    parser.add_option( '-t', '--fasta_description', dest='fasta_description', action='store', type="string", default=None, help='fasta_description' )
+    parser.add_option('-f', '--fasta_filename', dest='fasta_filename', action='store', type="string", default=None, help='fasta_filename')
+    parser.add_option('-d', '--fasta_dbkey', dest='fasta_dbkey', action='store', type="string", default=None, help='fasta_dbkey')
+    parser.add_option('-t', '--fasta_description', dest='fasta_description', action='store', type="string", default=None, help='fasta_description')
     (options, args) = parser.parse_args()
 
     filename = args[0]
 
-    params = loads( open( filename ).read() )
+    params = loads(open(filename).read())
 
-    target_directory = params[ 'output_data' ][0]['extra_files_path']
-    os.mkdir( target_directory )
+    target_directory = params['output_data'][0]['extra_files_path']
+    os.mkdir(target_directory)
     data_manager_dict = {}
 
     dbkey = options.fasta_dbkey
 
-    if dbkey in [ None, '', '?' ]:
-        raise Exception( '"%s" is not a valid dbkey. You must specify a valid dbkey.' % ( dbkey ) )
+    if dbkey in [None, '', '?']:
+        raise Exception('"%s" is not a valid dbkey. You must specify a valid dbkey.' % (dbkey))
 
-    sequence_id, sequence_name = get_id_name( params, dbkey=dbkey, fasta_description=options.fasta_description )
+    sequence_id, sequence_name = get_id_name(params, dbkey=dbkey, fasta_description=options.fasta_description)
 
     # build the index
-    build_twobit( data_manager_dict, options.fasta_filename, params, target_directory, dbkey, sequence_id, sequence_name )
+    build_twobit(data_manager_dict, options.fasta_filename, params, target_directory, dbkey, sequence_id, sequence_name)
 
     # save info to json file
-    open( filename, 'wb' ).write( dumps( data_manager_dict ) )
+    open(filename, 'w').write(dumps(data_manager_dict, sort_keys=True))
 
 
 if __name__ == "__main__":
--- a/data_manager/twobit_builder.xml	Tue Apr 04 18:16:29 2017 -0400
+++ b/data_manager/twobit_builder.xml	Mon Nov 18 17:43:27 2019 -0500
@@ -1,6 +1,6 @@
-<tool id="twobit_builder_data_manager" name="TwoBit" tool_type="manage_data" version="0.0.2">
+<tool id="twobit_builder_data_manager" name="TwoBit" tool_type="manage_data" version="0.0.3">
     <requirements>
-        <requirement type="package" version="324">ucsc-fatotwobit</requirement>
+        <requirement type="package" version="377">ucsc-fatotwobit</requirement>
     </requirements>
     <description>builder</description>
     <command detect_errors="exit_code"><![CDATA[
@@ -25,7 +25,7 @@
         <test>
             <param name="all_fasta_source" value="sacCer2"/>
             <param name="sequence_name" value=""/>
-            <output name="sequence_id" file="data_manager_two_bit_out_1.dat"/>
+            <output name="out_file" file="data_manager_twobit.json"/>
         </test>
     </tests>
 
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/alignseq.loc	Mon Nov 18 17:43:27 2019 -0500
@@ -0,0 +1,57 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use alignment data stored as axt files (lines starting with "align")
+#or nib files (lines starting with "seq").  You will need to index
+#them and then create an alignseq.loc file similar to this one (store
+#it in this directory) that points to the directories in which those
+#alignments are stored.  The "align" data referred to by the alignseq.loc
+#file has this format (white space characters are TAB characters):
+#
+#align	<build1>	<build2>	<dir>
+#
+#So, for example, if you had hg18/bosTau2 alignment files stored in
+#/depot/data2/galaxy/hg18/align/bosTau2, then the alignseq.loc entry
+#would look like this:
+#
+#align	hg18	bosTau2	/depot/data2/galaxy/hg18/align/bosTau2
+#
+#and your /depot/data2/galaxy/hg18/align/bosTau2 directory would
+#contain all of your alignment files (e.g.):
+#
+#-rw-rw-r--   1 nate   galaxy 151842783 2006-01-08 01:00 chr10.axt
+#-rw-rw-r--   1 nate   galaxy     79575 2006-01-08 01:00 chr10_random.axt
+#-rw-rw-r--   1 nate   galaxy 155015634 2006-01-08 01:01 chr11.axt
+#...etc...
+#
+#Your alignseq.loc file should include an entry per line for each alignment
+#file you have stored.  For example:
+#
+#align anoGam1 dm1 /depot/data2/galaxy/anoGam1/align/dm1
+#align anoGam1 dm2 /depot/data2/galaxy/anoGam1/align/dm2
+#align canFam1 hg17 /depot/data2/galaxy/canFam1/align/hg17
+#...etc...
+#
+#The "seq" data referred to by the alignseq.loc file has this
+#format (white space characters are TAB characters):
+#
+#seq	<build1>	<dir>
+#
+#So, for example, if you had anoGam1 sequence files stored in
+#/depot/data2/galaxy/anoGam1/seq, then the alignseq.loc entry
+#would look like this:
+#
+#seq anoGam1 /depot/data2/galaxy/anoGam1/seq
+#and your seq anoGam1 /depot/data2/galaxy/anoGam1/seq directory would
+#contain all of your sequence files (e.g.):
+#
+#-rw-rw-r-- 1 nate galaxy 24397551 2006-06-26 12:51 chr2L.nib
+#-rw-rw-r-- 1 nate galaxy 31362964 2006-06-26 12:51 chr2R.nib
+#-rw-rw-r-- 1 nate galaxy 20642013 2006-06-26 12:51 chr3L.nib
+#-rw-rw-r-- 1 nate galaxy 26636071 2006-06-26 12:51 chr3R.nib
+#
+#Your alignseq.loc file should include an entry per line for each sequence
+#file you have stored.  For example:
+#
+#seq anoGam1 /depot/data2/galaxy/anoGam1/seq
+#seq bosTau2 /depot/data2/galaxy/bosTau2/seq
+#seq bosTau3 /depot/data2/galaxy/bosTau3/seq
+#...etc...
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/all_fasta.loc	Mon Nov 18 17:43:27 2019 -0500
@@ -0,0 +1,1 @@
+sacCer2	sacCer2	sacCer2	${__HERE__}/sacCer2.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/data_manager_twobit.json	Mon Nov 18 17:43:27 2019 -0500
@@ -0,0 +1,1 @@
+{"data_tables": {"alignseq_seq": [{"path": "sacCer2.2bit", "type": "seq", "value": "sacCer2"}], "lastz_seqs": [{"name": "sacCer2", "path": "sacCer2.2bit", "value": "sacCer2"}], "twobit": [{"path": "sacCer2.2bit", "value": "sacCer2"}]}}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/lastz_seqs.loc	Mon Nov 18 17:43:27 2019 -0500
@@ -0,0 +1,30 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of 2bit genome files for use with Lastz. You will
+#need to supply these files and then create a lastz_seqs.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The lastz_seqs.loc
+#file has this format (white space characters are TAB characters):
+#
+#<unique_build_id>	<display_name>		<file_path>
+#
+#So, for example, if your lastz_seqs.loc began like this:
+#
+#hg18	Human (Homo sapiens): hg18		/depot/data2/galaxy/twobit/hg18.2bit
+#hg19	Human (Homo sapiens): hg19		/depot/data2/galaxy/twobit/hg19.2bit
+#mm9	Mouse (Mus musculus): mm9		/depot/data2/galaxy/twobit/mm9.2bit
+#
+#then your /depot/data2/galaxy/twobit/ directory
+#would need to contain the following 2bit files:
+#
+#-rw-r--r--  1 james    universe 830134 2005-09-13 10:12 hg18.2bit
+#-rw-r--r--  1 james    universe 527388 2005-09-13 10:12 hg19.2bit
+#-rw-r--r--  1 james    universe 269808 2005-09-13 10:12 mm9.2bit
+#
+#Your lastz_seqs.loc file should include an entry per line for
+#each file you have stored that you want to be available. Note that
+#your files should all have the extension '2bit'.
+#
+#Note that for backwards compatibility with workflows, the unique ID of
+#an entry must be the path that was in the original loc file, because that
+#is the value stored in the workflow for that parameter.
+#
Binary file test-data/sacCer2.2bit has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sacCer2.fa	Mon Nov 18 17:43:27 2019 -0500
@@ -0,0 +1,2 @@
+>chr1
+ATGCATCGATCGATCGCATCGACTACGACTACGATCAGTCACTACACTACGTACAGCTACGACTACGACTACGATCGACTACGATCAGCTACGACA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/twobit.loc	Mon Nov 18 17:43:27 2019 -0500
@@ -0,0 +1,26 @@
+#This is a sample file distributed with Galaxy that is used by some
+#tools.  The twobit.loc file has this format (white space characters
+#are TAB characters):
+#
+#<Build>	<FullPathToFile>
+#
+#So, for example, if you had droPer1 twobit files stored in
+#/depot/data2/galaxy/droPer1/, then the twobit.loc entry
+#would look like this:
+#
+#droPer1	/depot/data2/galaxy/droPer1/droPer1.2bit
+#
+#and your /depot/data2/galaxy/droPer1/ directory would
+#contain all of your twobit files (e.g.):
+#
+#-rw-rw-r--   1 nate   galaxy 48972650 2007-05-04 11:27 droPer1.2bit
+#...etc...
+#
+#Your twobit.loc file should include an entry per line for each twobit
+#file you have stored.  For example:
+#
+#droPer1	/depot/data2/galaxy/droPer1/droPer1.2bit
+#apiMel2	/depot/data2/galaxy/apiMel2/apiMel2.2bit
+#droAna1	/depot/data2/galaxy/droAna1/droAna1.2bit
+#droAna2	/depot/data2/galaxy/droAna2/droAna2.2bit
+#...etc...
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.test	Mon Nov 18 17:43:27 2019 -0500
@@ -0,0 +1,21 @@
+<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc-->
+<tables>
+    <!-- Locations of all fasta files under genome directory -->
+    <table name="all_fasta" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="${__HERE__}/test-data/all_fasta.loc" />
+    </table>
+    <!-- Locations of 2bit sequence files for use in Lastz -->
+    <table name="lastz_seqs" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="${__HERE__}/test-data/lastz_seqs.loc" />
+    </table>
+    <table name="twobit" comment_char="#">
+        <columns>value, path</columns>
+        <file path="${__HERE__}/test-data/twobit.loc" />
+    </table>
+    <table name="alignseq_seq" comment_char="#">
+        <columns>type, value, path</columns>
+        <file path="${__HERE__}/test-data/alignseq.loc" />
+    </table>
+</tables>