changeset 0:c3f08370fc82 draft default tip

Imported from capsule None
author devteam
date Tue, 01 Apr 2014 10:50:51 -0400
parents
children
files depth_of_coverage.xml gatk_macros.xml gatk_wrapper.py test-data/1.bam test-data/a.tab test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1.log.contains test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_cumulative_coverage_counts_sample.tabular test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_output_cumulative_coverage_proportions_sample.tabular test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_per_locus_coverage.tabular test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_statistics_sample.tabular test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_summary_sample.tabular test-data/gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam test-data/phiX.fasta tool-data/gatk_sorted_picard_index.loc.sample tool_data_table_conf.xml.sample tool_dependencies.xml
diffstat 16 files changed, 6713 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/depth_of_coverage.xml	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,743 @@
+<tool id="gatk_depth_of_coverage" name="Depth of Coverage" version="0.0.2">
+  <description>on BAM files</description>
+  <requirements>
+      <requirement type="package" version="1.4">gatk</requirement>
+      <requirement type="package" version="0.1.18">samtools</requirement>
+  </requirements>
+  <macros>
+    <import>gatk_macros.xml</import>
+  </macros>
+  <command interpreter="python">gatk_wrapper.py
+   --max_jvm_heap_fraction "1"
+   --stdout "${output_log}"
+   #for $i, $input_bam in enumerate( $reference_source.input_bams ):
+       -d "-I" "${input_bam.input_bam}" "${input_bam.input_bam.ext}" "gatk_input_${i}"
+       #if str( $input_bam.input_bam.metadata.bam_index ) != "None":
+           -d "" "${input_bam.input_bam.metadata.bam_index}" "bam_index" "gatk_input_${i}" ##hardcode galaxy ext type as bam_index
+       #end if
+   #end for
+   -p 'java 
+    -jar "\$JAVA_JAR_PATH/GenomeAnalysisTK.jar"
+    -T "DepthOfCoverage"
+    ##--num_threads 4 ##hard coded, for now
+    
+    -et "NO_ET" ##ET no phone home
+    #if $reference_source.reference_source_selector != "history":
+        -R "${reference_source.ref_file.fields.path}"
+    #end if
+    #if str( $input_calculate_coverage_over_genes ) != "None":
+        --calculateCoverageOverGenes "${input_calculate_coverage_over_genes}"
+    #end if
+    #if str( $partition_type ) != "None":
+        #for $pt in str( $partition_type ).split( ',' ):
+            --partitionType "${pt}"
+        #end for
+    #end if
+    --out "${output_per_locus_coverage}"
+    
+    #for $ct_group in $summary_coverage_threshold_group:
+        --summaryCoverageThreshold "${ct_group.summary_coverage_threshold}"
+    #end for
+    --outputFormat "${output_format}"
+   '
+   
+    #include source=$standard_gatk_options#
+    ##start analysis specific options
+    #if $analysis_param_type.analysis_param_type_selector == "advanced":
+        -p '
+        ${analysis_param_type.ignore_deletion_sites}
+        ${analysis_param_type.include_deletions}
+        --maxBaseQuality "${analysis_param_type.max_base_quality}"
+        --maxMappingQuality "${analysis_param_type.max_mapping_quality}"
+        --minBaseQuality "${analysis_param_type.min_base_quality}"
+        --minMappingQuality "${analysis_param_type.min_mapping_quality}"
+        --nBins "${analysis_param_type.n_bins}"
+        ${analysis_param_type.omit_depth_output_at_each_base}
+        ${analysis_param_type.omit_interval_statistics}
+        ${analysis_param_type.omit_locus_table}
+        ${analysis_param_type.omit_per_sample_stats}
+        ${analysis_param_type.print_base_counts}
+        ${analysis_param_type.print_bin_endpoints_and_exit}
+        --start "${analysis_param_type.start}"
+        --stop "${analysis_param_type.stop}"
+        '
+    #end if
+    ##Move additional files to final location
+    #if str( $partition_type ) != "None":
+       #set $partition_types = str( $partition_type ).split( ',' )
+    #else:
+        #set $partition_types = [ 'sample' ]
+    #end if
+    #if 'sample' in $partition_types and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.print_bin_endpoints_and_exit ) == "" ):
+        #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_per_sample_stats ) == "":
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_summary ${output_summary_sample}
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_statistics ${output_statistics_sample}
+        #end if
+        #if $gatk_param_type.gatk_param_type_selector == "advanced" and len( $gatk_param_type.input_interval_repeat ) and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_interval_statistics ) == "" ):
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_interval_summary ${output_interval_summary_sample}
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_interval_statistics ${output_interval_statistics_sample}
+        #end if
+        #if str( $input_calculate_coverage_over_genes ) != "None":
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_gene_summary ${output_gene_summary_sample}
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_gene_statistics ${output_gene_statistics_sample}
+        #end if
+        #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_depth_output_at_each_base ) == "":
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_cumulative_coverage_counts ${output_cumulative_coverage_counts_sample}
+            &amp;&amp; mv ${output_per_locus_coverage}.sample_cumulative_coverage_proportions ${output_cumulative_coverage_proportions_sample}
+        #end if
+    #end if
+    
+    #if 'readgroup' in $partition_types and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.print_bin_endpoints_and_exit ) == "" ):
+        #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_per_sample_stats ) == "":
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_summary ${output_summary_readgroup}
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_statistics ${output_statistics_readgroup}
+        #end if
+        #if $gatk_param_type.gatk_param_type_selector == "advanced" and len( $gatk_param_type.input_interval_repeat ) and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_interval_statistics ) == "" ):
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_interval_summary ${output_interval_summary_readgroup}
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_interval_statistics ${output_interval_statistics_readgroup}
+        #end if
+        #if str( $input_calculate_coverage_over_genes ) != "None":
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_gene_summary ${output_gene_summary_readgroup}
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_gene_statistics ${output_gene_statistics_readgroup}
+        #end if
+        #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_depth_output_at_each_base ) == "":
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_cumulative_coverage_counts ${output_cumulative_coverage_counts_readgroup}
+            &amp;&amp; mv ${output_per_locus_coverage}.read_group_cumulative_coverage_proportions ${output_cumulative_coverage_proportions_readgroup}
+        #end if
+    #end if
+    
+    #if 'library' in $partition_types and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.print_bin_endpoints_and_exit ) == "" ):
+        #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_per_sample_stats ) == "":
+            &amp;&amp; mv ${output_per_locus_coverage}.library_summary ${output_summary_library}
+            &amp;&amp; mv ${output_per_locus_coverage}.library_statistics ${output_statistics_library}
+        #end if
+        #if $gatk_param_type.gatk_param_type_selector == "advanced" and len( $gatk_param_type.input_interval_repeat ) and ( str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_interval_statistics ) == "" ):
+            &amp;&amp; mv ${output_per_locus_coverage}.library_interval_summary ${output_interval_summary_library}
+            &amp;&amp; mv ${output_per_locus_coverage}.library_interval_statistics ${output_interval_statistics_library}
+        #end if
+        #if str( $input_calculate_coverage_over_genes ) != "None":
+            &amp;&amp; mv ${output_per_locus_coverage}.library_gene_summary ${output_gene_summary_library}
+            &amp;&amp; mv ${output_per_locus_coverage}.library_gene_statistics ${output_gene_statistics_library}
+        #end if
+        #if str( $analysis_param_type.analysis_param_type_selector ) == "basic" or str( $analysis_param_type.omit_depth_output_at_each_base ) == "":
+            &amp;&amp; mv ${output_per_locus_coverage}.library_cumulative_coverage_counts ${output_cumulative_coverage_counts_library}
+            &amp;&amp; mv ${output_per_locus_coverage}.library_cumulative_coverage_proportions ${output_cumulative_coverage_proportions_library}
+        #end if
+    #end if
+    
+
+  </command>
+  <inputs>
+    <conditional name="reference_source">
+      <expand macro="reference_source_selector_param" />
+      <when value="cached">
+        <repeat name="input_bams" title="BAM file" min="1" help="-I,--input_file &amp;lt;input_file&amp;gt;">
+            <param name="input_bam" type="data" format="bam" label="BAM file">
+              <validator type="unspecified_build" />
+              <validator type="dataset_metadata_in_data_table" table_name="gatk_picard_indexes" metadata_name="dbkey" metadata_column="dbkey" message="Sequences are not currently available for the specified build." /> <!-- fixme!!! this needs to be a select -->
+            </param>
+        </repeat>
+        <param name="ref_file" type="select" label="Using reference genome" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;">
+          <options from_data_table="gatk_picard_indexes">
+            <!-- <filter type="data_meta" key="dbkey" ref="input_bam" column="dbkey"/> does not yet work in a repeat...--> 
+          </options>
+          <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/>
+        </param>
+      </when>
+      <when value="history"> <!-- FIX ME!!!! -->
+        <repeat name="input_bams" title="BAM file" min="1" help="-I,--input_file &amp;lt;input_file&amp;gt;">
+            <param name="input_bam" type="data" format="bam" label="BAM file" />
+        </repeat>
+        <param name="ref_file" type="data" format="fasta" label="Using reference file" help="-R,--reference_sequence &amp;lt;reference_sequence&amp;gt;" />
+      </when>
+    </conditional>
+    
+    <param name="input_calculate_coverage_over_genes" type="data" format="data" label="RefSeq Rod" optional="True" help="-geneList,--calculateCoverageOverGenes &amp;lt;calculateCoverageOverGenes&amp;gt;" />
+    
+    <param name="partition_type" type="select" label="Partition type for depth of coverage" multiple="True" display="checkboxes" help="-pt,--partitionType &amp;lt;partitionType&amp;gt;">
+      <option value="sample" selected="True">sample</option>
+      <option value="readgroup">readgroup</option>
+      <option value="library">library</option>
+    </param>
+    
+    <repeat name="summary_coverage_threshold_group" title="Summary coverage threshold" help="-ct,--summaryCoverageThreshold &amp;lt;summaryCoverageThreshold&amp;gt;">
+        <param name="summary_coverage_threshold" type="integer" value="15" label="for summary file outputs, report the % of bases covered to &gt;= this number" />
+    </repeat>
+    
+    <param name="output_format" type="select" label="Output format" help="--outputFormat &amp;lt;outputFormat&amp;gt;" >
+      <option value="csv">csv</option>
+      <option value="table">table</option>
+      <option value="rtable" selected="True">rtable</option>
+    </param>
+    
+    <expand macro="gatk_param_type_conditional" />
+    
+    <expand macro="analysis_type_conditional">
+        <param name="ignore_deletion_sites" type="boolean" truevalue="--ignoreDeletionSites" falsevalue="" checked="False" label="Ignore sites consisting only of deletions" help="--ignoreDeletionSites" />
+        <param name="include_deletions" type="boolean" truevalue="--includeDeletions" falsevalue="" checked="False" label="Include information on deletions" help="-dels,--includeDeletions" />
+        <param name="max_base_quality" type="integer" value="127" label="Maximum quality of bases to count towards depth" help="--maxBaseQuality &amp;lt;maxBaseQuality&amp;gt;" />
+        <param name="min_base_quality" type="integer" value="-1" label="Minimum quality of bases to count towards depth" help="-mbq,--minBaseQuality &amp;lt;minBaseQuality&amp;gt;" />
+        <param name="max_mapping_quality" type="integer" value="2147483647" label="Maximum mapping quality of reads to count towards depth." help="--maxMappingQuality &amp;lt;maxMappingQuality&amp;gt;" />
+        <param name="min_mapping_quality" type="integer" value="127" label="Minimum mapping quality of reads to count towards depth" help="-mmq,--minMappingQuality &amp;lt;minMappingQuality&amp;gt;" />
+        <param name="n_bins" type="integer" value="499" label="Number of bins to use for granular binning" help="--nBins &amp;lt;nBins&amp;gt;" />
+        <param name="omit_depth_output_at_each_base" type="boolean" truevalue="--omitDepthOutputAtEachBase" falsevalue="" checked="False" label="Omit the output of the depth of coverage at each base" help="-omitBaseOutput,--omitDepthOutputAtEachBase" />
+        <param name="omit_interval_statistics" type="boolean" truevalue="--omitIntervalStatistics" falsevalue="" checked="False" label="Omit the per-interval statistics section" help="-omitIntervals,--omitIntervalStatistics" />
+        <param name="omit_locus_table" type="boolean" truevalue="--omitLocusTable" falsevalue="" checked="False" label="Do not calculate the per-sample per-depth counts of loci" help="-omitLocusTable,--omitLocusTable" />
+        <param name="omit_per_sample_stats" type="boolean" truevalue="--omitPerSampleStats" falsevalue="" checked="False" label="Omit the summary files per-sample." help="-omitSampleSummary,--omitPerSampleStats" />
+        <param name="print_base_counts" type="boolean" truevalue="--printBaseCounts" falsevalue="" checked="False" label="Add base counts to per-locus output" help="-baseCounts,--printBaseCounts" />
+        <param name="print_bin_endpoints_and_exit" type="boolean" truevalue="--printBinEndpointsAndExit" falsevalue="" checked="False" label="Print the bin values and exits immediately" help="--printBinEndpointsAndExit" />
+        <param name="start" type="integer" value="1" label="Starting (left endpoint) for granular binning" help="--start &amp;lt;start&amp;gt;" />
+        <param name="stop" type="integer" value="500" label="Ending (right endpoint) for granular binning" help="--stop &amp;lt;stop&amp;gt;" />
+    </expand>
+  </inputs>
+  <outputs>
+    <data format="tabular" name="output_per_locus_coverage" label="${tool.name} on ${on_string} (per locus coverage)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_summary_sample" label="${tool.name} on ${on_string} (output summary sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'sample' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_statistics_sample" label="${tool.name} on ${on_string} (output statistics sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'sample' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_interval_summary_sample" label="${tool.name} on ${on_string} (output interval summary sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'sample' in partition_type or not partition_type</filter>
+        <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_interval_statistics_sample" label="${tool.name} on ${on_string} (output interval statistics sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'sample' in partition_type or not partition_type</filter>
+        <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_gene_summary_sample" label="${tool.name} on ${on_string} (output gene summary sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>input_calculate_coverage_over_genes is not None and 'sample' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_gene_statistics_sample" label="${tool.name} on ${on_string} (output gene statistics sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>input_calculate_coverage_over_genes is not None and 'sample' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_cumulative_coverage_counts_sample" label="${tool.name} on ${on_string} (output cumulative coverage counts sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'sample' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_cumulative_coverage_proportions_sample" label="${tool.name} on ${on_string} (output cumulative coverage proportions sample)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'sample' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    
+    <data format="tabular" name="output_summary_readgroup" label="${tool.name} on ${on_string} (output summary readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'readgroup' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_statistics_readgroup" label="${tool.name} on ${on_string} (output statistics readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'readgroup' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_interval_summary_readgroup" label="${tool.name} on ${on_string} (output interval summary readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'readgroup' in partition_type</filter>
+        <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_interval_statistics_readgroup" label="${tool.name} on ${on_string} (output interval statistics readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'readgroup' in partition_type</filter>
+        <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_gene_summary_readgroup" label="${tool.name} on ${on_string} (output gene summary readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>input_calculate_coverage_over_genes is not None and 'readgroup' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_gene_statistics_readgroup" label="${tool.name} on ${on_string} (output gene statistics readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>input_calculate_coverage_over_genes is not None and 'readgroup' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_cumulative_coverage_counts_readgroup" label="${tool.name} on ${on_string} (output cumulative coverage counts readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter>
+        <filter>'readgroup' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_cumulative_coverage_proportions_readgroup" label="${tool.name} on ${on_string} (output cumulative coverage proportions readgroup)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter>
+        <filter>'readgroup' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    
+    <data format="tabular" name="output_summary_library" label="${tool.name} on ${on_string} (output summary library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'library' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_statistics_library" label="${tool.name} on ${on_string} (output statistics library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_per_sample_stats'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'library' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_interval_summary_library" label="${tool.name} on ${on_string} (output interval summary library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'library' in partition_type</filter>
+        <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_interval_statistics_library" label="${tool.name} on ${on_string} (output interval statistics library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'library' in partition_type</filter>
+        <filter>gatk_param_type['gatk_param_type_selector'] == "advanced" and len( gatk_param_type['input_interval_repeat'] )</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_interval_statistics'] == False</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_gene_summary_library" label="${tool.name} on ${on_string} (output gene summary library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>input_calculate_coverage_over_genes is not None and 'library' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_gene_statistics_library" label="${tool.name} on ${on_string} (output gene statistics library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>input_calculate_coverage_over_genes is not None and 'library' in partition_type or not partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_cumulative_coverage_counts_library" label="${tool.name} on ${on_string} (output cumulative coverage counts library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'library' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    <data format="tabular" name="output_cumulative_coverage_proportions_library" label="${tool.name} on ${on_string} (output cumulative coverage proportions library)" >
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['omit_depth_output_at_each_base'] == False</filter>
+        <filter>analysis_param_type['analysis_param_type_selector'] == "basic" or analysis_param_type['print_bin_endpoints_and_exit'] == False</filter>
+        <filter>'library' in partition_type</filter>
+        <actions>
+            <conditional name="output_format">
+                <when value="rtable">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+                <when value="csv">
+                    <action type="format">
+                        <option type="from_param" name="output_format" />
+                    </action>
+                </when>
+            </conditional>
+        </actions>
+    </data>
+    
+    <data format="tabular" name="output_log" label="${tool.name} on ${on_string} (log)" />
+  </outputs>
+  <trackster_conf/>
+  <tests>
+      <test>
+          <param name="reference_source_selector" value="history" />
+          <param name="ref_file" value="phiX.fasta" ftype="fasta" />
+          <param name="input_bam" value="gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam" ftype="bam" />
+          <param name="input_calculate_coverage_over_genes" />
+          <param name="partition_type" value="sample" />
+          <param name="summary_coverage_threshold_group" value="0" />
+          <param name="output_format" value="rtable" />
+          <param name="gatk_param_type_selector" value="basic" />
+          <param name="analysis_param_type_selector" value="basic" />
+          <output name="output_per_locus_coverage" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_per_locus_coverage.tabular" />
+          <output name="output_summary_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_summary_sample.tabular" />
+          <output name="output_statistics_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_statistics_sample.tabular" />
+          <output name="output_cumulative_coverage_counts_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_cumulative_coverage_counts_sample.tabular" />
+          <output name="output_cumulative_coverage_proportions_sample" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_output_cumulative_coverage_proportions_sample.tabular" />
+          <output name="output_log" file="gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1.log.contains" compare="contains" />
+      </test>
+  </tests>
+  <help>
+**What it does**
+
+DepthOfCoverage processes a set of bam files to determine coverage at different levels of partitioning and aggregation. Coverage can be analyzed per locus, per interval, per gene, or in total; can be partitioned by sample, by read group, by technology, by center, or by library; and can be summarized by mean, median, quartiles, and/or percentage of bases covered to or beyond a threshold. Additionally, reads and bases can be filtered by mapping or base quality score. 
+
+For more information on the GATK Depth of Coverage, see this `tool specific page &lt;http://www.broadinstitute.org/gsa/wiki/index.php/Depth_of_Coverage&gt;`_.
+
+To learn about best practices for variant detection using GATK, see this `overview &lt;http://www.broadinstitute.org/gsa/wiki/index.php/Best_Practice_Variant_Detection_with_the_GATK_v3&gt;`_.
+
+If you encounter errors, please view the `GATK FAQ &lt;http://www.broadinstitute.org/gsa/wiki/index.php/Frequently_Asked_Questions&gt;`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: DepthOfCoverage accepts aligned BAM input files.
+
+
+**Outputs**
+
+The output is in various table formats.
+
+
+Go `here &lt;http://www.broadinstitute.org/gsa/wiki/index.php/Input_files_for_the_GATK&gt;`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+ calculateCoverageOverGenes     File     NA     Calculate the coverage statistics over this list of genes. Currently accepts RefSeq.
+ ignoreDeletionSites     boolean     false     Ignore sites consisting only of deletions
+ includeDeletions     boolean     false     Include information on deletions
+ maxBaseQuality     byte     127     Maximum quality of bases to count towards depth. Defaults to 127 (Byte.MAX_VALUE).
+ maxMappingQuality     int     2147483647     Maximum mapping quality of reads to count towards depth. Defaults to 2^31-1 (Integer.MAX_VALUE).
+ minBaseQuality     byte     -1     Minimum quality of bases to count towards depth. Defaults to -1.
+ minMappingQuality     int     -1     Minimum mapping quality of reads to count towards depth. Defaults to -1.
+ nBins     int     499     Number of bins to use for granular binning
+ omitDepthOutputAtEachBase     boolean     false     Will omit the output of the depth of coverage at each base, which should result in speedup
+ omitIntervalStatistics     boolean     false     Will omit the per-interval statistics section, which should result in speedup
+ omitLocusTable     boolean     false     Will not calculate the per-sample per-depth counts of loci, which should result in speedup
+ omitPerSampleStats     boolean     false     Omits the summary files per-sample. These statistics are still calculated, so this argument will not improve runtime.
+ outputFormat     String     rtable     the format of the output file (e.g. csv, table, rtable); defaults to r-readable table
+ partitionType     Set[Partition]     [sample]     Partition type for depth of coverage. Defaults to sample. Can be any combination of sample, readgroup, library.
+ printBaseCounts     boolean     false     Will add base counts to per-locus output.
+ printBinEndpointsAndExit     boolean     false     Prints the bin values and exits immediately. Use to calibrate what bins you want before running on data.
+ start     int     1     Starting (left endpoint) for granular binning
+ stop     int     500     Ending (right endpoint) for granular binning
+ summaryCoverageThreshold     int[]     [15]     for summary file outputs, report the % of bases coverd to >= this number. Defaults to 15; can take multiple arguments.
+
+@CITATION_SECTION@
+  </help>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/gatk_macros.xml	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,305 @@
+<macros>
+  <template name="standard_gatk_options">      
+    ##start standard gatk options
+    #if $gatk_param_type.gatk_param_type_selector == "advanced":
+        #for $pedigree in $gatk_param_type.pedigree:
+            -p '--pedigree "${pedigree.pedigree_file}"'
+        #end for
+        #for $pedigree_string in $gatk_param_type.pedigree_string_repeat:
+            -p '--pedigreeString "${pedigree_string.pedigree_string}"'
+        #end for
+        -p '--pedigreeValidationType "${gatk_param_type.pedigree_validation_type}"'
+        #for $read_filter in $gatk_param_type.read_filter:
+            -p '--read_filter "${read_filter.read_filter_type.read_filter_type_selector}"
+            ###raise Exception( str( dir( $read_filter ) ) )
+            #for $name, $param in $read_filter.read_filter_type.iteritems():
+                #if $name not in [ "__current_case__", "read_filter_type_selector" ]:
+                    #if hasattr( $param.input, 'truevalue' ):
+                        ${param}
+                    #else:
+                        --${name} "${param}"
+                    #end if
+                #end if
+            #end for
+            '
+        #end for
+        #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_interval_repeat ):
+            -d "--intervals" "${input_intervals.input_intervals}" "${input_intervals.input_intervals.ext}" "input_intervals_${interval_count}"
+        #end for
+        
+        #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_exclude_interval_repeat ):
+            -d "--excludeIntervals" "${input_intervals.input_exclude_intervals}" "${input_intervals.input_exclude_intervals.ext}" "input_exlude_intervals_${interval_count}"
+        #end for
+
+        -p '--interval_set_rule "${gatk_param_type.interval_set_rule}"'
+        
+        -p '--downsampling_type "${gatk_param_type.downsampling_type.downsampling_type_selector}"'
+        #if str( $gatk_param_type.downsampling_type.downsampling_type_selector ) != "NONE":
+            -p '--${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_type_selector} "${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_value}"'
+        #end if
+        -p '
+        --baq "${gatk_param_type.baq}"
+        --baqGapOpenPenalty "${gatk_param_type.baq_gap_open_penalty}"
+        ${gatk_param_type.use_original_qualities}
+        --defaultBaseQualities "${gatk_param_type.default_base_qualities}"
+        --validation_strictness "${gatk_param_type.validation_strictness}"
+        --interval_merging "${gatk_param_type.interval_merging}"
+        ${gatk_param_type.disable_experimental_low_memory_sharding}
+        ${gatk_param_type.non_deterministic_random_seed}
+        '
+        #for $rg_black_list_count, $rg_black_list in enumerate( $gatk_param_type.read_group_black_list_repeat ):
+            #if $rg_black_list.read_group_black_list_type.read_group_black_list_type_selector == "file":
+                -d "--read_group_black_list" "${rg_black_list.read_group_black_list_type.read_group_black_list}" "txt" "input_read_group_black_list_${rg_black_list_count}"
+            #else
+                -p '--read_group_black_list "${rg_black_list.read_group_black_list_type.read_group_black_list}"'
+            #end if
+        #end for
+    #end if
+    
+    #if str( $reference_source.reference_source_selector ) == "history":
+        -d "-R" "${reference_source.ref_file}" "${reference_source.ref_file.ext}" "gatk_input"
+    #end if
+    ##end standard gatk options
+  </template>
+  <xml name="gatk_param_type_conditional">
+    <conditional name="gatk_param_type">
+      <param name="gatk_param_type_selector" type="select" label="Basic or Advanced GATK options">
+        <option value="basic" selected="True">Basic</option>
+        <option value="advanced">Advanced</option>
+      </param>
+      <when value="basic">
+        <!-- Do nothing here -->
+      </when>
+      <when value="advanced">
+        <repeat name="pedigree" title="Pedigree file" help="-ped,--pedigree &amp;lt;pedigree&amp;gt;">
+            <param name="pedigree_file" type="data" format="txt" label="Pedigree files for samples"/>
+        </repeat>
+        <repeat name="pedigree_string_repeat" title="Pedigree string" help="-pedString,--pedigreeString &amp;lt;pedigreeString&amp;gt;">
+            <param name="pedigree_string" type="text" value="" label="Pedigree string for samples"/>
+        </repeat>
+        <param name="pedigree_validation_type" type="select" label="How strict should we be in validating the pedigree information" help="-pedValidationType,--pedigreeValidationType &amp;lt;pedigreeValidationType&amp;gt;">
+          <option value="STRICT" selected="True">STRICT</option>
+          <option value="SILENT">SILENT</option>
+        </param>
+        <repeat name="read_filter" title="Read Filter" help="-rf,--read_filter &amp;lt;read_filter&amp;gt;">
+            <conditional name="read_filter_type">
+              <param name="read_filter_type_selector" type="select" label="Read Filter Type">
+                <option value="BadCigar">BadCigar</option>
+                <option value="BadMate">BadMate</option>
+                <option value="DuplicateRead">DuplicateRead</option>
+                <option value="FailsVendorQualityCheck">FailsVendorQualityCheck</option>
+                <option value="MalformedRead">MalformedRead</option>
+                <option value="MappingQuality">MappingQuality</option>
+                <option value="MappingQualityUnavailable">MappingQualityUnavailable</option>
+                <option value="MappingQualityZero">MappingQualityZero</option>
+                <option value="MateSameStrand">MateSameStrand</option>
+                <option value="MaxInsertSize">MaxInsertSize</option>
+                <option value="MaxReadLength" selected="True">MaxReadLength</option>
+                <option value="MissingReadGroup">MissingReadGroup</option>
+                <option value="NoOriginalQualityScores">NoOriginalQualityScores</option>
+                <option value="NotPrimaryAlignment">NotPrimaryAlignment</option>
+                <option value="Platform454">Platform454</option>
+                <option value="Platform">Platform</option>
+                <option value="PlatformUnit">PlatformUnit</option>
+                <option value="ReadGroupBlackList">ReadGroupBlackList</option>
+                <option value="ReadName">ReadName</option>
+                <option value="ReadStrand">ReadStrand</option>
+                <option value="ReassignMappingQuality">ReassignMappingQuality</option>
+                <option value="Sample">Sample</option>
+                <option value="SingleReadGroup">SingleReadGroup</option>
+                <option value="UnmappedRead">UnmappedRead</option>
+              </param>
+              <when value="BadCigar">
+                  <!-- no extra options -->
+              </when>
+              <when value="BadMate">
+                  <!-- no extra options -->
+              </when>
+              <when value="DuplicateRead">
+                  <!-- no extra options -->
+              </when>
+              <when value="FailsVendorQualityCheck">
+                  <!-- no extra options -->
+              </when>
+              <when value="MalformedRead">
+                  <!-- no extra options -->
+              </when>
+              <when value="MappingQuality">
+                  <param name="min_mapping_quality_score" type="integer" value="10" label="Minimum read mapping quality required to consider a read for calling"/>
+              </when>
+              <when value="MappingQualityUnavailable">
+                  <!-- no extra options -->
+              </when>
+              <when value="MappingQualityZero">
+                  <!-- no extra options -->
+              </when>
+              <when value="MateSameStrand">
+                  <!-- no extra options -->
+              </when>
+              <when value="MaxInsertSize">
+                  <param name="maxInsertSize" type="integer" value="1000000" label="Discard reads with insert size greater than the specified value"/>
+              </when>
+              <when value="MaxReadLength">
+                  <param name="maxReadLength" type="integer" value="76" label="Max Read Length"/>
+              </when>
+              <when value="MissingReadGroup">
+                  <!-- no extra options -->
+              </when>
+              <when value="NoOriginalQualityScores">
+                  <!-- no extra options -->
+              </when>
+              <when value="NotPrimaryAlignment">
+                  <!-- no extra options -->
+              </when>
+              <when value="Platform454">
+                  <!-- no extra options -->
+              </when>
+              <when value="Platform">
+                  <param name="PLFilterName" type="text" value="" label="Discard reads with RG:PL attribute containing this string"/>
+              </when>
+              <when value="PlatformUnit">
+                  <!-- no extra options -->
+              </when>
+              <when value="ReadGroupBlackList">
+                  <!-- no extra options -->
+              </when>
+              <when value="ReadName">
+                  <param name="readName" type="text" value="" label="Filter out all reads except those with this read name"/>
+              </when>
+              <when value="ReadStrand">
+                  <param name="filterPositive" type="boolean" truevalue="--filterPositive" falsevalue="" label="Discard reads on the forward strand"/>
+              </when>
+              <when value="ReassignMappingQuality">
+                  <param name="default_mapping_quality" type="integer" value="60" label="Default read mapping quality to assign to all reads"/>
+              </when>
+              <when value="Sample">
+                  <param name="sample_to_keep" type="text" value="" label="The name of the sample(s) to keep, filtering out all others"/>
+              </when>
+              <when value="SingleReadGroup">
+                  <param name="read_group_to_keep" type="integer" value="76" label="The name of the read group to keep, filtering out all others"/>
+              </when>
+              <when value="UnmappedRead">
+                  <!-- no extra options -->
+              </when>
+            </conditional>
+        </repeat>
+        <repeat name="input_interval_repeat" title="Operate on Genomic intervals" help="-L,--intervals &amp;lt;intervals&amp;gt;">
+          <param name="input_intervals" type="data" format="bed,gatk_interval,picard_interval_list,vcf" label="Genomic intervals" />
+        </repeat>
+        <repeat name="input_exclude_interval_repeat" title="Exclude Genomic intervals" help="-XL,--excludeIntervals &amp;lt;excludeIntervals&amp;gt;">
+          <param name="input_exclude_intervals" type="data" format="bed,gatk_interval,picard_interval_list,vcf" label="Genomic intervals" />
+        </repeat>
+        
+        <param name="interval_set_rule" type="select" label="Interval set rule" help="-isr,--interval_set_rule &amp;lt;interval_set_rule&amp;gt;">
+          <option value="UNION" selected="True">UNION</option>
+          <option value="INTERSECTION">INTERSECTION</option>
+        </param>
+        
+        <conditional name="downsampling_type">
+          <param name="downsampling_type_selector" type="select" label="Type of reads downsampling to employ at a given locus" help="-dt,--downsampling_type &amp;lt;downsampling_type&amp;gt;">
+            <option value="NONE" selected="True">NONE</option>
+            <option value="ALL_READS">ALL_READS</option>
+            <option value="BY_SAMPLE">BY_SAMPLE</option>
+          </param>
+          <when value="NONE">
+              <!-- no more options here -->
+          </when>
+          <when value="ALL_READS">
+              <conditional name="downsample_to_type">
+                  <param name="downsample_to_type_selector" type="select" label="Downsample method">
+                      <option value="downsample_to_fraction" selected="True">Downsample by Fraction</option>
+                      <option value="downsample_to_coverage">Downsample by Coverage</option>
+                  </param>
+                  <when value="downsample_to_fraction">
+                      <param name="downsample_to_value" type="float" label="Fraction [0.0-1.0] of reads to downsample to" value="1" min="0" max="1" help="-dfrac,--downsample_to_fraction &amp;lt;downsample_to_fraction&amp;gt;"/>
+                  </when>
+                  <when value="downsample_to_coverage">
+                      <param name="downsample_to_value" type="integer" label="Coverage to downsample to at any given locus" value="0" help="-dcov,--downsample_to_coverage &amp;lt;downsample_to_coverage&amp;gt;"/>
+                  </when>
+              </conditional>
+          </when>
+          <when value="BY_SAMPLE">
+              <conditional name="downsample_to_type">
+                  <param name="downsample_to_type_selector" type="select" label="Downsample method">
+                      <option value="downsample_to_fraction" selected="True">Downsample by Fraction</option>
+                      <option value="downsample_to_coverage">Downsample by Coverage</option>
+                  </param>
+                  <when value="downsample_to_fraction">
+                      <param name="downsample_to_value" type="float" label="Fraction [0.0-1.0] of reads to downsample to" value="1" min="0" max="1" help="-dfrac,--downsample_to_fraction &amp;lt;downsample_to_fraction&amp;gt;"/>
+                  </when>
+                  <when value="downsample_to_coverage">
+                      <param name="downsample_to_value" type="integer" label="Coverage to downsample to at any given locus" value="0" help="-dcov,--downsample_to_coverage &amp;lt;downsample_to_coverage&amp;gt;"/>
+                  </when>
+              </conditional>
+          </when>
+        </conditional>
+        <param name="baq" type="select" label="Type of BAQ calculation to apply in the engine" help="-baq,--baq &amp;lt;baq&amp;gt;">
+          <option value="OFF" selected="True">OFF</option>
+          <option value="CALCULATE_AS_NECESSARY">CALCULATE_AS_NECESSARY</option>
+          <option value="RECALCULATE">RECALCULATE</option>
+        </param>
+        <param name="baq_gap_open_penalty" type="float" label="BAQ gap open penalty (Phred Scaled)" value="40" help="Default value is 40. 30 is perhaps better for whole genome call sets. -baqGOP,--baqGapOpenPenalty &amp;lt;baqGapOpenPenalty&amp;gt;" />
+        <param name="use_original_qualities" type="boolean" truevalue="--useOriginalQualities" falsevalue="" label="Use the original base quality scores from the OQ tag" help="-OQ,--useOriginalQualities" />
+        <param name="default_base_qualities" type="integer" label="Value to be used for all base quality scores, when some are missing" value="-1" help="-DBQ,--defaultBaseQualities &amp;lt;defaultBaseQualities&amp;gt;"/>
+        <param name="validation_strictness" type="select" label="How strict should we be with validation" help="-S,--validation_strictness &amp;lt;validation_strictness&amp;gt;">
+          <option value="STRICT" selected="True">STRICT</option>
+          <option value="LENIENT">LENIENT</option>
+          <option value="SILENT">SILENT</option>
+          <!-- <option value="DEFAULT_STRINGENCY">DEFAULT_STRINGENCY</option> listed in docs, but not valid value...-->
+        </param>
+        <param name="interval_merging" type="select" label="Interval merging rule" help="-im,--interval_merging &amp;lt;interval_merging&amp;gt;">
+          <option value="ALL" selected="True">ALL</option>
+          <option value="OVERLAPPING_ONLY">OVERLAPPING_ONLY</option>
+        </param>
+        
+        <repeat name="read_group_black_list_repeat" title="Read group black list" help="-rgbl,--read_group_black_list &amp;lt;read_group_black_list&amp;gt;">
+          <conditional name="read_group_black_list_type">
+            <param name="read_group_black_list_type_selector" type="select" label="Type of reads read group black list">
+              <option value="file" selected="True">Filters in file</option>
+              <option value="text">Specify filters as a string</option>
+            </param>
+            <when value="file">
+              <param name="read_group_black_list" type="data" format="txt" label="Read group black list file" />
+            </when>
+            <when value="text">
+              <param name="read_group_black_list" type="text" value="tag:string" label="Read group black list tag:string" />
+            </when>
+          </conditional>
+        </repeat>
+        
+        <param name="disable_experimental_low_memory_sharding" type="boolean" truevalue="--disable_experimental_low_memory_sharding" falsevalue="" label="Disable experimental low-memory sharding functionality." checked="False" help="--disable_experimental_low_memory_sharding"/>
+        <param name="non_deterministic_random_seed" type="boolean" truevalue="--nonDeterministicRandomSeed" falsevalue="" label="Makes the GATK behave non deterministically, that is, the random numbers generated will be different in every run" checked="False"  help="-ndrs,--nonDeterministicRandomSeed"/>
+        
+      </when>
+    </conditional>    
+  </xml>
+  <xml name="analysis_type_conditional">
+    <conditional name="analysis_param_type">
+      <param name="analysis_param_type_selector" type="select" label="Basic or Advanced Analysis options">
+        <option value="basic" selected="True">Basic</option>
+        <option value="advanced">Advanced</option>
+      </param>
+      <when value="basic">
+        <!-- Do nothing here -->
+      </when>
+      <when value="advanced">
+        <yield />
+      </when>
+    </conditional>
+  </xml>
+  <xml name="reference_source_selector_param">
+    <param name="reference_source_selector" type="select" label="Choose the source for the reference list">
+      <option value="cached">Locally cached</option>
+      <option value="history">History</option>
+    </param>
+  </xml>
+  <token name="@CITATION_SECTION@">------
+
+**Citation**
+
+For the underlying tool, please cite `DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011 May;43(5):491-8. &lt;http://www.ncbi.nlm.nih.gov/pubmed/21478889&gt;`_
+
+If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.*
+
+  </token>
+</macros>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/gatk_wrapper.py	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,126 @@
+#!/usr/bin/env python
+#Dan Blankenberg
+
+"""
+A wrapper script for running the GenomeAnalysisTK.jar commands.
+"""
+
+import sys, optparse, os, tempfile, subprocess, shutil
+from binascii import unhexlify
+from string import Template
+
+GALAXY_EXT_TO_GATK_EXT = { 'gatk_interval':'intervals', 'bam_index':'bam.bai', 'gatk_dbsnp':'dbSNP', 'picard_interval_list':'interval_list' } #items not listed here will use the galaxy extension as-is
+GALAXY_EXT_TO_GATK_FILE_TYPE = GALAXY_EXT_TO_GATK_EXT #for now, these are the same, but could be different if needed
+DEFAULT_GATK_PREFIX = "gatk_file"
+CHUNK_SIZE = 2**20 #1mb
+
+
+def cleanup_before_exit( tmp_dir ):
+    if tmp_dir and os.path.exists( tmp_dir ):
+        shutil.rmtree( tmp_dir )
+
+def gatk_filename_from_galaxy( galaxy_filename, galaxy_ext, target_dir = None, prefix = None ):
+    suffix = GALAXY_EXT_TO_GATK_EXT.get( galaxy_ext, galaxy_ext )
+    if prefix is None:
+        prefix = DEFAULT_GATK_PREFIX
+    if target_dir is None:
+        target_dir = os.getcwd()
+    gatk_filename = os.path.join( target_dir, "%s.%s" % ( prefix, suffix ) )
+    os.symlink( galaxy_filename, gatk_filename )
+    return gatk_filename
+
+def gatk_filetype_argument_substitution( argument, galaxy_ext ):
+    return argument % dict( file_type = GALAXY_EXT_TO_GATK_FILE_TYPE.get( galaxy_ext, galaxy_ext ) )
+
+def open_file_from_option( filename, mode = 'rb' ):
+    if filename:
+        return open( filename, mode = mode )
+    return None
+
+def html_report_from_directory( html_out, dir ):
+    html_out.write( '<html>\n<head>\n<title>Galaxy - GATK Output</title>\n</head>\n<body>\n<p/>\n<ul>\n' )
+    for fname in sorted( os.listdir( dir ) ):
+        html_out.write(  '<li><a href="%s">%s</a></li>\n' % ( fname, fname ) )
+    html_out.write( '</ul>\n</body>\n</html>\n' )
+
+def index_bam_files( bam_filenames, tmp_dir ):
+    for bam_filename in bam_filenames:
+        bam_index_filename = "%s.bai" % bam_filename
+        if not os.path.exists( bam_index_filename ):
+            #need to index this bam file
+            stderr_name = tempfile.NamedTemporaryFile( prefix = "bam_index_stderr" ).name
+            command = 'samtools index %s %s' % ( bam_filename, bam_index_filename )
+            proc = subprocess.Popen( args=command, shell=True, stderr=open( stderr_name, 'wb' ) )
+            return_code = proc.wait()
+            if return_code:
+                for line in open( stderr_name ):
+                    print >> sys.stderr, line
+                os.unlink( stderr_name ) #clean up
+                cleanup_before_exit( tmp_dir )
+                raise Exception( "Error indexing BAM file" )
+            os.unlink( stderr_name ) #clean up
+
+def __main__():
+    #Parse Command Line
+    parser = optparse.OptionParser()
+    parser.add_option( '-p', '--pass_through', dest='pass_through_options', action='append', type="string", help='These options are passed through directly to GATK, without any modification.' )
+    parser.add_option( '-o', '--pass_through_options', dest='pass_through_options_encoded', action='append', type="string", help='These options are passed through directly to GATK, with decoding from binascii.unhexlify.' )
+    parser.add_option( '-d', '--dataset', dest='datasets', action='append', type="string", nargs=4, help='"-argument" "original_filename" "galaxy_filetype" "name_prefix"' )
+    parser.add_option( '', '--max_jvm_heap', dest='max_jvm_heap', action='store', type="string", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value.' )
+    parser.add_option( '', '--max_jvm_heap_fraction', dest='max_jvm_heap_fraction', action='store', type="int", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value as a fraction of total physical memory.' )
+    parser.add_option( '', '--stdout', dest='stdout', action='store', type="string", default=None, help='If specified, the output of stdout will be written to this file.' )
+    parser.add_option( '', '--stderr', dest='stderr', action='store', type="string", default=None, help='If specified, the output of stderr will be written to this file.' )
+    parser.add_option( '', '--html_report_from_directory', dest='html_report_from_directory', action='append', type="string", nargs=2, help='"Target HTML File" "Directory"')
+    (options, args) = parser.parse_args()
+    
+    tmp_dir = tempfile.mkdtemp( prefix='tmp-gatk-' )
+    if options.pass_through_options:
+        cmd = ' '.join( options.pass_through_options )
+    else:
+        cmd = ''
+    if options.pass_through_options_encoded:
+        cmd = '%s %s' % ( cmd, ' '.join( map( unhexlify, options.pass_through_options_encoded ) ) )
+    if options.max_jvm_heap is not None:
+        cmd = cmd.replace( 'java ', 'java -Xmx%s ' % ( options.max_jvm_heap ), 1 )
+    elif options.max_jvm_heap_fraction is not None:
+        cmd = cmd.replace( 'java ', 'java -XX:DefaultMaxRAMFraction=%s  -XX:+UseParallelGC ' % ( options.max_jvm_heap_fraction ), 1 )
+    bam_filenames = []
+    if options.datasets:
+        for ( dataset_arg, filename, galaxy_ext, prefix ) in options.datasets:
+            gatk_filename = gatk_filename_from_galaxy( filename, galaxy_ext, target_dir = tmp_dir, prefix = prefix )
+            if dataset_arg:
+                cmd = '%s %s "%s"' % ( cmd, gatk_filetype_argument_substitution( dataset_arg, galaxy_ext ), gatk_filename )
+            if galaxy_ext == "bam":
+                bam_filenames.append( gatk_filename )
+    index_bam_files( bam_filenames, tmp_dir )
+    #set up stdout and stderr output options
+    stdout = open_file_from_option( options.stdout, mode = 'wb' )
+    stderr = open_file_from_option( options.stderr, mode = 'wb' )
+    #if no stderr file is specified, we'll use our own
+    if stderr is None:
+        stderr = tempfile.NamedTemporaryFile( prefix="gatk-stderr-", dir=tmp_dir )
+    
+    proc = subprocess.Popen( args=cmd, stdout=stdout, stderr=stderr, shell=True, cwd=tmp_dir )
+    return_code = proc.wait()
+    
+    if return_code:
+        stderr_target = sys.stderr
+    else:
+        stderr_target = sys.stdout
+    stderr.flush()
+    stderr.seek(0)
+    while True:
+        chunk = stderr.read( CHUNK_SIZE )
+        if chunk:
+            stderr_target.write( chunk )
+        else:
+            break
+    stderr.close()
+    #generate html reports
+    if options.html_report_from_directory:
+        for ( html_filename, html_dir ) in options.html_report_from_directory:
+            html_report_from_directory( open( html_filename, 'wb' ), html_dir )
+    
+    cleanup_before_exit( tmp_dir )
+
+if __name__=="__main__": __main__()
Binary file test-data/1.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/a.tab	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,15 @@
+CHR	SNP	BP	A1	TEST	NMISS	BETA	STAT	P
+1	rs1181876	3671541	T	DOMDEV	958	-1.415	-3.326	0.0009161
+1	rs10492923	5092886	C	ADD	1007	5.105	4.368	1.382e-05
+1	rs10492923	5092886	C	DOMDEV	1007	-5.612	-4.249	2.35e-05
+1	rs10492923	5092886	C	GENO_2DF	1007	NA	19.9	4.775e-05
+1	rs1801133	11778965	T	ADD	1022	1.23	3.97	7.682e-05
+1	rs1801133	11778965	T	GENO_2DF	1022	NA	16.07	0.0003233
+1	rs1361912	12663121	A	ADD	1021	12.69	4.093	4.596e-05
+1	rs1361912	12663121	A	DOMDEV	1021	-12.37	-3.945	8.533e-05
+1	rs1361912	12663121	A	GENO_2DF	1021	NA	17.05	0.0001982
+1	rs1009806	19373138	G	ADD	1021	-1.334	-3.756	0.0001826
+1	rs1009806	19373138	G	GENO_2DF	1021	NA	19.36	6.244e-05
+1	rs873654	29550948	A	DOMDEV	1012	1.526	3.6	0.0003339
+1	rs10489527	36800027	C	ADD	1016	12.67	4.114	4.211e-05
+1	rs10489527	36800027	C	DOMDEV	1016	-13.05	-4.02	6.249e-05
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1.log.contains	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,6 @@
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING] 
+TraversalEngine -        Location processed.sites  runtime per.1M.sites completed total.runtime remaining 
+DepthOfCoverageWalker - Printing summary info 
+DepthOfCoverageWalker - Printing locus summary 
+TraversalEngine - Total runtime
+TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%)
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_cumulative_coverage_counts_sample.tabular	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,2 @@
+	gte_0	gte_1	gte_2	gte_3	gte_4	gte_5	gte_6	gte_7	gte_8	gte_9	gte_10	gte_11	gte_12	gte_13	gte_14	gte_15	gte_16	gte_17	gte_18	gte_19	gte_20	gte_21	gte_22	gte_23	gte_24	gte_25	gte_26	gte_27	gte_28	gte_29	gte_30	gte_31	gte_32	gte_33	gte_34	gte_35	gte_36	gte_37	gte_38	gte_39	gte_40	gte_41	gte_42	gte_43	gte_44	gte_45	gte_46	gte_47	gte_48	gte_49	gte_50	gte_51	gte_52	gte_53	gte_54	gte_55	gte_56	gte_57	gte_58	gte_59	gte_60	gte_61	gte_62	gte_63	gte_64	gte_65	gte_66	gte_67	gte_68	gte_69	gte_70	gte_71	gte_72	gte_73	gte_74	gte_75	gte_76	gte_77	gte_78	gte_79	gte_80	gte_81	gte_82	gte_83	gte_84	gte_85	gte_86	gte_87	gte_88	gte_89	gte_90	gte_91	gte_92	gte_93	gte_94	gte_95	gte_96	gte_97	gte_98	gte_99	gte_100	gte_101	gte_102	gte_103	gte_104	gte_105	gte_106	gte_107	gte_108	gte_109	gte_110	gte_111	gte_112	gte_113	gte_114	gte_115	gte_116	gte_117	gte_118	gte_119	gte_120	gte_121	gte_122	gte_123	gte_124	gte_125	gte_126	gte_127	gte_128	gte_129	gte_130	gte_131	gte_132	gte_133	gte_134	gte_135	gte_136	gte_137	gte_138	gte_139	gte_140	gte_141	gte_142	gte_143	gte_144	gte_145	gte_146	gte_147	gte_148	gte_149	gte_150	gte_151	gte_152	gte_153	gte_154	gte_155	gte_156	gte_157	gte_158	gte_159	gte_160	gte_161	gte_162	gte_163	gte_164	gte_165	gte_166	gte_167	gte_168	gte_169	gte_170	gte_171	gte_172	gte_173	gte_174	gte_175	gte_176	gte_177	gte_178	gte_179	gte_180	gte_181	gte_182	gte_183	gte_184	gte_185	gte_186	gte_187	gte_188	gte_189	gte_190	gte_191	gte_192	gte_193	gte_194	gte_195	gte_196	gte_197	gte_198	gte_199	gte_200	gte_201	gte_202	gte_203	gte_204	gte_205	gte_206	gte_207	gte_208	gte_209	gte_210	gte_211	gte_212	gte_213	gte_214	gte_215	gte_216	gte_217	gte_218	gte_219	gte_220	gte_221	gte_222	gte_223	gte_224	gte_225	gte_226	gte_227	gte_228	gte_229	gte_230	gte_231	gte_232	gte_233	gte_234	gte_235	gte_236	gte_237	gte_238	gte_239	gte_240	gte_241	gte_242	gte_243	gte_244	gte_245	gte_246	gte_247	gte_248	gte_249	gte_250	gte_251	gte_252	gte_253	gte_254	gte_255	gte_256	gte_257	gte_258	gte_259	gte_260	gte_261	gte_262	gte_263	gte_264	gte_265	gte_266	gte_267	gte_268	gte_269	gte_270	gte_271	gte_272	gte_273	gte_274	gte_275	gte_276	gte_277	gte_278	gte_279	gte_280	gte_281	gte_282	gte_283	gte_284	gte_285	gte_286	gte_287	gte_288	gte_289	gte_290	gte_291	gte_292	gte_293	gte_294	gte_295	gte_296	gte_297	gte_298	gte_299	gte_300	gte_301	gte_302	gte_303	gte_304	gte_305	gte_306	gte_307	gte_308	gte_309	gte_310	gte_311	gte_312	gte_313	gte_314	gte_315	gte_316	gte_317	gte_318	gte_319	gte_320	gte_321	gte_322	gte_323	gte_324	gte_325	gte_326	gte_327	gte_328	gte_329	gte_330	gte_331	gte_332	gte_333	gte_334	gte_335	gte_336	gte_337	gte_338	gte_339	gte_340	gte_341	gte_342	gte_343	gte_344	gte_345	gte_346	gte_347	gte_348	gte_349	gte_350	gte_351	gte_352	gte_353	gte_354	gte_355	gte_356	gte_357	gte_358	gte_359	gte_360	gte_361	gte_362	gte_363	gte_364	gte_365	gte_366	gte_367	gte_368	gte_369	gte_370	gte_371	gte_372	gte_373	gte_374	gte_375	gte_376	gte_377	gte_378	gte_379	gte_380	gte_381	gte_382	gte_383	gte_384	gte_385	gte_386	gte_387	gte_388	gte_389	gte_390	gte_391	gte_392	gte_393	gte_394	gte_395	gte_396	gte_397	gte_398	gte_399	gte_400	gte_401	gte_402	gte_403	gte_404	gte_405	gte_406	gte_407	gte_408	gte_409	gte_410	gte_411	gte_412	gte_413	gte_414	gte_415	gte_416	gte_417	gte_418	gte_419	gte_420	gte_421	gte_422	gte_423	gte_424	gte_425	gte_426	gte_427	gte_428	gte_429	gte_430	gte_431	gte_432	gte_433	gte_434	gte_435	gte_436	gte_437	gte_438	gte_439	gte_440	gte_441	gte_442	gte_443	gte_444	gte_445	gte_446	gte_447	gte_448	gte_449	gte_450	gte_451	gte_452	gte_453	gte_454	gte_455	gte_456	gte_457	gte_458	gte_459	gte_460	gte_461	gte_462	gte_463	gte_464	gte_465	gte_466	gte_467	gte_468	gte_469	gte_470	gte_471	gte_472	gte_473	gte_474	gte_475	gte_476	gte_477	gte_478	gte_479	gte_480	gte_481	gte_482	gte_483	gte_484	gte_485	gte_486	gte_487	gte_488	gte_489	gte_490	gte_491	gte_492	gte_493	gte_494	gte_495	gte_496	gte_497	gte_498	gte_499	gte_500
+NSamples_1	5386	43	41	40	38	37	36	34	32	30	29	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_output_cumulative_coverage_proportions_sample.tabular	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,2 @@
+	gte_0	gte_1	gte_2	gte_3	gte_4	gte_5	gte_6	gte_7	gte_8	gte_9	gte_10	gte_11	gte_12	gte_13	gte_14	gte_15	gte_16	gte_17	gte_18	gte_19	gte_20	gte_21	gte_22	gte_23	gte_24	gte_25	gte_26	gte_27	gte_28	gte_29	gte_30	gte_31	gte_32	gte_33	gte_34	gte_35	gte_36	gte_37	gte_38	gte_39	gte_40	gte_41	gte_42	gte_43	gte_44	gte_45	gte_46	gte_47	gte_48	gte_49	gte_50	gte_51	gte_52	gte_53	gte_54	gte_55	gte_56	gte_57	gte_58	gte_59	gte_60	gte_61	gte_62	gte_63	gte_64	gte_65	gte_66	gte_67	gte_68	gte_69	gte_70	gte_71	gte_72	gte_73	gte_74	gte_75	gte_76	gte_77	gte_78	gte_79	gte_80	gte_81	gte_82	gte_83	gte_84	gte_85	gte_86	gte_87	gte_88	gte_89	gte_90	gte_91	gte_92	gte_93	gte_94	gte_95	gte_96	gte_97	gte_98	gte_99	gte_100	gte_101	gte_102	gte_103	gte_104	gte_105	gte_106	gte_107	gte_108	gte_109	gte_110	gte_111	gte_112	gte_113	gte_114	gte_115	gte_116	gte_117	gte_118	gte_119	gte_120	gte_121	gte_122	gte_123	gte_124	gte_125	gte_126	gte_127	gte_128	gte_129	gte_130	gte_131	gte_132	gte_133	gte_134	gte_135	gte_136	gte_137	gte_138	gte_139	gte_140	gte_141	gte_142	gte_143	gte_144	gte_145	gte_146	gte_147	gte_148	gte_149	gte_150	gte_151	gte_152	gte_153	gte_154	gte_155	gte_156	gte_157	gte_158	gte_159	gte_160	gte_161	gte_162	gte_163	gte_164	gte_165	gte_166	gte_167	gte_168	gte_169	gte_170	gte_171	gte_172	gte_173	gte_174	gte_175	gte_176	gte_177	gte_178	gte_179	gte_180	gte_181	gte_182	gte_183	gte_184	gte_185	gte_186	gte_187	gte_188	gte_189	gte_190	gte_191	gte_192	gte_193	gte_194	gte_195	gte_196	gte_197	gte_198	gte_199	gte_200	gte_201	gte_202	gte_203	gte_204	gte_205	gte_206	gte_207	gte_208	gte_209	gte_210	gte_211	gte_212	gte_213	gte_214	gte_215	gte_216	gte_217	gte_218	gte_219	gte_220	gte_221	gte_222	gte_223	gte_224	gte_225	gte_226	gte_227	gte_228	gte_229	gte_230	gte_231	gte_232	gte_233	gte_234	gte_235	gte_236	gte_237	gte_238	gte_239	gte_240	gte_241	gte_242	gte_243	gte_244	gte_245	gte_246	gte_247	gte_248	gte_249	gte_250	gte_251	gte_252	gte_253	gte_254	gte_255	gte_256	gte_257	gte_258	gte_259	gte_260	gte_261	gte_262	gte_263	gte_264	gte_265	gte_266	gte_267	gte_268	gte_269	gte_270	gte_271	gte_272	gte_273	gte_274	gte_275	gte_276	gte_277	gte_278	gte_279	gte_280	gte_281	gte_282	gte_283	gte_284	gte_285	gte_286	gte_287	gte_288	gte_289	gte_290	gte_291	gte_292	gte_293	gte_294	gte_295	gte_296	gte_297	gte_298	gte_299	gte_300	gte_301	gte_302	gte_303	gte_304	gte_305	gte_306	gte_307	gte_308	gte_309	gte_310	gte_311	gte_312	gte_313	gte_314	gte_315	gte_316	gte_317	gte_318	gte_319	gte_320	gte_321	gte_322	gte_323	gte_324	gte_325	gte_326	gte_327	gte_328	gte_329	gte_330	gte_331	gte_332	gte_333	gte_334	gte_335	gte_336	gte_337	gte_338	gte_339	gte_340	gte_341	gte_342	gte_343	gte_344	gte_345	gte_346	gte_347	gte_348	gte_349	gte_350	gte_351	gte_352	gte_353	gte_354	gte_355	gte_356	gte_357	gte_358	gte_359	gte_360	gte_361	gte_362	gte_363	gte_364	gte_365	gte_366	gte_367	gte_368	gte_369	gte_370	gte_371	gte_372	gte_373	gte_374	gte_375	gte_376	gte_377	gte_378	gte_379	gte_380	gte_381	gte_382	gte_383	gte_384	gte_385	gte_386	gte_387	gte_388	gte_389	gte_390	gte_391	gte_392	gte_393	gte_394	gte_395	gte_396	gte_397	gte_398	gte_399	gte_400	gte_401	gte_402	gte_403	gte_404	gte_405	gte_406	gte_407	gte_408	gte_409	gte_410	gte_411	gte_412	gte_413	gte_414	gte_415	gte_416	gte_417	gte_418	gte_419	gte_420	gte_421	gte_422	gte_423	gte_424	gte_425	gte_426	gte_427	gte_428	gte_429	gte_430	gte_431	gte_432	gte_433	gte_434	gte_435	gte_436	gte_437	gte_438	gte_439	gte_440	gte_441	gte_442	gte_443	gte_444	gte_445	gte_446	gte_447	gte_448	gte_449	gte_450	gte_451	gte_452	gte_453	gte_454	gte_455	gte_456	gte_457	gte_458	gte_459	gte_460	gte_461	gte_462	gte_463	gte_464	gte_465	gte_466	gte_467	gte_468	gte_469	gte_470	gte_471	gte_472	gte_473	gte_474	gte_475	gte_476	gte_477	gte_478	gte_479	gte_480	gte_481	gte_482	gte_483	gte_484	gte_485	gte_486	gte_487	gte_488	gte_489	gte_490	gte_491	gte_492	gte_493	gte_494	gte_495	gte_496	gte_497	gte_498	gte_499	gte_500
+A Fake phiX Sample	1.00	0.01	0.01	0.01	0.01	0.01	0.01	0.01	0.01	0.01	0.01	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00	0.00
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_per_locus_coverage.tabular	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,5387 @@
+Locus	Total_Depth	Average_Depth_sample	Depth_for_A Fake phiX Sample
+phiX174:1	0	0.00	0
+phiX174:2	0	0.00	0
+phiX174:3	0	0.00	0
+phiX174:4	0	0.00	0
+phiX174:5	0	0.00	0
+phiX174:6	0	0.00	0
+phiX174:7	0	0.00	0
+phiX174:8	0	0.00	0
+phiX174:9	0	0.00	0
+phiX174:10	0	0.00	0
+phiX174:11	0	0.00	0
+phiX174:12	0	0.00	0
+phiX174:13	0	0.00	0
+phiX174:14	0	0.00	0
+phiX174:15	0	0.00	0
+phiX174:16	0	0.00	0
+phiX174:17	0	0.00	0
+phiX174:18	0	0.00	0
+phiX174:19	0	0.00	0
+phiX174:20	0	0.00	0
+phiX174:21	0	0.00	0
+phiX174:22	0	0.00	0
+phiX174:23	0	0.00	0
+phiX174:24	0	0.00	0
+phiX174:25	0	0.00	0
+phiX174:26	0	0.00	0
+phiX174:27	0	0.00	0
+phiX174:28	0	0.00	0
+phiX174:29	0	0.00	0
+phiX174:30	0	0.00	0
+phiX174:31	0	0.00	0
+phiX174:32	0	0.00	0
+phiX174:33	0	0.00	0
+phiX174:34	0	0.00	0
+phiX174:35	0	0.00	0
+phiX174:36	0	0.00	0
+phiX174:37	0	0.00	0
+phiX174:38	0	0.00	0
+phiX174:39	0	0.00	0
+phiX174:40	0	0.00	0
+phiX174:41	0	0.00	0
+phiX174:42	0	0.00	0
+phiX174:43	0	0.00	0
+phiX174:44	0	0.00	0
+phiX174:45	0	0.00	0
+phiX174:46	0	0.00	0
+phiX174:47	0	0.00	0
+phiX174:48	0	0.00	0
+phiX174:49	0	0.00	0
+phiX174:50	0	0.00	0
+phiX174:51	0	0.00	0
+phiX174:52	0	0.00	0
+phiX174:53	0	0.00	0
+phiX174:54	0	0.00	0
+phiX174:55	0	0.00	0
+phiX174:56	0	0.00	0
+phiX174:57	0	0.00	0
+phiX174:58	0	0.00	0
+phiX174:59	0	0.00	0
+phiX174:60	0	0.00	0
+phiX174:61	0	0.00	0
+phiX174:62	0	0.00	0
+phiX174:63	0	0.00	0
+phiX174:64	0	0.00	0
+phiX174:65	0	0.00	0
+phiX174:66	0	0.00	0
+phiX174:67	0	0.00	0
+phiX174:68	0	0.00	0
+phiX174:69	0	0.00	0
+phiX174:70	0	0.00	0
+phiX174:71	0	0.00	0
+phiX174:72	0	0.00	0
+phiX174:73	0	0.00	0
+phiX174:74	0	0.00	0
+phiX174:75	0	0.00	0
+phiX174:76	0	0.00	0
+phiX174:77	0	0.00	0
+phiX174:78	0	0.00	0
+phiX174:79	0	0.00	0
+phiX174:80	0	0.00	0
+phiX174:81	0	0.00	0
+phiX174:82	0	0.00	0
+phiX174:83	0	0.00	0
+phiX174:84	0	0.00	0
+phiX174:85	0	0.00	0
+phiX174:86	0	0.00	0
+phiX174:87	0	0.00	0
+phiX174:88	0	0.00	0
+phiX174:89	0	0.00	0
+phiX174:90	0	0.00	0
+phiX174:91	0	0.00	0
+phiX174:92	0	0.00	0
+phiX174:93	0	0.00	0
+phiX174:94	0	0.00	0
+phiX174:95	0	0.00	0
+phiX174:96	0	0.00	0
+phiX174:97	0	0.00	0
+phiX174:98	0	0.00	0
+phiX174:99	0	0.00	0
+phiX174:100	0	0.00	0
+phiX174:101	0	0.00	0
+phiX174:102	0	0.00	0
+phiX174:103	0	0.00	0
+phiX174:104	0	0.00	0
+phiX174:105	0	0.00	0
+phiX174:106	0	0.00	0
+phiX174:107	0	0.00	0
+phiX174:108	0	0.00	0
+phiX174:109	0	0.00	0
+phiX174:110	0	0.00	0
+phiX174:111	0	0.00	0
+phiX174:112	0	0.00	0
+phiX174:113	0	0.00	0
+phiX174:114	0	0.00	0
+phiX174:115	0	0.00	0
+phiX174:116	0	0.00	0
+phiX174:117	0	0.00	0
+phiX174:118	0	0.00	0
+phiX174:119	0	0.00	0
+phiX174:120	0	0.00	0
+phiX174:121	0	0.00	0
+phiX174:122	0	0.00	0
+phiX174:123	0	0.00	0
+phiX174:124	0	0.00	0
+phiX174:125	0	0.00	0
+phiX174:126	0	0.00	0
+phiX174:127	0	0.00	0
+phiX174:128	0	0.00	0
+phiX174:129	0	0.00	0
+phiX174:130	0	0.00	0
+phiX174:131	0	0.00	0
+phiX174:132	0	0.00	0
+phiX174:133	0	0.00	0
+phiX174:134	0	0.00	0
+phiX174:135	0	0.00	0
+phiX174:136	0	0.00	0
+phiX174:137	0	0.00	0
+phiX174:138	0	0.00	0
+phiX174:139	0	0.00	0
+phiX174:140	0	0.00	0
+phiX174:141	0	0.00	0
+phiX174:142	0	0.00	0
+phiX174:143	0	0.00	0
+phiX174:144	0	0.00	0
+phiX174:145	0	0.00	0
+phiX174:146	0	0.00	0
+phiX174:147	0	0.00	0
+phiX174:148	0	0.00	0
+phiX174:149	0	0.00	0
+phiX174:150	0	0.00	0
+phiX174:151	0	0.00	0
+phiX174:152	0	0.00	0
+phiX174:153	0	0.00	0
+phiX174:154	0	0.00	0
+phiX174:155	0	0.00	0
+phiX174:156	0	0.00	0
+phiX174:157	0	0.00	0
+phiX174:158	0	0.00	0
+phiX174:159	0	0.00	0
+phiX174:160	0	0.00	0
+phiX174:161	0	0.00	0
+phiX174:162	0	0.00	0
+phiX174:163	0	0.00	0
+phiX174:164	0	0.00	0
+phiX174:165	0	0.00	0
+phiX174:166	0	0.00	0
+phiX174:167	0	0.00	0
+phiX174:168	0	0.00	0
+phiX174:169	0	0.00	0
+phiX174:170	0	0.00	0
+phiX174:171	0	0.00	0
+phiX174:172	0	0.00	0
+phiX174:173	0	0.00	0
+phiX174:174	0	0.00	0
+phiX174:175	0	0.00	0
+phiX174:176	0	0.00	0
+phiX174:177	0	0.00	0
+phiX174:178	0	0.00	0
+phiX174:179	0	0.00	0
+phiX174:180	0	0.00	0
+phiX174:181	0	0.00	0
+phiX174:182	0	0.00	0
+phiX174:183	0	0.00	0
+phiX174:184	0	0.00	0
+phiX174:185	0	0.00	0
+phiX174:186	0	0.00	0
+phiX174:187	0	0.00	0
+phiX174:188	0	0.00	0
+phiX174:189	0	0.00	0
+phiX174:190	0	0.00	0
+phiX174:191	0	0.00	0
+phiX174:192	0	0.00	0
+phiX174:193	0	0.00	0
+phiX174:194	0	0.00	0
+phiX174:195	0	0.00	0
+phiX174:196	0	0.00	0
+phiX174:197	0	0.00	0
+phiX174:198	0	0.00	0
+phiX174:199	0	0.00	0
+phiX174:200	0	0.00	0
+phiX174:201	0	0.00	0
+phiX174:202	0	0.00	0
+phiX174:203	0	0.00	0
+phiX174:204	0	0.00	0
+phiX174:205	0	0.00	0
+phiX174:206	0	0.00	0
+phiX174:207	0	0.00	0
+phiX174:208	0	0.00	0
+phiX174:209	0	0.00	0
+phiX174:210	0	0.00	0
+phiX174:211	0	0.00	0
+phiX174:212	0	0.00	0
+phiX174:213	0	0.00	0
+phiX174:214	0	0.00	0
+phiX174:215	0	0.00	0
+phiX174:216	0	0.00	0
+phiX174:217	0	0.00	0
+phiX174:218	0	0.00	0
+phiX174:219	0	0.00	0
+phiX174:220	0	0.00	0
+phiX174:221	0	0.00	0
+phiX174:222	0	0.00	0
+phiX174:223	0	0.00	0
+phiX174:224	0	0.00	0
+phiX174:225	0	0.00	0
+phiX174:226	0	0.00	0
+phiX174:227	0	0.00	0
+phiX174:228	0	0.00	0
+phiX174:229	0	0.00	0
+phiX174:230	0	0.00	0
+phiX174:231	0	0.00	0
+phiX174:232	0	0.00	0
+phiX174:233	0	0.00	0
+phiX174:234	0	0.00	0
+phiX174:235	0	0.00	0
+phiX174:236	0	0.00	0
+phiX174:237	0	0.00	0
+phiX174:238	0	0.00	0
+phiX174:239	0	0.00	0
+phiX174:240	0	0.00	0
+phiX174:241	0	0.00	0
+phiX174:242	0	0.00	0
+phiX174:243	0	0.00	0
+phiX174:244	0	0.00	0
+phiX174:245	0	0.00	0
+phiX174:246	0	0.00	0
+phiX174:247	0	0.00	0
+phiX174:248	0	0.00	0
+phiX174:249	0	0.00	0
+phiX174:250	0	0.00	0
+phiX174:251	0	0.00	0
+phiX174:252	0	0.00	0
+phiX174:253	0	0.00	0
+phiX174:254	0	0.00	0
+phiX174:255	0	0.00	0
+phiX174:256	0	0.00	0
+phiX174:257	0	0.00	0
+phiX174:258	0	0.00	0
+phiX174:259	0	0.00	0
+phiX174:260	0	0.00	0
+phiX174:261	0	0.00	0
+phiX174:262	0	0.00	0
+phiX174:263	0	0.00	0
+phiX174:264	0	0.00	0
+phiX174:265	0	0.00	0
+phiX174:266	0	0.00	0
+phiX174:267	0	0.00	0
+phiX174:268	0	0.00	0
+phiX174:269	0	0.00	0
+phiX174:270	0	0.00	0
+phiX174:271	0	0.00	0
+phiX174:272	0	0.00	0
+phiX174:273	0	0.00	0
+phiX174:274	0	0.00	0
+phiX174:275	0	0.00	0
+phiX174:276	0	0.00	0
+phiX174:277	0	0.00	0
+phiX174:278	0	0.00	0
+phiX174:279	0	0.00	0
+phiX174:280	0	0.00	0
+phiX174:281	0	0.00	0
+phiX174:282	0	0.00	0
+phiX174:283	0	0.00	0
+phiX174:284	0	0.00	0
+phiX174:285	0	0.00	0
+phiX174:286	0	0.00	0
+phiX174:287	0	0.00	0
+phiX174:288	0	0.00	0
+phiX174:289	0	0.00	0
+phiX174:290	0	0.00	0
+phiX174:291	0	0.00	0
+phiX174:292	0	0.00	0
+phiX174:293	0	0.00	0
+phiX174:294	0	0.00	0
+phiX174:295	0	0.00	0
+phiX174:296	0	0.00	0
+phiX174:297	0	0.00	0
+phiX174:298	0	0.00	0
+phiX174:299	0	0.00	0
+phiX174:300	0	0.00	0
+phiX174:301	0	0.00	0
+phiX174:302	0	0.00	0
+phiX174:303	0	0.00	0
+phiX174:304	0	0.00	0
+phiX174:305	0	0.00	0
+phiX174:306	0	0.00	0
+phiX174:307	0	0.00	0
+phiX174:308	0	0.00	0
+phiX174:309	0	0.00	0
+phiX174:310	0	0.00	0
+phiX174:311	0	0.00	0
+phiX174:312	0	0.00	0
+phiX174:313	0	0.00	0
+phiX174:314	0	0.00	0
+phiX174:315	0	0.00	0
+phiX174:316	0	0.00	0
+phiX174:317	0	0.00	0
+phiX174:318	0	0.00	0
+phiX174:319	0	0.00	0
+phiX174:320	0	0.00	0
+phiX174:321	0	0.00	0
+phiX174:322	0	0.00	0
+phiX174:323	0	0.00	0
+phiX174:324	0	0.00	0
+phiX174:325	0	0.00	0
+phiX174:326	0	0.00	0
+phiX174:327	0	0.00	0
+phiX174:328	0	0.00	0
+phiX174:329	0	0.00	0
+phiX174:330	0	0.00	0
+phiX174:331	0	0.00	0
+phiX174:332	0	0.00	0
+phiX174:333	0	0.00	0
+phiX174:334	0	0.00	0
+phiX174:335	0	0.00	0
+phiX174:336	0	0.00	0
+phiX174:337	0	0.00	0
+phiX174:338	0	0.00	0
+phiX174:339	0	0.00	0
+phiX174:340	0	0.00	0
+phiX174:341	0	0.00	0
+phiX174:342	0	0.00	0
+phiX174:343	0	0.00	0
+phiX174:344	0	0.00	0
+phiX174:345	0	0.00	0
+phiX174:346	0	0.00	0
+phiX174:347	0	0.00	0
+phiX174:348	0	0.00	0
+phiX174:349	0	0.00	0
+phiX174:350	0	0.00	0
+phiX174:351	0	0.00	0
+phiX174:352	0	0.00	0
+phiX174:353	0	0.00	0
+phiX174:354	0	0.00	0
+phiX174:355	0	0.00	0
+phiX174:356	0	0.00	0
+phiX174:357	0	0.00	0
+phiX174:358	0	0.00	0
+phiX174:359	0	0.00	0
+phiX174:360	0	0.00	0
+phiX174:361	0	0.00	0
+phiX174:362	0	0.00	0
+phiX174:363	0	0.00	0
+phiX174:364	0	0.00	0
+phiX174:365	0	0.00	0
+phiX174:366	0	0.00	0
+phiX174:367	0	0.00	0
+phiX174:368	0	0.00	0
+phiX174:369	0	0.00	0
+phiX174:370	0	0.00	0
+phiX174:371	0	0.00	0
+phiX174:372	0	0.00	0
+phiX174:373	0	0.00	0
+phiX174:374	0	0.00	0
+phiX174:375	0	0.00	0
+phiX174:376	0	0.00	0
+phiX174:377	0	0.00	0
+phiX174:378	0	0.00	0
+phiX174:379	0	0.00	0
+phiX174:380	0	0.00	0
+phiX174:381	0	0.00	0
+phiX174:382	0	0.00	0
+phiX174:383	0	0.00	0
+phiX174:384	0	0.00	0
+phiX174:385	0	0.00	0
+phiX174:386	0	0.00	0
+phiX174:387	0	0.00	0
+phiX174:388	0	0.00	0
+phiX174:389	0	0.00	0
+phiX174:390	0	0.00	0
+phiX174:391	0	0.00	0
+phiX174:392	0	0.00	0
+phiX174:393	0	0.00	0
+phiX174:394	0	0.00	0
+phiX174:395	0	0.00	0
+phiX174:396	0	0.00	0
+phiX174:397	0	0.00	0
+phiX174:398	0	0.00	0
+phiX174:399	0	0.00	0
+phiX174:400	0	0.00	0
+phiX174:401	0	0.00	0
+phiX174:402	0	0.00	0
+phiX174:403	0	0.00	0
+phiX174:404	0	0.00	0
+phiX174:405	0	0.00	0
+phiX174:406	0	0.00	0
+phiX174:407	0	0.00	0
+phiX174:408	0	0.00	0
+phiX174:409	0	0.00	0
+phiX174:410	0	0.00	0
+phiX174:411	0	0.00	0
+phiX174:412	0	0.00	0
+phiX174:413	0	0.00	0
+phiX174:414	0	0.00	0
+phiX174:415	0	0.00	0
+phiX174:416	0	0.00	0
+phiX174:417	0	0.00	0
+phiX174:418	0	0.00	0
+phiX174:419	0	0.00	0
+phiX174:420	0	0.00	0
+phiX174:421	0	0.00	0
+phiX174:422	0	0.00	0
+phiX174:423	0	0.00	0
+phiX174:424	0	0.00	0
+phiX174:425	0	0.00	0
+phiX174:426	0	0.00	0
+phiX174:427	0	0.00	0
+phiX174:428	0	0.00	0
+phiX174:429	0	0.00	0
+phiX174:430	0	0.00	0
+phiX174:431	0	0.00	0
+phiX174:432	0	0.00	0
+phiX174:433	0	0.00	0
+phiX174:434	0	0.00	0
+phiX174:435	0	0.00	0
+phiX174:436	0	0.00	0
+phiX174:437	0	0.00	0
+phiX174:438	0	0.00	0
+phiX174:439	0	0.00	0
+phiX174:440	0	0.00	0
+phiX174:441	0	0.00	0
+phiX174:442	0	0.00	0
+phiX174:443	0	0.00	0
+phiX174:444	0	0.00	0
+phiX174:445	0	0.00	0
+phiX174:446	0	0.00	0
+phiX174:447	0	0.00	0
+phiX174:448	0	0.00	0
+phiX174:449	0	0.00	0
+phiX174:450	0	0.00	0
+phiX174:451	0	0.00	0
+phiX174:452	0	0.00	0
+phiX174:453	0	0.00	0
+phiX174:454	0	0.00	0
+phiX174:455	0	0.00	0
+phiX174:456	0	0.00	0
+phiX174:457	0	0.00	0
+phiX174:458	0	0.00	0
+phiX174:459	0	0.00	0
+phiX174:460	0	0.00	0
+phiX174:461	0	0.00	0
+phiX174:462	0	0.00	0
+phiX174:463	0	0.00	0
+phiX174:464	0	0.00	0
+phiX174:465	0	0.00	0
+phiX174:466	0	0.00	0
+phiX174:467	0	0.00	0
+phiX174:468	0	0.00	0
+phiX174:469	0	0.00	0
+phiX174:470	0	0.00	0
+phiX174:471	0	0.00	0
+phiX174:472	0	0.00	0
+phiX174:473	0	0.00	0
+phiX174:474	0	0.00	0
+phiX174:475	0	0.00	0
+phiX174:476	0	0.00	0
+phiX174:477	0	0.00	0
+phiX174:478	0	0.00	0
+phiX174:479	0	0.00	0
+phiX174:480	0	0.00	0
+phiX174:481	0	0.00	0
+phiX174:482	0	0.00	0
+phiX174:483	0	0.00	0
+phiX174:484	0	0.00	0
+phiX174:485	0	0.00	0
+phiX174:486	0	0.00	0
+phiX174:487	0	0.00	0
+phiX174:488	0	0.00	0
+phiX174:489	0	0.00	0
+phiX174:490	0	0.00	0
+phiX174:491	0	0.00	0
+phiX174:492	0	0.00	0
+phiX174:493	0	0.00	0
+phiX174:494	0	0.00	0
+phiX174:495	0	0.00	0
+phiX174:496	0	0.00	0
+phiX174:497	0	0.00	0
+phiX174:498	0	0.00	0
+phiX174:499	0	0.00	0
+phiX174:500	0	0.00	0
+phiX174:501	0	0.00	0
+phiX174:502	0	0.00	0
+phiX174:503	0	0.00	0
+phiX174:504	0	0.00	0
+phiX174:505	0	0.00	0
+phiX174:506	0	0.00	0
+phiX174:507	0	0.00	0
+phiX174:508	0	0.00	0
+phiX174:509	0	0.00	0
+phiX174:510	0	0.00	0
+phiX174:511	0	0.00	0
+phiX174:512	0	0.00	0
+phiX174:513	0	0.00	0
+phiX174:514	0	0.00	0
+phiX174:515	0	0.00	0
+phiX174:516	0	0.00	0
+phiX174:517	0	0.00	0
+phiX174:518	0	0.00	0
+phiX174:519	0	0.00	0
+phiX174:520	0	0.00	0
+phiX174:521	0	0.00	0
+phiX174:522	0	0.00	0
+phiX174:523	0	0.00	0
+phiX174:524	0	0.00	0
+phiX174:525	0	0.00	0
+phiX174:526	0	0.00	0
+phiX174:527	0	0.00	0
+phiX174:528	0	0.00	0
+phiX174:529	0	0.00	0
+phiX174:530	0	0.00	0
+phiX174:531	0	0.00	0
+phiX174:532	0	0.00	0
+phiX174:533	0	0.00	0
+phiX174:534	0	0.00	0
+phiX174:535	0	0.00	0
+phiX174:536	0	0.00	0
+phiX174:537	0	0.00	0
+phiX174:538	0	0.00	0
+phiX174:539	0	0.00	0
+phiX174:540	0	0.00	0
+phiX174:541	0	0.00	0
+phiX174:542	0	0.00	0
+phiX174:543	0	0.00	0
+phiX174:544	0	0.00	0
+phiX174:545	0	0.00	0
+phiX174:546	0	0.00	0
+phiX174:547	0	0.00	0
+phiX174:548	0	0.00	0
+phiX174:549	0	0.00	0
+phiX174:550	0	0.00	0
+phiX174:551	0	0.00	0
+phiX174:552	0	0.00	0
+phiX174:553	0	0.00	0
+phiX174:554	0	0.00	0
+phiX174:555	0	0.00	0
+phiX174:556	0	0.00	0
+phiX174:557	0	0.00	0
+phiX174:558	0	0.00	0
+phiX174:559	0	0.00	0
+phiX174:560	0	0.00	0
+phiX174:561	0	0.00	0
+phiX174:562	0	0.00	0
+phiX174:563	0	0.00	0
+phiX174:564	0	0.00	0
+phiX174:565	0	0.00	0
+phiX174:566	0	0.00	0
+phiX174:567	0	0.00	0
+phiX174:568	0	0.00	0
+phiX174:569	0	0.00	0
+phiX174:570	0	0.00	0
+phiX174:571	0	0.00	0
+phiX174:572	0	0.00	0
+phiX174:573	0	0.00	0
+phiX174:574	0	0.00	0
+phiX174:575	0	0.00	0
+phiX174:576	0	0.00	0
+phiX174:577	0	0.00	0
+phiX174:578	0	0.00	0
+phiX174:579	0	0.00	0
+phiX174:580	0	0.00	0
+phiX174:581	0	0.00	0
+phiX174:582	0	0.00	0
+phiX174:583	0	0.00	0
+phiX174:584	0	0.00	0
+phiX174:585	0	0.00	0
+phiX174:586	0	0.00	0
+phiX174:587	0	0.00	0
+phiX174:588	0	0.00	0
+phiX174:589	0	0.00	0
+phiX174:590	0	0.00	0
+phiX174:591	0	0.00	0
+phiX174:592	0	0.00	0
+phiX174:593	0	0.00	0
+phiX174:594	0	0.00	0
+phiX174:595	0	0.00	0
+phiX174:596	0	0.00	0
+phiX174:597	0	0.00	0
+phiX174:598	0	0.00	0
+phiX174:599	0	0.00	0
+phiX174:600	0	0.00	0
+phiX174:601	0	0.00	0
+phiX174:602	0	0.00	0
+phiX174:603	0	0.00	0
+phiX174:604	0	0.00	0
+phiX174:605	0	0.00	0
+phiX174:606	0	0.00	0
+phiX174:607	0	0.00	0
+phiX174:608	0	0.00	0
+phiX174:609	0	0.00	0
+phiX174:610	0	0.00	0
+phiX174:611	0	0.00	0
+phiX174:612	0	0.00	0
+phiX174:613	0	0.00	0
+phiX174:614	0	0.00	0
+phiX174:615	0	0.00	0
+phiX174:616	0	0.00	0
+phiX174:617	0	0.00	0
+phiX174:618	0	0.00	0
+phiX174:619	0	0.00	0
+phiX174:620	0	0.00	0
+phiX174:621	0	0.00	0
+phiX174:622	0	0.00	0
+phiX174:623	0	0.00	0
+phiX174:624	0	0.00	0
+phiX174:625	0	0.00	0
+phiX174:626	0	0.00	0
+phiX174:627	0	0.00	0
+phiX174:628	0	0.00	0
+phiX174:629	0	0.00	0
+phiX174:630	0	0.00	0
+phiX174:631	0	0.00	0
+phiX174:632	0	0.00	0
+phiX174:633	0	0.00	0
+phiX174:634	0	0.00	0
+phiX174:635	0	0.00	0
+phiX174:636	0	0.00	0
+phiX174:637	0	0.00	0
+phiX174:638	0	0.00	0
+phiX174:639	0	0.00	0
+phiX174:640	0	0.00	0
+phiX174:641	0	0.00	0
+phiX174:642	0	0.00	0
+phiX174:643	0	0.00	0
+phiX174:644	0	0.00	0
+phiX174:645	0	0.00	0
+phiX174:646	0	0.00	0
+phiX174:647	0	0.00	0
+phiX174:648	0	0.00	0
+phiX174:649	0	0.00	0
+phiX174:650	0	0.00	0
+phiX174:651	0	0.00	0
+phiX174:652	0	0.00	0
+phiX174:653	0	0.00	0
+phiX174:654	0	0.00	0
+phiX174:655	0	0.00	0
+phiX174:656	0	0.00	0
+phiX174:657	0	0.00	0
+phiX174:658	0	0.00	0
+phiX174:659	0	0.00	0
+phiX174:660	0	0.00	0
+phiX174:661	0	0.00	0
+phiX174:662	0	0.00	0
+phiX174:663	0	0.00	0
+phiX174:664	0	0.00	0
+phiX174:665	0	0.00	0
+phiX174:666	0	0.00	0
+phiX174:667	0	0.00	0
+phiX174:668	0	0.00	0
+phiX174:669	0	0.00	0
+phiX174:670	0	0.00	0
+phiX174:671	0	0.00	0
+phiX174:672	0	0.00	0
+phiX174:673	0	0.00	0
+phiX174:674	0	0.00	0
+phiX174:675	0	0.00	0
+phiX174:676	0	0.00	0
+phiX174:677	0	0.00	0
+phiX174:678	0	0.00	0
+phiX174:679	0	0.00	0
+phiX174:680	0	0.00	0
+phiX174:681	0	0.00	0
+phiX174:682	0	0.00	0
+phiX174:683	0	0.00	0
+phiX174:684	0	0.00	0
+phiX174:685	0	0.00	0
+phiX174:686	0	0.00	0
+phiX174:687	0	0.00	0
+phiX174:688	0	0.00	0
+phiX174:689	0	0.00	0
+phiX174:690	0	0.00	0
+phiX174:691	0	0.00	0
+phiX174:692	0	0.00	0
+phiX174:693	0	0.00	0
+phiX174:694	0	0.00	0
+phiX174:695	0	0.00	0
+phiX174:696	0	0.00	0
+phiX174:697	0	0.00	0
+phiX174:698	0	0.00	0
+phiX174:699	0	0.00	0
+phiX174:700	0	0.00	0
+phiX174:701	0	0.00	0
+phiX174:702	0	0.00	0
+phiX174:703	0	0.00	0
+phiX174:704	0	0.00	0
+phiX174:705	0	0.00	0
+phiX174:706	0	0.00	0
+phiX174:707	0	0.00	0
+phiX174:708	0	0.00	0
+phiX174:709	0	0.00	0
+phiX174:710	0	0.00	0
+phiX174:711	0	0.00	0
+phiX174:712	0	0.00	0
+phiX174:713	0	0.00	0
+phiX174:714	0	0.00	0
+phiX174:715	0	0.00	0
+phiX174:716	0	0.00	0
+phiX174:717	0	0.00	0
+phiX174:718	0	0.00	0
+phiX174:719	0	0.00	0
+phiX174:720	0	0.00	0
+phiX174:721	0	0.00	0
+phiX174:722	0	0.00	0
+phiX174:723	0	0.00	0
+phiX174:724	0	0.00	0
+phiX174:725	0	0.00	0
+phiX174:726	0	0.00	0
+phiX174:727	0	0.00	0
+phiX174:728	0	0.00	0
+phiX174:729	0	0.00	0
+phiX174:730	0	0.00	0
+phiX174:731	0	0.00	0
+phiX174:732	0	0.00	0
+phiX174:733	0	0.00	0
+phiX174:734	0	0.00	0
+phiX174:735	0	0.00	0
+phiX174:736	0	0.00	0
+phiX174:737	0	0.00	0
+phiX174:738	0	0.00	0
+phiX174:739	0	0.00	0
+phiX174:740	0	0.00	0
+phiX174:741	0	0.00	0
+phiX174:742	0	0.00	0
+phiX174:743	0	0.00	0
+phiX174:744	0	0.00	0
+phiX174:745	0	0.00	0
+phiX174:746	0	0.00	0
+phiX174:747	0	0.00	0
+phiX174:748	0	0.00	0
+phiX174:749	0	0.00	0
+phiX174:750	0	0.00	0
+phiX174:751	0	0.00	0
+phiX174:752	0	0.00	0
+phiX174:753	0	0.00	0
+phiX174:754	0	0.00	0
+phiX174:755	0	0.00	0
+phiX174:756	0	0.00	0
+phiX174:757	0	0.00	0
+phiX174:758	0	0.00	0
+phiX174:759	0	0.00	0
+phiX174:760	0	0.00	0
+phiX174:761	0	0.00	0
+phiX174:762	0	0.00	0
+phiX174:763	0	0.00	0
+phiX174:764	0	0.00	0
+phiX174:765	0	0.00	0
+phiX174:766	0	0.00	0
+phiX174:767	0	0.00	0
+phiX174:768	0	0.00	0
+phiX174:769	0	0.00	0
+phiX174:770	0	0.00	0
+phiX174:771	0	0.00	0
+phiX174:772	0	0.00	0
+phiX174:773	0	0.00	0
+phiX174:774	0	0.00	0
+phiX174:775	0	0.00	0
+phiX174:776	0	0.00	0
+phiX174:777	0	0.00	0
+phiX174:778	0	0.00	0
+phiX174:779	0	0.00	0
+phiX174:780	0	0.00	0
+phiX174:781	0	0.00	0
+phiX174:782	0	0.00	0
+phiX174:783	0	0.00	0
+phiX174:784	0	0.00	0
+phiX174:785	0	0.00	0
+phiX174:786	0	0.00	0
+phiX174:787	0	0.00	0
+phiX174:788	0	0.00	0
+phiX174:789	0	0.00	0
+phiX174:790	0	0.00	0
+phiX174:791	0	0.00	0
+phiX174:792	0	0.00	0
+phiX174:793	0	0.00	0
+phiX174:794	0	0.00	0
+phiX174:795	0	0.00	0
+phiX174:796	0	0.00	0
+phiX174:797	0	0.00	0
+phiX174:798	0	0.00	0
+phiX174:799	0	0.00	0
+phiX174:800	0	0.00	0
+phiX174:801	0	0.00	0
+phiX174:802	0	0.00	0
+phiX174:803	0	0.00	0
+phiX174:804	0	0.00	0
+phiX174:805	0	0.00	0
+phiX174:806	0	0.00	0
+phiX174:807	0	0.00	0
+phiX174:808	0	0.00	0
+phiX174:809	0	0.00	0
+phiX174:810	0	0.00	0
+phiX174:811	0	0.00	0
+phiX174:812	0	0.00	0
+phiX174:813	0	0.00	0
+phiX174:814	0	0.00	0
+phiX174:815	0	0.00	0
+phiX174:816	0	0.00	0
+phiX174:817	0	0.00	0
+phiX174:818	0	0.00	0
+phiX174:819	0	0.00	0
+phiX174:820	0	0.00	0
+phiX174:821	0	0.00	0
+phiX174:822	0	0.00	0
+phiX174:823	0	0.00	0
+phiX174:824	0	0.00	0
+phiX174:825	0	0.00	0
+phiX174:826	0	0.00	0
+phiX174:827	0	0.00	0
+phiX174:828	0	0.00	0
+phiX174:829	0	0.00	0
+phiX174:830	0	0.00	0
+phiX174:831	0	0.00	0
+phiX174:832	0	0.00	0
+phiX174:833	0	0.00	0
+phiX174:834	0	0.00	0
+phiX174:835	0	0.00	0
+phiX174:836	0	0.00	0
+phiX174:837	0	0.00	0
+phiX174:838	0	0.00	0
+phiX174:839	0	0.00	0
+phiX174:840	0	0.00	0
+phiX174:841	0	0.00	0
+phiX174:842	0	0.00	0
+phiX174:843	0	0.00	0
+phiX174:844	0	0.00	0
+phiX174:845	0	0.00	0
+phiX174:846	0	0.00	0
+phiX174:847	0	0.00	0
+phiX174:848	0	0.00	0
+phiX174:849	0	0.00	0
+phiX174:850	0	0.00	0
+phiX174:851	0	0.00	0
+phiX174:852	0	0.00	0
+phiX174:853	0	0.00	0
+phiX174:854	0	0.00	0
+phiX174:855	0	0.00	0
+phiX174:856	0	0.00	0
+phiX174:857	0	0.00	0
+phiX174:858	0	0.00	0
+phiX174:859	0	0.00	0
+phiX174:860	0	0.00	0
+phiX174:861	0	0.00	0
+phiX174:862	0	0.00	0
+phiX174:863	0	0.00	0
+phiX174:864	0	0.00	0
+phiX174:865	0	0.00	0
+phiX174:866	0	0.00	0
+phiX174:867	0	0.00	0
+phiX174:868	0	0.00	0
+phiX174:869	0	0.00	0
+phiX174:870	0	0.00	0
+phiX174:871	0	0.00	0
+phiX174:872	0	0.00	0
+phiX174:873	0	0.00	0
+phiX174:874	0	0.00	0
+phiX174:875	0	0.00	0
+phiX174:876	0	0.00	0
+phiX174:877	0	0.00	0
+phiX174:878	0	0.00	0
+phiX174:879	0	0.00	0
+phiX174:880	0	0.00	0
+phiX174:881	0	0.00	0
+phiX174:882	0	0.00	0
+phiX174:883	0	0.00	0
+phiX174:884	0	0.00	0
+phiX174:885	0	0.00	0
+phiX174:886	0	0.00	0
+phiX174:887	0	0.00	0
+phiX174:888	0	0.00	0
+phiX174:889	0	0.00	0
+phiX174:890	0	0.00	0
+phiX174:891	0	0.00	0
+phiX174:892	0	0.00	0
+phiX174:893	0	0.00	0
+phiX174:894	0	0.00	0
+phiX174:895	0	0.00	0
+phiX174:896	0	0.00	0
+phiX174:897	0	0.00	0
+phiX174:898	0	0.00	0
+phiX174:899	0	0.00	0
+phiX174:900	0	0.00	0
+phiX174:901	0	0.00	0
+phiX174:902	0	0.00	0
+phiX174:903	0	0.00	0
+phiX174:904	0	0.00	0
+phiX174:905	0	0.00	0
+phiX174:906	0	0.00	0
+phiX174:907	0	0.00	0
+phiX174:908	0	0.00	0
+phiX174:909	0	0.00	0
+phiX174:910	0	0.00	0
+phiX174:911	0	0.00	0
+phiX174:912	0	0.00	0
+phiX174:913	0	0.00	0
+phiX174:914	0	0.00	0
+phiX174:915	0	0.00	0
+phiX174:916	0	0.00	0
+phiX174:917	0	0.00	0
+phiX174:918	0	0.00	0
+phiX174:919	0	0.00	0
+phiX174:920	0	0.00	0
+phiX174:921	0	0.00	0
+phiX174:922	0	0.00	0
+phiX174:923	0	0.00	0
+phiX174:924	0	0.00	0
+phiX174:925	0	0.00	0
+phiX174:926	0	0.00	0
+phiX174:927	0	0.00	0
+phiX174:928	0	0.00	0
+phiX174:929	0	0.00	0
+phiX174:930	0	0.00	0
+phiX174:931	0	0.00	0
+phiX174:932	0	0.00	0
+phiX174:933	0	0.00	0
+phiX174:934	0	0.00	0
+phiX174:935	0	0.00	0
+phiX174:936	0	0.00	0
+phiX174:937	0	0.00	0
+phiX174:938	0	0.00	0
+phiX174:939	0	0.00	0
+phiX174:940	0	0.00	0
+phiX174:941	0	0.00	0
+phiX174:942	0	0.00	0
+phiX174:943	0	0.00	0
+phiX174:944	0	0.00	0
+phiX174:945	0	0.00	0
+phiX174:946	0	0.00	0
+phiX174:947	0	0.00	0
+phiX174:948	0	0.00	0
+phiX174:949	0	0.00	0
+phiX174:950	0	0.00	0
+phiX174:951	0	0.00	0
+phiX174:952	0	0.00	0
+phiX174:953	0	0.00	0
+phiX174:954	0	0.00	0
+phiX174:955	0	0.00	0
+phiX174:956	0	0.00	0
+phiX174:957	0	0.00	0
+phiX174:958	0	0.00	0
+phiX174:959	0	0.00	0
+phiX174:960	0	0.00	0
+phiX174:961	0	0.00	0
+phiX174:962	0	0.00	0
+phiX174:963	0	0.00	0
+phiX174:964	0	0.00	0
+phiX174:965	0	0.00	0
+phiX174:966	0	0.00	0
+phiX174:967	0	0.00	0
+phiX174:968	0	0.00	0
+phiX174:969	0	0.00	0
+phiX174:970	0	0.00	0
+phiX174:971	0	0.00	0
+phiX174:972	0	0.00	0
+phiX174:973	0	0.00	0
+phiX174:974	0	0.00	0
+phiX174:975	0	0.00	0
+phiX174:976	0	0.00	0
+phiX174:977	0	0.00	0
+phiX174:978	0	0.00	0
+phiX174:979	0	0.00	0
+phiX174:980	0	0.00	0
+phiX174:981	0	0.00	0
+phiX174:982	0	0.00	0
+phiX174:983	0	0.00	0
+phiX174:984	0	0.00	0
+phiX174:985	0	0.00	0
+phiX174:986	0	0.00	0
+phiX174:987	0	0.00	0
+phiX174:988	0	0.00	0
+phiX174:989	0	0.00	0
+phiX174:990	0	0.00	0
+phiX174:991	0	0.00	0
+phiX174:992	0	0.00	0
+phiX174:993	0	0.00	0
+phiX174:994	0	0.00	0
+phiX174:995	0	0.00	0
+phiX174:996	0	0.00	0
+phiX174:997	0	0.00	0
+phiX174:998	0	0.00	0
+phiX174:999	0	0.00	0
+phiX174:1000	0	0.00	0
+phiX174:1001	0	0.00	0
+phiX174:1002	0	0.00	0
+phiX174:1003	0	0.00	0
+phiX174:1004	0	0.00	0
+phiX174:1005	0	0.00	0
+phiX174:1006	0	0.00	0
+phiX174:1007	0	0.00	0
+phiX174:1008	0	0.00	0
+phiX174:1009	0	0.00	0
+phiX174:1010	0	0.00	0
+phiX174:1011	0	0.00	0
+phiX174:1012	0	0.00	0
+phiX174:1013	0	0.00	0
+phiX174:1014	0	0.00	0
+phiX174:1015	0	0.00	0
+phiX174:1016	0	0.00	0
+phiX174:1017	0	0.00	0
+phiX174:1018	0	0.00	0
+phiX174:1019	0	0.00	0
+phiX174:1020	0	0.00	0
+phiX174:1021	0	0.00	0
+phiX174:1022	0	0.00	0
+phiX174:1023	0	0.00	0
+phiX174:1024	0	0.00	0
+phiX174:1025	0	0.00	0
+phiX174:1026	0	0.00	0
+phiX174:1027	0	0.00	0
+phiX174:1028	0	0.00	0
+phiX174:1029	0	0.00	0
+phiX174:1030	0	0.00	0
+phiX174:1031	0	0.00	0
+phiX174:1032	0	0.00	0
+phiX174:1033	0	0.00	0
+phiX174:1034	0	0.00	0
+phiX174:1035	0	0.00	0
+phiX174:1036	0	0.00	0
+phiX174:1037	0	0.00	0
+phiX174:1038	0	0.00	0
+phiX174:1039	0	0.00	0
+phiX174:1040	0	0.00	0
+phiX174:1041	0	0.00	0
+phiX174:1042	0	0.00	0
+phiX174:1043	0	0.00	0
+phiX174:1044	0	0.00	0
+phiX174:1045	0	0.00	0
+phiX174:1046	0	0.00	0
+phiX174:1047	0	0.00	0
+phiX174:1048	0	0.00	0
+phiX174:1049	0	0.00	0
+phiX174:1050	0	0.00	0
+phiX174:1051	0	0.00	0
+phiX174:1052	0	0.00	0
+phiX174:1053	0	0.00	0
+phiX174:1054	0	0.00	0
+phiX174:1055	0	0.00	0
+phiX174:1056	0	0.00	0
+phiX174:1057	0	0.00	0
+phiX174:1058	0	0.00	0
+phiX174:1059	0	0.00	0
+phiX174:1060	0	0.00	0
+phiX174:1061	0	0.00	0
+phiX174:1062	0	0.00	0
+phiX174:1063	0	0.00	0
+phiX174:1064	0	0.00	0
+phiX174:1065	0	0.00	0
+phiX174:1066	0	0.00	0
+phiX174:1067	0	0.00	0
+phiX174:1068	0	0.00	0
+phiX174:1069	0	0.00	0
+phiX174:1070	0	0.00	0
+phiX174:1071	0	0.00	0
+phiX174:1072	0	0.00	0
+phiX174:1073	0	0.00	0
+phiX174:1074	0	0.00	0
+phiX174:1075	0	0.00	0
+phiX174:1076	0	0.00	0
+phiX174:1077	0	0.00	0
+phiX174:1078	0	0.00	0
+phiX174:1079	0	0.00	0
+phiX174:1080	0	0.00	0
+phiX174:1081	0	0.00	0
+phiX174:1082	0	0.00	0
+phiX174:1083	0	0.00	0
+phiX174:1084	0	0.00	0
+phiX174:1085	0	0.00	0
+phiX174:1086	0	0.00	0
+phiX174:1087	0	0.00	0
+phiX174:1088	0	0.00	0
+phiX174:1089	0	0.00	0
+phiX174:1090	0	0.00	0
+phiX174:1091	0	0.00	0
+phiX174:1092	0	0.00	0
+phiX174:1093	0	0.00	0
+phiX174:1094	0	0.00	0
+phiX174:1095	0	0.00	0
+phiX174:1096	0	0.00	0
+phiX174:1097	0	0.00	0
+phiX174:1098	0	0.00	0
+phiX174:1099	0	0.00	0
+phiX174:1100	0	0.00	0
+phiX174:1101	0	0.00	0
+phiX174:1102	0	0.00	0
+phiX174:1103	0	0.00	0
+phiX174:1104	0	0.00	0
+phiX174:1105	0	0.00	0
+phiX174:1106	0	0.00	0
+phiX174:1107	0	0.00	0
+phiX174:1108	0	0.00	0
+phiX174:1109	0	0.00	0
+phiX174:1110	0	0.00	0
+phiX174:1111	0	0.00	0
+phiX174:1112	0	0.00	0
+phiX174:1113	0	0.00	0
+phiX174:1114	0	0.00	0
+phiX174:1115	0	0.00	0
+phiX174:1116	0	0.00	0
+phiX174:1117	0	0.00	0
+phiX174:1118	0	0.00	0
+phiX174:1119	0	0.00	0
+phiX174:1120	0	0.00	0
+phiX174:1121	0	0.00	0
+phiX174:1122	0	0.00	0
+phiX174:1123	0	0.00	0
+phiX174:1124	0	0.00	0
+phiX174:1125	0	0.00	0
+phiX174:1126	0	0.00	0
+phiX174:1127	0	0.00	0
+phiX174:1128	0	0.00	0
+phiX174:1129	0	0.00	0
+phiX174:1130	0	0.00	0
+phiX174:1131	0	0.00	0
+phiX174:1132	0	0.00	0
+phiX174:1133	0	0.00	0
+phiX174:1134	0	0.00	0
+phiX174:1135	0	0.00	0
+phiX174:1136	0	0.00	0
+phiX174:1137	0	0.00	0
+phiX174:1138	0	0.00	0
+phiX174:1139	0	0.00	0
+phiX174:1140	0	0.00	0
+phiX174:1141	0	0.00	0
+phiX174:1142	0	0.00	0
+phiX174:1143	0	0.00	0
+phiX174:1144	0	0.00	0
+phiX174:1145	0	0.00	0
+phiX174:1146	0	0.00	0
+phiX174:1147	0	0.00	0
+phiX174:1148	0	0.00	0
+phiX174:1149	0	0.00	0
+phiX174:1150	0	0.00	0
+phiX174:1151	0	0.00	0
+phiX174:1152	0	0.00	0
+phiX174:1153	0	0.00	0
+phiX174:1154	0	0.00	0
+phiX174:1155	0	0.00	0
+phiX174:1156	0	0.00	0
+phiX174:1157	0	0.00	0
+phiX174:1158	0	0.00	0
+phiX174:1159	0	0.00	0
+phiX174:1160	0	0.00	0
+phiX174:1161	0	0.00	0
+phiX174:1162	0	0.00	0
+phiX174:1163	0	0.00	0
+phiX174:1164	0	0.00	0
+phiX174:1165	0	0.00	0
+phiX174:1166	0	0.00	0
+phiX174:1167	0	0.00	0
+phiX174:1168	0	0.00	0
+phiX174:1169	0	0.00	0
+phiX174:1170	0	0.00	0
+phiX174:1171	0	0.00	0
+phiX174:1172	0	0.00	0
+phiX174:1173	0	0.00	0
+phiX174:1174	0	0.00	0
+phiX174:1175	0	0.00	0
+phiX174:1176	0	0.00	0
+phiX174:1177	0	0.00	0
+phiX174:1178	0	0.00	0
+phiX174:1179	0	0.00	0
+phiX174:1180	0	0.00	0
+phiX174:1181	0	0.00	0
+phiX174:1182	0	0.00	0
+phiX174:1183	0	0.00	0
+phiX174:1184	0	0.00	0
+phiX174:1185	0	0.00	0
+phiX174:1186	0	0.00	0
+phiX174:1187	0	0.00	0
+phiX174:1188	0	0.00	0
+phiX174:1189	0	0.00	0
+phiX174:1190	0	0.00	0
+phiX174:1191	0	0.00	0
+phiX174:1192	0	0.00	0
+phiX174:1193	0	0.00	0
+phiX174:1194	0	0.00	0
+phiX174:1195	0	0.00	0
+phiX174:1196	0	0.00	0
+phiX174:1197	0	0.00	0
+phiX174:1198	0	0.00	0
+phiX174:1199	0	0.00	0
+phiX174:1200	0	0.00	0
+phiX174:1201	0	0.00	0
+phiX174:1202	0	0.00	0
+phiX174:1203	0	0.00	0
+phiX174:1204	0	0.00	0
+phiX174:1205	0	0.00	0
+phiX174:1206	0	0.00	0
+phiX174:1207	0	0.00	0
+phiX174:1208	0	0.00	0
+phiX174:1209	0	0.00	0
+phiX174:1210	0	0.00	0
+phiX174:1211	0	0.00	0
+phiX174:1212	0	0.00	0
+phiX174:1213	0	0.00	0
+phiX174:1214	0	0.00	0
+phiX174:1215	0	0.00	0
+phiX174:1216	0	0.00	0
+phiX174:1217	0	0.00	0
+phiX174:1218	0	0.00	0
+phiX174:1219	0	0.00	0
+phiX174:1220	0	0.00	0
+phiX174:1221	0	0.00	0
+phiX174:1222	0	0.00	0
+phiX174:1223	0	0.00	0
+phiX174:1224	0	0.00	0
+phiX174:1225	0	0.00	0
+phiX174:1226	0	0.00	0
+phiX174:1227	0	0.00	0
+phiX174:1228	0	0.00	0
+phiX174:1229	0	0.00	0
+phiX174:1230	0	0.00	0
+phiX174:1231	0	0.00	0
+phiX174:1232	0	0.00	0
+phiX174:1233	0	0.00	0
+phiX174:1234	0	0.00	0
+phiX174:1235	0	0.00	0
+phiX174:1236	0	0.00	0
+phiX174:1237	0	0.00	0
+phiX174:1238	0	0.00	0
+phiX174:1239	0	0.00	0
+phiX174:1240	0	0.00	0
+phiX174:1241	0	0.00	0
+phiX174:1242	0	0.00	0
+phiX174:1243	0	0.00	0
+phiX174:1244	0	0.00	0
+phiX174:1245	0	0.00	0
+phiX174:1246	0	0.00	0
+phiX174:1247	0	0.00	0
+phiX174:1248	0	0.00	0
+phiX174:1249	0	0.00	0
+phiX174:1250	0	0.00	0
+phiX174:1251	0	0.00	0
+phiX174:1252	0	0.00	0
+phiX174:1253	0	0.00	0
+phiX174:1254	0	0.00	0
+phiX174:1255	0	0.00	0
+phiX174:1256	0	0.00	0
+phiX174:1257	0	0.00	0
+phiX174:1258	0	0.00	0
+phiX174:1259	0	0.00	0
+phiX174:1260	0	0.00	0
+phiX174:1261	0	0.00	0
+phiX174:1262	0	0.00	0
+phiX174:1263	0	0.00	0
+phiX174:1264	0	0.00	0
+phiX174:1265	0	0.00	0
+phiX174:1266	0	0.00	0
+phiX174:1267	0	0.00	0
+phiX174:1268	0	0.00	0
+phiX174:1269	0	0.00	0
+phiX174:1270	0	0.00	0
+phiX174:1271	0	0.00	0
+phiX174:1272	0	0.00	0
+phiX174:1273	0	0.00	0
+phiX174:1274	0	0.00	0
+phiX174:1275	0	0.00	0
+phiX174:1276	0	0.00	0
+phiX174:1277	0	0.00	0
+phiX174:1278	0	0.00	0
+phiX174:1279	0	0.00	0
+phiX174:1280	0	0.00	0
+phiX174:1281	0	0.00	0
+phiX174:1282	0	0.00	0
+phiX174:1283	0	0.00	0
+phiX174:1284	0	0.00	0
+phiX174:1285	0	0.00	0
+phiX174:1286	0	0.00	0
+phiX174:1287	0	0.00	0
+phiX174:1288	0	0.00	0
+phiX174:1289	0	0.00	0
+phiX174:1290	0	0.00	0
+phiX174:1291	0	0.00	0
+phiX174:1292	0	0.00	0
+phiX174:1293	0	0.00	0
+phiX174:1294	0	0.00	0
+phiX174:1295	0	0.00	0
+phiX174:1296	0	0.00	0
+phiX174:1297	0	0.00	0
+phiX174:1298	0	0.00	0
+phiX174:1299	0	0.00	0
+phiX174:1300	0	0.00	0
+phiX174:1301	0	0.00	0
+phiX174:1302	0	0.00	0
+phiX174:1303	0	0.00	0
+phiX174:1304	0	0.00	0
+phiX174:1305	0	0.00	0
+phiX174:1306	0	0.00	0
+phiX174:1307	0	0.00	0
+phiX174:1308	0	0.00	0
+phiX174:1309	0	0.00	0
+phiX174:1310	0	0.00	0
+phiX174:1311	0	0.00	0
+phiX174:1312	0	0.00	0
+phiX174:1313	0	0.00	0
+phiX174:1314	0	0.00	0
+phiX174:1315	0	0.00	0
+phiX174:1316	0	0.00	0
+phiX174:1317	0	0.00	0
+phiX174:1318	0	0.00	0
+phiX174:1319	0	0.00	0
+phiX174:1320	0	0.00	0
+phiX174:1321	0	0.00	0
+phiX174:1322	0	0.00	0
+phiX174:1323	0	0.00	0
+phiX174:1324	0	0.00	0
+phiX174:1325	0	0.00	0
+phiX174:1326	0	0.00	0
+phiX174:1327	0	0.00	0
+phiX174:1328	0	0.00	0
+phiX174:1329	0	0.00	0
+phiX174:1330	0	0.00	0
+phiX174:1331	0	0.00	0
+phiX174:1332	0	0.00	0
+phiX174:1333	0	0.00	0
+phiX174:1334	0	0.00	0
+phiX174:1335	0	0.00	0
+phiX174:1336	0	0.00	0
+phiX174:1337	0	0.00	0
+phiX174:1338	0	0.00	0
+phiX174:1339	0	0.00	0
+phiX174:1340	0	0.00	0
+phiX174:1341	0	0.00	0
+phiX174:1342	0	0.00	0
+phiX174:1343	0	0.00	0
+phiX174:1344	0	0.00	0
+phiX174:1345	0	0.00	0
+phiX174:1346	0	0.00	0
+phiX174:1347	0	0.00	0
+phiX174:1348	0	0.00	0
+phiX174:1349	0	0.00	0
+phiX174:1350	0	0.00	0
+phiX174:1351	0	0.00	0
+phiX174:1352	0	0.00	0
+phiX174:1353	0	0.00	0
+phiX174:1354	0	0.00	0
+phiX174:1355	0	0.00	0
+phiX174:1356	0	0.00	0
+phiX174:1357	0	0.00	0
+phiX174:1358	0	0.00	0
+phiX174:1359	0	0.00	0
+phiX174:1360	0	0.00	0
+phiX174:1361	0	0.00	0
+phiX174:1362	0	0.00	0
+phiX174:1363	0	0.00	0
+phiX174:1364	0	0.00	0
+phiX174:1365	0	0.00	0
+phiX174:1366	0	0.00	0
+phiX174:1367	0	0.00	0
+phiX174:1368	0	0.00	0
+phiX174:1369	0	0.00	0
+phiX174:1370	0	0.00	0
+phiX174:1371	0	0.00	0
+phiX174:1372	0	0.00	0
+phiX174:1373	0	0.00	0
+phiX174:1374	0	0.00	0
+phiX174:1375	0	0.00	0
+phiX174:1376	0	0.00	0
+phiX174:1377	0	0.00	0
+phiX174:1378	0	0.00	0
+phiX174:1379	0	0.00	0
+phiX174:1380	0	0.00	0
+phiX174:1381	0	0.00	0
+phiX174:1382	0	0.00	0
+phiX174:1383	0	0.00	0
+phiX174:1384	0	0.00	0
+phiX174:1385	0	0.00	0
+phiX174:1386	0	0.00	0
+phiX174:1387	0	0.00	0
+phiX174:1388	0	0.00	0
+phiX174:1389	0	0.00	0
+phiX174:1390	0	0.00	0
+phiX174:1391	0	0.00	0
+phiX174:1392	0	0.00	0
+phiX174:1393	0	0.00	0
+phiX174:1394	0	0.00	0
+phiX174:1395	0	0.00	0
+phiX174:1396	0	0.00	0
+phiX174:1397	0	0.00	0
+phiX174:1398	0	0.00	0
+phiX174:1399	0	0.00	0
+phiX174:1400	0	0.00	0
+phiX174:1401	0	0.00	0
+phiX174:1402	0	0.00	0
+phiX174:1403	0	0.00	0
+phiX174:1404	0	0.00	0
+phiX174:1405	0	0.00	0
+phiX174:1406	0	0.00	0
+phiX174:1407	0	0.00	0
+phiX174:1408	0	0.00	0
+phiX174:1409	0	0.00	0
+phiX174:1410	0	0.00	0
+phiX174:1411	1	1.00	1
+phiX174:1412	3	3.00	3
+phiX174:1413	5	5.00	5
+phiX174:1414	6	6.00	6
+phiX174:1415	7	7.00	7
+phiX174:1416	8	8.00	8
+phiX174:1417	9	9.00	9
+phiX174:1418	10	10.00	10
+phiX174:1419	10	10.00	10
+phiX174:1420	10	10.00	10
+phiX174:1421	10	10.00	10
+phiX174:1422	10	10.00	10
+phiX174:1423	10	10.00	10
+phiX174:1424	10	10.00	10
+phiX174:1425	10	10.00	10
+phiX174:1426	10	10.00	10
+phiX174:1427	10	10.00	10
+phiX174:1428	10	10.00	10
+phiX174:1429	10	10.00	10
+phiX174:1430	10	10.00	10
+phiX174:1431	10	10.00	10
+phiX174:1432	10	10.00	10
+phiX174:1433	10	10.00	10
+phiX174:1434	10	10.00	10
+phiX174:1435	10	10.00	10
+phiX174:1436	10	10.00	10
+phiX174:1437	10	10.00	10
+phiX174:1438	10	10.00	10
+phiX174:1439	10	10.00	10
+phiX174:1440	10	10.00	10
+phiX174:1441	10	10.00	10
+phiX174:1442	10	10.00	10
+phiX174:1443	10	10.00	10
+phiX174:1444	7	7.00	7
+phiX174:1445	10	10.00	10
+phiX174:1446	10	10.00	10
+phiX174:1447	10	10.00	10
+phiX174:1448	8	8.00	8
+phiX174:1449	6	6.00	6
+phiX174:1450	4	4.00	4
+phiX174:1451	3	3.00	3
+phiX174:1452	2	2.00	2
+phiX174:1453	1	1.00	1
+phiX174:1454	0	0.00	0
+phiX174:1455	0	0.00	0
+phiX174:1456	0	0.00	0
+phiX174:1457	0	0.00	0
+phiX174:1458	0	0.00	0
+phiX174:1459	0	0.00	0
+phiX174:1460	0	0.00	0
+phiX174:1461	0	0.00	0
+phiX174:1462	0	0.00	0
+phiX174:1463	0	0.00	0
+phiX174:1464	0	0.00	0
+phiX174:1465	0	0.00	0
+phiX174:1466	0	0.00	0
+phiX174:1467	0	0.00	0
+phiX174:1468	0	0.00	0
+phiX174:1469	0	0.00	0
+phiX174:1470	0	0.00	0
+phiX174:1471	0	0.00	0
+phiX174:1472	0	0.00	0
+phiX174:1473	0	0.00	0
+phiX174:1474	0	0.00	0
+phiX174:1475	0	0.00	0
+phiX174:1476	0	0.00	0
+phiX174:1477	0	0.00	0
+phiX174:1478	0	0.00	0
+phiX174:1479	0	0.00	0
+phiX174:1480	0	0.00	0
+phiX174:1481	0	0.00	0
+phiX174:1482	0	0.00	0
+phiX174:1483	0	0.00	0
+phiX174:1484	0	0.00	0
+phiX174:1485	0	0.00	0
+phiX174:1486	0	0.00	0
+phiX174:1487	0	0.00	0
+phiX174:1488	0	0.00	0
+phiX174:1489	0	0.00	0
+phiX174:1490	0	0.00	0
+phiX174:1491	0	0.00	0
+phiX174:1492	0	0.00	0
+phiX174:1493	0	0.00	0
+phiX174:1494	0	0.00	0
+phiX174:1495	0	0.00	0
+phiX174:1496	0	0.00	0
+phiX174:1497	0	0.00	0
+phiX174:1498	0	0.00	0
+phiX174:1499	0	0.00	0
+phiX174:1500	0	0.00	0
+phiX174:1501	0	0.00	0
+phiX174:1502	0	0.00	0
+phiX174:1503	0	0.00	0
+phiX174:1504	0	0.00	0
+phiX174:1505	0	0.00	0
+phiX174:1506	0	0.00	0
+phiX174:1507	0	0.00	0
+phiX174:1508	0	0.00	0
+phiX174:1509	0	0.00	0
+phiX174:1510	0	0.00	0
+phiX174:1511	0	0.00	0
+phiX174:1512	0	0.00	0
+phiX174:1513	0	0.00	0
+phiX174:1514	0	0.00	0
+phiX174:1515	0	0.00	0
+phiX174:1516	0	0.00	0
+phiX174:1517	0	0.00	0
+phiX174:1518	0	0.00	0
+phiX174:1519	0	0.00	0
+phiX174:1520	0	0.00	0
+phiX174:1521	0	0.00	0
+phiX174:1522	0	0.00	0
+phiX174:1523	0	0.00	0
+phiX174:1524	0	0.00	0
+phiX174:1525	0	0.00	0
+phiX174:1526	0	0.00	0
+phiX174:1527	0	0.00	0
+phiX174:1528	0	0.00	0
+phiX174:1529	0	0.00	0
+phiX174:1530	0	0.00	0
+phiX174:1531	0	0.00	0
+phiX174:1532	0	0.00	0
+phiX174:1533	0	0.00	0
+phiX174:1534	0	0.00	0
+phiX174:1535	0	0.00	0
+phiX174:1536	0	0.00	0
+phiX174:1537	0	0.00	0
+phiX174:1538	0	0.00	0
+phiX174:1539	0	0.00	0
+phiX174:1540	0	0.00	0
+phiX174:1541	0	0.00	0
+phiX174:1542	0	0.00	0
+phiX174:1543	0	0.00	0
+phiX174:1544	0	0.00	0
+phiX174:1545	0	0.00	0
+phiX174:1546	0	0.00	0
+phiX174:1547	0	0.00	0
+phiX174:1548	0	0.00	0
+phiX174:1549	0	0.00	0
+phiX174:1550	0	0.00	0
+phiX174:1551	0	0.00	0
+phiX174:1552	0	0.00	0
+phiX174:1553	0	0.00	0
+phiX174:1554	0	0.00	0
+phiX174:1555	0	0.00	0
+phiX174:1556	0	0.00	0
+phiX174:1557	0	0.00	0
+phiX174:1558	0	0.00	0
+phiX174:1559	0	0.00	0
+phiX174:1560	0	0.00	0
+phiX174:1561	0	0.00	0
+phiX174:1562	0	0.00	0
+phiX174:1563	0	0.00	0
+phiX174:1564	0	0.00	0
+phiX174:1565	0	0.00	0
+phiX174:1566	0	0.00	0
+phiX174:1567	0	0.00	0
+phiX174:1568	0	0.00	0
+phiX174:1569	0	0.00	0
+phiX174:1570	0	0.00	0
+phiX174:1571	0	0.00	0
+phiX174:1572	0	0.00	0
+phiX174:1573	0	0.00	0
+phiX174:1574	0	0.00	0
+phiX174:1575	0	0.00	0
+phiX174:1576	0	0.00	0
+phiX174:1577	0	0.00	0
+phiX174:1578	0	0.00	0
+phiX174:1579	0	0.00	0
+phiX174:1580	0	0.00	0
+phiX174:1581	0	0.00	0
+phiX174:1582	0	0.00	0
+phiX174:1583	0	0.00	0
+phiX174:1584	0	0.00	0
+phiX174:1585	0	0.00	0
+phiX174:1586	0	0.00	0
+phiX174:1587	0	0.00	0
+phiX174:1588	0	0.00	0
+phiX174:1589	0	0.00	0
+phiX174:1590	0	0.00	0
+phiX174:1591	0	0.00	0
+phiX174:1592	0	0.00	0
+phiX174:1593	0	0.00	0
+phiX174:1594	0	0.00	0
+phiX174:1595	0	0.00	0
+phiX174:1596	0	0.00	0
+phiX174:1597	0	0.00	0
+phiX174:1598	0	0.00	0
+phiX174:1599	0	0.00	0
+phiX174:1600	0	0.00	0
+phiX174:1601	0	0.00	0
+phiX174:1602	0	0.00	0
+phiX174:1603	0	0.00	0
+phiX174:1604	0	0.00	0
+phiX174:1605	0	0.00	0
+phiX174:1606	0	0.00	0
+phiX174:1607	0	0.00	0
+phiX174:1608	0	0.00	0
+phiX174:1609	0	0.00	0
+phiX174:1610	0	0.00	0
+phiX174:1611	0	0.00	0
+phiX174:1612	0	0.00	0
+phiX174:1613	0	0.00	0
+phiX174:1614	0	0.00	0
+phiX174:1615	0	0.00	0
+phiX174:1616	0	0.00	0
+phiX174:1617	0	0.00	0
+phiX174:1618	0	0.00	0
+phiX174:1619	0	0.00	0
+phiX174:1620	0	0.00	0
+phiX174:1621	0	0.00	0
+phiX174:1622	0	0.00	0
+phiX174:1623	0	0.00	0
+phiX174:1624	0	0.00	0
+phiX174:1625	0	0.00	0
+phiX174:1626	0	0.00	0
+phiX174:1627	0	0.00	0
+phiX174:1628	0	0.00	0
+phiX174:1629	0	0.00	0
+phiX174:1630	0	0.00	0
+phiX174:1631	0	0.00	0
+phiX174:1632	0	0.00	0
+phiX174:1633	0	0.00	0
+phiX174:1634	0	0.00	0
+phiX174:1635	0	0.00	0
+phiX174:1636	0	0.00	0
+phiX174:1637	0	0.00	0
+phiX174:1638	0	0.00	0
+phiX174:1639	0	0.00	0
+phiX174:1640	0	0.00	0
+phiX174:1641	0	0.00	0
+phiX174:1642	0	0.00	0
+phiX174:1643	0	0.00	0
+phiX174:1644	0	0.00	0
+phiX174:1645	0	0.00	0
+phiX174:1646	0	0.00	0
+phiX174:1647	0	0.00	0
+phiX174:1648	0	0.00	0
+phiX174:1649	0	0.00	0
+phiX174:1650	0	0.00	0
+phiX174:1651	0	0.00	0
+phiX174:1652	0	0.00	0
+phiX174:1653	0	0.00	0
+phiX174:1654	0	0.00	0
+phiX174:1655	0	0.00	0
+phiX174:1656	0	0.00	0
+phiX174:1657	0	0.00	0
+phiX174:1658	0	0.00	0
+phiX174:1659	0	0.00	0
+phiX174:1660	0	0.00	0
+phiX174:1661	0	0.00	0
+phiX174:1662	0	0.00	0
+phiX174:1663	0	0.00	0
+phiX174:1664	0	0.00	0
+phiX174:1665	0	0.00	0
+phiX174:1666	0	0.00	0
+phiX174:1667	0	0.00	0
+phiX174:1668	0	0.00	0
+phiX174:1669	0	0.00	0
+phiX174:1670	0	0.00	0
+phiX174:1671	0	0.00	0
+phiX174:1672	0	0.00	0
+phiX174:1673	0	0.00	0
+phiX174:1674	0	0.00	0
+phiX174:1675	0	0.00	0
+phiX174:1676	0	0.00	0
+phiX174:1677	0	0.00	0
+phiX174:1678	0	0.00	0
+phiX174:1679	0	0.00	0
+phiX174:1680	0	0.00	0
+phiX174:1681	0	0.00	0
+phiX174:1682	0	0.00	0
+phiX174:1683	0	0.00	0
+phiX174:1684	0	0.00	0
+phiX174:1685	0	0.00	0
+phiX174:1686	0	0.00	0
+phiX174:1687	0	0.00	0
+phiX174:1688	0	0.00	0
+phiX174:1689	0	0.00	0
+phiX174:1690	0	0.00	0
+phiX174:1691	0	0.00	0
+phiX174:1692	0	0.00	0
+phiX174:1693	0	0.00	0
+phiX174:1694	0	0.00	0
+phiX174:1695	0	0.00	0
+phiX174:1696	0	0.00	0
+phiX174:1697	0	0.00	0
+phiX174:1698	0	0.00	0
+phiX174:1699	0	0.00	0
+phiX174:1700	0	0.00	0
+phiX174:1701	0	0.00	0
+phiX174:1702	0	0.00	0
+phiX174:1703	0	0.00	0
+phiX174:1704	0	0.00	0
+phiX174:1705	0	0.00	0
+phiX174:1706	0	0.00	0
+phiX174:1707	0	0.00	0
+phiX174:1708	0	0.00	0
+phiX174:1709	0	0.00	0
+phiX174:1710	0	0.00	0
+phiX174:1711	0	0.00	0
+phiX174:1712	0	0.00	0
+phiX174:1713	0	0.00	0
+phiX174:1714	0	0.00	0
+phiX174:1715	0	0.00	0
+phiX174:1716	0	0.00	0
+phiX174:1717	0	0.00	0
+phiX174:1718	0	0.00	0
+phiX174:1719	0	0.00	0
+phiX174:1720	0	0.00	0
+phiX174:1721	0	0.00	0
+phiX174:1722	0	0.00	0
+phiX174:1723	0	0.00	0
+phiX174:1724	0	0.00	0
+phiX174:1725	0	0.00	0
+phiX174:1726	0	0.00	0
+phiX174:1727	0	0.00	0
+phiX174:1728	0	0.00	0
+phiX174:1729	0	0.00	0
+phiX174:1730	0	0.00	0
+phiX174:1731	0	0.00	0
+phiX174:1732	0	0.00	0
+phiX174:1733	0	0.00	0
+phiX174:1734	0	0.00	0
+phiX174:1735	0	0.00	0
+phiX174:1736	0	0.00	0
+phiX174:1737	0	0.00	0
+phiX174:1738	0	0.00	0
+phiX174:1739	0	0.00	0
+phiX174:1740	0	0.00	0
+phiX174:1741	0	0.00	0
+phiX174:1742	0	0.00	0
+phiX174:1743	0	0.00	0
+phiX174:1744	0	0.00	0
+phiX174:1745	0	0.00	0
+phiX174:1746	0	0.00	0
+phiX174:1747	0	0.00	0
+phiX174:1748	0	0.00	0
+phiX174:1749	0	0.00	0
+phiX174:1750	0	0.00	0
+phiX174:1751	0	0.00	0
+phiX174:1752	0	0.00	0
+phiX174:1753	0	0.00	0
+phiX174:1754	0	0.00	0
+phiX174:1755	0	0.00	0
+phiX174:1756	0	0.00	0
+phiX174:1757	0	0.00	0
+phiX174:1758	0	0.00	0
+phiX174:1759	0	0.00	0
+phiX174:1760	0	0.00	0
+phiX174:1761	0	0.00	0
+phiX174:1762	0	0.00	0
+phiX174:1763	0	0.00	0
+phiX174:1764	0	0.00	0
+phiX174:1765	0	0.00	0
+phiX174:1766	0	0.00	0
+phiX174:1767	0	0.00	0
+phiX174:1768	0	0.00	0
+phiX174:1769	0	0.00	0
+phiX174:1770	0	0.00	0
+phiX174:1771	0	0.00	0
+phiX174:1772	0	0.00	0
+phiX174:1773	0	0.00	0
+phiX174:1774	0	0.00	0
+phiX174:1775	0	0.00	0
+phiX174:1776	0	0.00	0
+phiX174:1777	0	0.00	0
+phiX174:1778	0	0.00	0
+phiX174:1779	0	0.00	0
+phiX174:1780	0	0.00	0
+phiX174:1781	0	0.00	0
+phiX174:1782	0	0.00	0
+phiX174:1783	0	0.00	0
+phiX174:1784	0	0.00	0
+phiX174:1785	0	0.00	0
+phiX174:1786	0	0.00	0
+phiX174:1787	0	0.00	0
+phiX174:1788	0	0.00	0
+phiX174:1789	0	0.00	0
+phiX174:1790	0	0.00	0
+phiX174:1791	0	0.00	0
+phiX174:1792	0	0.00	0
+phiX174:1793	0	0.00	0
+phiX174:1794	0	0.00	0
+phiX174:1795	0	0.00	0
+phiX174:1796	0	0.00	0
+phiX174:1797	0	0.00	0
+phiX174:1798	0	0.00	0
+phiX174:1799	0	0.00	0
+phiX174:1800	0	0.00	0
+phiX174:1801	0	0.00	0
+phiX174:1802	0	0.00	0
+phiX174:1803	0	0.00	0
+phiX174:1804	0	0.00	0
+phiX174:1805	0	0.00	0
+phiX174:1806	0	0.00	0
+phiX174:1807	0	0.00	0
+phiX174:1808	0	0.00	0
+phiX174:1809	0	0.00	0
+phiX174:1810	0	0.00	0
+phiX174:1811	0	0.00	0
+phiX174:1812	0	0.00	0
+phiX174:1813	0	0.00	0
+phiX174:1814	0	0.00	0
+phiX174:1815	0	0.00	0
+phiX174:1816	0	0.00	0
+phiX174:1817	0	0.00	0
+phiX174:1818	0	0.00	0
+phiX174:1819	0	0.00	0
+phiX174:1820	0	0.00	0
+phiX174:1821	0	0.00	0
+phiX174:1822	0	0.00	0
+phiX174:1823	0	0.00	0
+phiX174:1824	0	0.00	0
+phiX174:1825	0	0.00	0
+phiX174:1826	0	0.00	0
+phiX174:1827	0	0.00	0
+phiX174:1828	0	0.00	0
+phiX174:1829	0	0.00	0
+phiX174:1830	0	0.00	0
+phiX174:1831	0	0.00	0
+phiX174:1832	0	0.00	0
+phiX174:1833	0	0.00	0
+phiX174:1834	0	0.00	0
+phiX174:1835	0	0.00	0
+phiX174:1836	0	0.00	0
+phiX174:1837	0	0.00	0
+phiX174:1838	0	0.00	0
+phiX174:1839	0	0.00	0
+phiX174:1840	0	0.00	0
+phiX174:1841	0	0.00	0
+phiX174:1842	0	0.00	0
+phiX174:1843	0	0.00	0
+phiX174:1844	0	0.00	0
+phiX174:1845	0	0.00	0
+phiX174:1846	0	0.00	0
+phiX174:1847	0	0.00	0
+phiX174:1848	0	0.00	0
+phiX174:1849	0	0.00	0
+phiX174:1850	0	0.00	0
+phiX174:1851	0	0.00	0
+phiX174:1852	0	0.00	0
+phiX174:1853	0	0.00	0
+phiX174:1854	0	0.00	0
+phiX174:1855	0	0.00	0
+phiX174:1856	0	0.00	0
+phiX174:1857	0	0.00	0
+phiX174:1858	0	0.00	0
+phiX174:1859	0	0.00	0
+phiX174:1860	0	0.00	0
+phiX174:1861	0	0.00	0
+phiX174:1862	0	0.00	0
+phiX174:1863	0	0.00	0
+phiX174:1864	0	0.00	0
+phiX174:1865	0	0.00	0
+phiX174:1866	0	0.00	0
+phiX174:1867	0	0.00	0
+phiX174:1868	0	0.00	0
+phiX174:1869	0	0.00	0
+phiX174:1870	0	0.00	0
+phiX174:1871	0	0.00	0
+phiX174:1872	0	0.00	0
+phiX174:1873	0	0.00	0
+phiX174:1874	0	0.00	0
+phiX174:1875	0	0.00	0
+phiX174:1876	0	0.00	0
+phiX174:1877	0	0.00	0
+phiX174:1878	0	0.00	0
+phiX174:1879	0	0.00	0
+phiX174:1880	0	0.00	0
+phiX174:1881	0	0.00	0
+phiX174:1882	0	0.00	0
+phiX174:1883	0	0.00	0
+phiX174:1884	0	0.00	0
+phiX174:1885	0	0.00	0
+phiX174:1886	0	0.00	0
+phiX174:1887	0	0.00	0
+phiX174:1888	0	0.00	0
+phiX174:1889	0	0.00	0
+phiX174:1890	0	0.00	0
+phiX174:1891	0	0.00	0
+phiX174:1892	0	0.00	0
+phiX174:1893	0	0.00	0
+phiX174:1894	0	0.00	0
+phiX174:1895	0	0.00	0
+phiX174:1896	0	0.00	0
+phiX174:1897	0	0.00	0
+phiX174:1898	0	0.00	0
+phiX174:1899	0	0.00	0
+phiX174:1900	0	0.00	0
+phiX174:1901	0	0.00	0
+phiX174:1902	0	0.00	0
+phiX174:1903	0	0.00	0
+phiX174:1904	0	0.00	0
+phiX174:1905	0	0.00	0
+phiX174:1906	0	0.00	0
+phiX174:1907	0	0.00	0
+phiX174:1908	0	0.00	0
+phiX174:1909	0	0.00	0
+phiX174:1910	0	0.00	0
+phiX174:1911	0	0.00	0
+phiX174:1912	0	0.00	0
+phiX174:1913	0	0.00	0
+phiX174:1914	0	0.00	0
+phiX174:1915	0	0.00	0
+phiX174:1916	0	0.00	0
+phiX174:1917	0	0.00	0
+phiX174:1918	0	0.00	0
+phiX174:1919	0	0.00	0
+phiX174:1920	0	0.00	0
+phiX174:1921	0	0.00	0
+phiX174:1922	0	0.00	0
+phiX174:1923	0	0.00	0
+phiX174:1924	0	0.00	0
+phiX174:1925	0	0.00	0
+phiX174:1926	0	0.00	0
+phiX174:1927	0	0.00	0
+phiX174:1928	0	0.00	0
+phiX174:1929	0	0.00	0
+phiX174:1930	0	0.00	0
+phiX174:1931	0	0.00	0
+phiX174:1932	0	0.00	0
+phiX174:1933	0	0.00	0
+phiX174:1934	0	0.00	0
+phiX174:1935	0	0.00	0
+phiX174:1936	0	0.00	0
+phiX174:1937	0	0.00	0
+phiX174:1938	0	0.00	0
+phiX174:1939	0	0.00	0
+phiX174:1940	0	0.00	0
+phiX174:1941	0	0.00	0
+phiX174:1942	0	0.00	0
+phiX174:1943	0	0.00	0
+phiX174:1944	0	0.00	0
+phiX174:1945	0	0.00	0
+phiX174:1946	0	0.00	0
+phiX174:1947	0	0.00	0
+phiX174:1948	0	0.00	0
+phiX174:1949	0	0.00	0
+phiX174:1950	0	0.00	0
+phiX174:1951	0	0.00	0
+phiX174:1952	0	0.00	0
+phiX174:1953	0	0.00	0
+phiX174:1954	0	0.00	0
+phiX174:1955	0	0.00	0
+phiX174:1956	0	0.00	0
+phiX174:1957	0	0.00	0
+phiX174:1958	0	0.00	0
+phiX174:1959	0	0.00	0
+phiX174:1960	0	0.00	0
+phiX174:1961	0	0.00	0
+phiX174:1962	0	0.00	0
+phiX174:1963	0	0.00	0
+phiX174:1964	0	0.00	0
+phiX174:1965	0	0.00	0
+phiX174:1966	0	0.00	0
+phiX174:1967	0	0.00	0
+phiX174:1968	0	0.00	0
+phiX174:1969	0	0.00	0
+phiX174:1970	0	0.00	0
+phiX174:1971	0	0.00	0
+phiX174:1972	0	0.00	0
+phiX174:1973	0	0.00	0
+phiX174:1974	0	0.00	0
+phiX174:1975	0	0.00	0
+phiX174:1976	0	0.00	0
+phiX174:1977	0	0.00	0
+phiX174:1978	0	0.00	0
+phiX174:1979	0	0.00	0
+phiX174:1980	0	0.00	0
+phiX174:1981	0	0.00	0
+phiX174:1982	0	0.00	0
+phiX174:1983	0	0.00	0
+phiX174:1984	0	0.00	0
+phiX174:1985	0	0.00	0
+phiX174:1986	0	0.00	0
+phiX174:1987	0	0.00	0
+phiX174:1988	0	0.00	0
+phiX174:1989	0	0.00	0
+phiX174:1990	0	0.00	0
+phiX174:1991	0	0.00	0
+phiX174:1992	0	0.00	0
+phiX174:1993	0	0.00	0
+phiX174:1994	0	0.00	0
+phiX174:1995	0	0.00	0
+phiX174:1996	0	0.00	0
+phiX174:1997	0	0.00	0
+phiX174:1998	0	0.00	0
+phiX174:1999	0	0.00	0
+phiX174:2000	0	0.00	0
+phiX174:2001	0	0.00	0
+phiX174:2002	0	0.00	0
+phiX174:2003	0	0.00	0
+phiX174:2004	0	0.00	0
+phiX174:2005	0	0.00	0
+phiX174:2006	0	0.00	0
+phiX174:2007	0	0.00	0
+phiX174:2008	0	0.00	0
+phiX174:2009	0	0.00	0
+phiX174:2010	0	0.00	0
+phiX174:2011	0	0.00	0
+phiX174:2012	0	0.00	0
+phiX174:2013	0	0.00	0
+phiX174:2014	0	0.00	0
+phiX174:2015	0	0.00	0
+phiX174:2016	0	0.00	0
+phiX174:2017	0	0.00	0
+phiX174:2018	0	0.00	0
+phiX174:2019	0	0.00	0
+phiX174:2020	0	0.00	0
+phiX174:2021	0	0.00	0
+phiX174:2022	0	0.00	0
+phiX174:2023	0	0.00	0
+phiX174:2024	0	0.00	0
+phiX174:2025	0	0.00	0
+phiX174:2026	0	0.00	0
+phiX174:2027	0	0.00	0
+phiX174:2028	0	0.00	0
+phiX174:2029	0	0.00	0
+phiX174:2030	0	0.00	0
+phiX174:2031	0	0.00	0
+phiX174:2032	0	0.00	0
+phiX174:2033	0	0.00	0
+phiX174:2034	0	0.00	0
+phiX174:2035	0	0.00	0
+phiX174:2036	0	0.00	0
+phiX174:2037	0	0.00	0
+phiX174:2038	0	0.00	0
+phiX174:2039	0	0.00	0
+phiX174:2040	0	0.00	0
+phiX174:2041	0	0.00	0
+phiX174:2042	0	0.00	0
+phiX174:2043	0	0.00	0
+phiX174:2044	0	0.00	0
+phiX174:2045	0	0.00	0
+phiX174:2046	0	0.00	0
+phiX174:2047	0	0.00	0
+phiX174:2048	0	0.00	0
+phiX174:2049	0	0.00	0
+phiX174:2050	0	0.00	0
+phiX174:2051	0	0.00	0
+phiX174:2052	0	0.00	0
+phiX174:2053	0	0.00	0
+phiX174:2054	0	0.00	0
+phiX174:2055	0	0.00	0
+phiX174:2056	0	0.00	0
+phiX174:2057	0	0.00	0
+phiX174:2058	0	0.00	0
+phiX174:2059	0	0.00	0
+phiX174:2060	0	0.00	0
+phiX174:2061	0	0.00	0
+phiX174:2062	0	0.00	0
+phiX174:2063	0	0.00	0
+phiX174:2064	0	0.00	0
+phiX174:2065	0	0.00	0
+phiX174:2066	0	0.00	0
+phiX174:2067	0	0.00	0
+phiX174:2068	0	0.00	0
+phiX174:2069	0	0.00	0
+phiX174:2070	0	0.00	0
+phiX174:2071	0	0.00	0
+phiX174:2072	0	0.00	0
+phiX174:2073	0	0.00	0
+phiX174:2074	0	0.00	0
+phiX174:2075	0	0.00	0
+phiX174:2076	0	0.00	0
+phiX174:2077	0	0.00	0
+phiX174:2078	0	0.00	0
+phiX174:2079	0	0.00	0
+phiX174:2080	0	0.00	0
+phiX174:2081	0	0.00	0
+phiX174:2082	0	0.00	0
+phiX174:2083	0	0.00	0
+phiX174:2084	0	0.00	0
+phiX174:2085	0	0.00	0
+phiX174:2086	0	0.00	0
+phiX174:2087	0	0.00	0
+phiX174:2088	0	0.00	0
+phiX174:2089	0	0.00	0
+phiX174:2090	0	0.00	0
+phiX174:2091	0	0.00	0
+phiX174:2092	0	0.00	0
+phiX174:2093	0	0.00	0
+phiX174:2094	0	0.00	0
+phiX174:2095	0	0.00	0
+phiX174:2096	0	0.00	0
+phiX174:2097	0	0.00	0
+phiX174:2098	0	0.00	0
+phiX174:2099	0	0.00	0
+phiX174:2100	0	0.00	0
+phiX174:2101	0	0.00	0
+phiX174:2102	0	0.00	0
+phiX174:2103	0	0.00	0
+phiX174:2104	0	0.00	0
+phiX174:2105	0	0.00	0
+phiX174:2106	0	0.00	0
+phiX174:2107	0	0.00	0
+phiX174:2108	0	0.00	0
+phiX174:2109	0	0.00	0
+phiX174:2110	0	0.00	0
+phiX174:2111	0	0.00	0
+phiX174:2112	0	0.00	0
+phiX174:2113	0	0.00	0
+phiX174:2114	0	0.00	0
+phiX174:2115	0	0.00	0
+phiX174:2116	0	0.00	0
+phiX174:2117	0	0.00	0
+phiX174:2118	0	0.00	0
+phiX174:2119	0	0.00	0
+phiX174:2120	0	0.00	0
+phiX174:2121	0	0.00	0
+phiX174:2122	0	0.00	0
+phiX174:2123	0	0.00	0
+phiX174:2124	0	0.00	0
+phiX174:2125	0	0.00	0
+phiX174:2126	0	0.00	0
+phiX174:2127	0	0.00	0
+phiX174:2128	0	0.00	0
+phiX174:2129	0	0.00	0
+phiX174:2130	0	0.00	0
+phiX174:2131	0	0.00	0
+phiX174:2132	0	0.00	0
+phiX174:2133	0	0.00	0
+phiX174:2134	0	0.00	0
+phiX174:2135	0	0.00	0
+phiX174:2136	0	0.00	0
+phiX174:2137	0	0.00	0
+phiX174:2138	0	0.00	0
+phiX174:2139	0	0.00	0
+phiX174:2140	0	0.00	0
+phiX174:2141	0	0.00	0
+phiX174:2142	0	0.00	0
+phiX174:2143	0	0.00	0
+phiX174:2144	0	0.00	0
+phiX174:2145	0	0.00	0
+phiX174:2146	0	0.00	0
+phiX174:2147	0	0.00	0
+phiX174:2148	0	0.00	0
+phiX174:2149	0	0.00	0
+phiX174:2150	0	0.00	0
+phiX174:2151	0	0.00	0
+phiX174:2152	0	0.00	0
+phiX174:2153	0	0.00	0
+phiX174:2154	0	0.00	0
+phiX174:2155	0	0.00	0
+phiX174:2156	0	0.00	0
+phiX174:2157	0	0.00	0
+phiX174:2158	0	0.00	0
+phiX174:2159	0	0.00	0
+phiX174:2160	0	0.00	0
+phiX174:2161	0	0.00	0
+phiX174:2162	0	0.00	0
+phiX174:2163	0	0.00	0
+phiX174:2164	0	0.00	0
+phiX174:2165	0	0.00	0
+phiX174:2166	0	0.00	0
+phiX174:2167	0	0.00	0
+phiX174:2168	0	0.00	0
+phiX174:2169	0	0.00	0
+phiX174:2170	0	0.00	0
+phiX174:2171	0	0.00	0
+phiX174:2172	0	0.00	0
+phiX174:2173	0	0.00	0
+phiX174:2174	0	0.00	0
+phiX174:2175	0	0.00	0
+phiX174:2176	0	0.00	0
+phiX174:2177	0	0.00	0
+phiX174:2178	0	0.00	0
+phiX174:2179	0	0.00	0
+phiX174:2180	0	0.00	0
+phiX174:2181	0	0.00	0
+phiX174:2182	0	0.00	0
+phiX174:2183	0	0.00	0
+phiX174:2184	0	0.00	0
+phiX174:2185	0	0.00	0
+phiX174:2186	0	0.00	0
+phiX174:2187	0	0.00	0
+phiX174:2188	0	0.00	0
+phiX174:2189	0	0.00	0
+phiX174:2190	0	0.00	0
+phiX174:2191	0	0.00	0
+phiX174:2192	0	0.00	0
+phiX174:2193	0	0.00	0
+phiX174:2194	0	0.00	0
+phiX174:2195	0	0.00	0
+phiX174:2196	0	0.00	0
+phiX174:2197	0	0.00	0
+phiX174:2198	0	0.00	0
+phiX174:2199	0	0.00	0
+phiX174:2200	0	0.00	0
+phiX174:2201	0	0.00	0
+phiX174:2202	0	0.00	0
+phiX174:2203	0	0.00	0
+phiX174:2204	0	0.00	0
+phiX174:2205	0	0.00	0
+phiX174:2206	0	0.00	0
+phiX174:2207	0	0.00	0
+phiX174:2208	0	0.00	0
+phiX174:2209	0	0.00	0
+phiX174:2210	0	0.00	0
+phiX174:2211	0	0.00	0
+phiX174:2212	0	0.00	0
+phiX174:2213	0	0.00	0
+phiX174:2214	0	0.00	0
+phiX174:2215	0	0.00	0
+phiX174:2216	0	0.00	0
+phiX174:2217	0	0.00	0
+phiX174:2218	0	0.00	0
+phiX174:2219	0	0.00	0
+phiX174:2220	0	0.00	0
+phiX174:2221	0	0.00	0
+phiX174:2222	0	0.00	0
+phiX174:2223	0	0.00	0
+phiX174:2224	0	0.00	0
+phiX174:2225	0	0.00	0
+phiX174:2226	0	0.00	0
+phiX174:2227	0	0.00	0
+phiX174:2228	0	0.00	0
+phiX174:2229	0	0.00	0
+phiX174:2230	0	0.00	0
+phiX174:2231	0	0.00	0
+phiX174:2232	0	0.00	0
+phiX174:2233	0	0.00	0
+phiX174:2234	0	0.00	0
+phiX174:2235	0	0.00	0
+phiX174:2236	0	0.00	0
+phiX174:2237	0	0.00	0
+phiX174:2238	0	0.00	0
+phiX174:2239	0	0.00	0
+phiX174:2240	0	0.00	0
+phiX174:2241	0	0.00	0
+phiX174:2242	0	0.00	0
+phiX174:2243	0	0.00	0
+phiX174:2244	0	0.00	0
+phiX174:2245	0	0.00	0
+phiX174:2246	0	0.00	0
+phiX174:2247	0	0.00	0
+phiX174:2248	0	0.00	0
+phiX174:2249	0	0.00	0
+phiX174:2250	0	0.00	0
+phiX174:2251	0	0.00	0
+phiX174:2252	0	0.00	0
+phiX174:2253	0	0.00	0
+phiX174:2254	0	0.00	0
+phiX174:2255	0	0.00	0
+phiX174:2256	0	0.00	0
+phiX174:2257	0	0.00	0
+phiX174:2258	0	0.00	0
+phiX174:2259	0	0.00	0
+phiX174:2260	0	0.00	0
+phiX174:2261	0	0.00	0
+phiX174:2262	0	0.00	0
+phiX174:2263	0	0.00	0
+phiX174:2264	0	0.00	0
+phiX174:2265	0	0.00	0
+phiX174:2266	0	0.00	0
+phiX174:2267	0	0.00	0
+phiX174:2268	0	0.00	0
+phiX174:2269	0	0.00	0
+phiX174:2270	0	0.00	0
+phiX174:2271	0	0.00	0
+phiX174:2272	0	0.00	0
+phiX174:2273	0	0.00	0
+phiX174:2274	0	0.00	0
+phiX174:2275	0	0.00	0
+phiX174:2276	0	0.00	0
+phiX174:2277	0	0.00	0
+phiX174:2278	0	0.00	0
+phiX174:2279	0	0.00	0
+phiX174:2280	0	0.00	0
+phiX174:2281	0	0.00	0
+phiX174:2282	0	0.00	0
+phiX174:2283	0	0.00	0
+phiX174:2284	0	0.00	0
+phiX174:2285	0	0.00	0
+phiX174:2286	0	0.00	0
+phiX174:2287	0	0.00	0
+phiX174:2288	0	0.00	0
+phiX174:2289	0	0.00	0
+phiX174:2290	0	0.00	0
+phiX174:2291	0	0.00	0
+phiX174:2292	0	0.00	0
+phiX174:2293	0	0.00	0
+phiX174:2294	0	0.00	0
+phiX174:2295	0	0.00	0
+phiX174:2296	0	0.00	0
+phiX174:2297	0	0.00	0
+phiX174:2298	0	0.00	0
+phiX174:2299	0	0.00	0
+phiX174:2300	0	0.00	0
+phiX174:2301	0	0.00	0
+phiX174:2302	0	0.00	0
+phiX174:2303	0	0.00	0
+phiX174:2304	0	0.00	0
+phiX174:2305	0	0.00	0
+phiX174:2306	0	0.00	0
+phiX174:2307	0	0.00	0
+phiX174:2308	0	0.00	0
+phiX174:2309	0	0.00	0
+phiX174:2310	0	0.00	0
+phiX174:2311	0	0.00	0
+phiX174:2312	0	0.00	0
+phiX174:2313	0	0.00	0
+phiX174:2314	0	0.00	0
+phiX174:2315	0	0.00	0
+phiX174:2316	0	0.00	0
+phiX174:2317	0	0.00	0
+phiX174:2318	0	0.00	0
+phiX174:2319	0	0.00	0
+phiX174:2320	0	0.00	0
+phiX174:2321	0	0.00	0
+phiX174:2322	0	0.00	0
+phiX174:2323	0	0.00	0
+phiX174:2324	0	0.00	0
+phiX174:2325	0	0.00	0
+phiX174:2326	0	0.00	0
+phiX174:2327	0	0.00	0
+phiX174:2328	0	0.00	0
+phiX174:2329	0	0.00	0
+phiX174:2330	0	0.00	0
+phiX174:2331	0	0.00	0
+phiX174:2332	0	0.00	0
+phiX174:2333	0	0.00	0
+phiX174:2334	0	0.00	0
+phiX174:2335	0	0.00	0
+phiX174:2336	0	0.00	0
+phiX174:2337	0	0.00	0
+phiX174:2338	0	0.00	0
+phiX174:2339	0	0.00	0
+phiX174:2340	0	0.00	0
+phiX174:2341	0	0.00	0
+phiX174:2342	0	0.00	0
+phiX174:2343	0	0.00	0
+phiX174:2344	0	0.00	0
+phiX174:2345	0	0.00	0
+phiX174:2346	0	0.00	0
+phiX174:2347	0	0.00	0
+phiX174:2348	0	0.00	0
+phiX174:2349	0	0.00	0
+phiX174:2350	0	0.00	0
+phiX174:2351	0	0.00	0
+phiX174:2352	0	0.00	0
+phiX174:2353	0	0.00	0
+phiX174:2354	0	0.00	0
+phiX174:2355	0	0.00	0
+phiX174:2356	0	0.00	0
+phiX174:2357	0	0.00	0
+phiX174:2358	0	0.00	0
+phiX174:2359	0	0.00	0
+phiX174:2360	0	0.00	0
+phiX174:2361	0	0.00	0
+phiX174:2362	0	0.00	0
+phiX174:2363	0	0.00	0
+phiX174:2364	0	0.00	0
+phiX174:2365	0	0.00	0
+phiX174:2366	0	0.00	0
+phiX174:2367	0	0.00	0
+phiX174:2368	0	0.00	0
+phiX174:2369	0	0.00	0
+phiX174:2370	0	0.00	0
+phiX174:2371	0	0.00	0
+phiX174:2372	0	0.00	0
+phiX174:2373	0	0.00	0
+phiX174:2374	0	0.00	0
+phiX174:2375	0	0.00	0
+phiX174:2376	0	0.00	0
+phiX174:2377	0	0.00	0
+phiX174:2378	0	0.00	0
+phiX174:2379	0	0.00	0
+phiX174:2380	0	0.00	0
+phiX174:2381	0	0.00	0
+phiX174:2382	0	0.00	0
+phiX174:2383	0	0.00	0
+phiX174:2384	0	0.00	0
+phiX174:2385	0	0.00	0
+phiX174:2386	0	0.00	0
+phiX174:2387	0	0.00	0
+phiX174:2388	0	0.00	0
+phiX174:2389	0	0.00	0
+phiX174:2390	0	0.00	0
+phiX174:2391	0	0.00	0
+phiX174:2392	0	0.00	0
+phiX174:2393	0	0.00	0
+phiX174:2394	0	0.00	0
+phiX174:2395	0	0.00	0
+phiX174:2396	0	0.00	0
+phiX174:2397	0	0.00	0
+phiX174:2398	0	0.00	0
+phiX174:2399	0	0.00	0
+phiX174:2400	0	0.00	0
+phiX174:2401	0	0.00	0
+phiX174:2402	0	0.00	0
+phiX174:2403	0	0.00	0
+phiX174:2404	0	0.00	0
+phiX174:2405	0	0.00	0
+phiX174:2406	0	0.00	0
+phiX174:2407	0	0.00	0
+phiX174:2408	0	0.00	0
+phiX174:2409	0	0.00	0
+phiX174:2410	0	0.00	0
+phiX174:2411	0	0.00	0
+phiX174:2412	0	0.00	0
+phiX174:2413	0	0.00	0
+phiX174:2414	0	0.00	0
+phiX174:2415	0	0.00	0
+phiX174:2416	0	0.00	0
+phiX174:2417	0	0.00	0
+phiX174:2418	0	0.00	0
+phiX174:2419	0	0.00	0
+phiX174:2420	0	0.00	0
+phiX174:2421	0	0.00	0
+phiX174:2422	0	0.00	0
+phiX174:2423	0	0.00	0
+phiX174:2424	0	0.00	0
+phiX174:2425	0	0.00	0
+phiX174:2426	0	0.00	0
+phiX174:2427	0	0.00	0
+phiX174:2428	0	0.00	0
+phiX174:2429	0	0.00	0
+phiX174:2430	0	0.00	0
+phiX174:2431	0	0.00	0
+phiX174:2432	0	0.00	0
+phiX174:2433	0	0.00	0
+phiX174:2434	0	0.00	0
+phiX174:2435	0	0.00	0
+phiX174:2436	0	0.00	0
+phiX174:2437	0	0.00	0
+phiX174:2438	0	0.00	0
+phiX174:2439	0	0.00	0
+phiX174:2440	0	0.00	0
+phiX174:2441	0	0.00	0
+phiX174:2442	0	0.00	0
+phiX174:2443	0	0.00	0
+phiX174:2444	0	0.00	0
+phiX174:2445	0	0.00	0
+phiX174:2446	0	0.00	0
+phiX174:2447	0	0.00	0
+phiX174:2448	0	0.00	0
+phiX174:2449	0	0.00	0
+phiX174:2450	0	0.00	0
+phiX174:2451	0	0.00	0
+phiX174:2452	0	0.00	0
+phiX174:2453	0	0.00	0
+phiX174:2454	0	0.00	0
+phiX174:2455	0	0.00	0
+phiX174:2456	0	0.00	0
+phiX174:2457	0	0.00	0
+phiX174:2458	0	0.00	0
+phiX174:2459	0	0.00	0
+phiX174:2460	0	0.00	0
+phiX174:2461	0	0.00	0
+phiX174:2462	0	0.00	0
+phiX174:2463	0	0.00	0
+phiX174:2464	0	0.00	0
+phiX174:2465	0	0.00	0
+phiX174:2466	0	0.00	0
+phiX174:2467	0	0.00	0
+phiX174:2468	0	0.00	0
+phiX174:2469	0	0.00	0
+phiX174:2470	0	0.00	0
+phiX174:2471	0	0.00	0
+phiX174:2472	0	0.00	0
+phiX174:2473	0	0.00	0
+phiX174:2474	0	0.00	0
+phiX174:2475	0	0.00	0
+phiX174:2476	0	0.00	0
+phiX174:2477	0	0.00	0
+phiX174:2478	0	0.00	0
+phiX174:2479	0	0.00	0
+phiX174:2480	0	0.00	0
+phiX174:2481	0	0.00	0
+phiX174:2482	0	0.00	0
+phiX174:2483	0	0.00	0
+phiX174:2484	0	0.00	0
+phiX174:2485	0	0.00	0
+phiX174:2486	0	0.00	0
+phiX174:2487	0	0.00	0
+phiX174:2488	0	0.00	0
+phiX174:2489	0	0.00	0
+phiX174:2490	0	0.00	0
+phiX174:2491	0	0.00	0
+phiX174:2492	0	0.00	0
+phiX174:2493	0	0.00	0
+phiX174:2494	0	0.00	0
+phiX174:2495	0	0.00	0
+phiX174:2496	0	0.00	0
+phiX174:2497	0	0.00	0
+phiX174:2498	0	0.00	0
+phiX174:2499	0	0.00	0
+phiX174:2500	0	0.00	0
+phiX174:2501	0	0.00	0
+phiX174:2502	0	0.00	0
+phiX174:2503	0	0.00	0
+phiX174:2504	0	0.00	0
+phiX174:2505	0	0.00	0
+phiX174:2506	0	0.00	0
+phiX174:2507	0	0.00	0
+phiX174:2508	0	0.00	0
+phiX174:2509	0	0.00	0
+phiX174:2510	0	0.00	0
+phiX174:2511	0	0.00	0
+phiX174:2512	0	0.00	0
+phiX174:2513	0	0.00	0
+phiX174:2514	0	0.00	0
+phiX174:2515	0	0.00	0
+phiX174:2516	0	0.00	0
+phiX174:2517	0	0.00	0
+phiX174:2518	0	0.00	0
+phiX174:2519	0	0.00	0
+phiX174:2520	0	0.00	0
+phiX174:2521	0	0.00	0
+phiX174:2522	0	0.00	0
+phiX174:2523	0	0.00	0
+phiX174:2524	0	0.00	0
+phiX174:2525	0	0.00	0
+phiX174:2526	0	0.00	0
+phiX174:2527	0	0.00	0
+phiX174:2528	0	0.00	0
+phiX174:2529	0	0.00	0
+phiX174:2530	0	0.00	0
+phiX174:2531	0	0.00	0
+phiX174:2532	0	0.00	0
+phiX174:2533	0	0.00	0
+phiX174:2534	0	0.00	0
+phiX174:2535	0	0.00	0
+phiX174:2536	0	0.00	0
+phiX174:2537	0	0.00	0
+phiX174:2538	0	0.00	0
+phiX174:2539	0	0.00	0
+phiX174:2540	0	0.00	0
+phiX174:2541	0	0.00	0
+phiX174:2542	0	0.00	0
+phiX174:2543	0	0.00	0
+phiX174:2544	0	0.00	0
+phiX174:2545	0	0.00	0
+phiX174:2546	0	0.00	0
+phiX174:2547	0	0.00	0
+phiX174:2548	0	0.00	0
+phiX174:2549	0	0.00	0
+phiX174:2550	0	0.00	0
+phiX174:2551	0	0.00	0
+phiX174:2552	0	0.00	0
+phiX174:2553	0	0.00	0
+phiX174:2554	0	0.00	0
+phiX174:2555	0	0.00	0
+phiX174:2556	0	0.00	0
+phiX174:2557	0	0.00	0
+phiX174:2558	0	0.00	0
+phiX174:2559	0	0.00	0
+phiX174:2560	0	0.00	0
+phiX174:2561	0	0.00	0
+phiX174:2562	0	0.00	0
+phiX174:2563	0	0.00	0
+phiX174:2564	0	0.00	0
+phiX174:2565	0	0.00	0
+phiX174:2566	0	0.00	0
+phiX174:2567	0	0.00	0
+phiX174:2568	0	0.00	0
+phiX174:2569	0	0.00	0
+phiX174:2570	0	0.00	0
+phiX174:2571	0	0.00	0
+phiX174:2572	0	0.00	0
+phiX174:2573	0	0.00	0
+phiX174:2574	0	0.00	0
+phiX174:2575	0	0.00	0
+phiX174:2576	0	0.00	0
+phiX174:2577	0	0.00	0
+phiX174:2578	0	0.00	0
+phiX174:2579	0	0.00	0
+phiX174:2580	0	0.00	0
+phiX174:2581	0	0.00	0
+phiX174:2582	0	0.00	0
+phiX174:2583	0	0.00	0
+phiX174:2584	0	0.00	0
+phiX174:2585	0	0.00	0
+phiX174:2586	0	0.00	0
+phiX174:2587	0	0.00	0
+phiX174:2588	0	0.00	0
+phiX174:2589	0	0.00	0
+phiX174:2590	0	0.00	0
+phiX174:2591	0	0.00	0
+phiX174:2592	0	0.00	0
+phiX174:2593	0	0.00	0
+phiX174:2594	0	0.00	0
+phiX174:2595	0	0.00	0
+phiX174:2596	0	0.00	0
+phiX174:2597	0	0.00	0
+phiX174:2598	0	0.00	0
+phiX174:2599	0	0.00	0
+phiX174:2600	0	0.00	0
+phiX174:2601	0	0.00	0
+phiX174:2602	0	0.00	0
+phiX174:2603	0	0.00	0
+phiX174:2604	0	0.00	0
+phiX174:2605	0	0.00	0
+phiX174:2606	0	0.00	0
+phiX174:2607	0	0.00	0
+phiX174:2608	0	0.00	0
+phiX174:2609	0	0.00	0
+phiX174:2610	0	0.00	0
+phiX174:2611	0	0.00	0
+phiX174:2612	0	0.00	0
+phiX174:2613	0	0.00	0
+phiX174:2614	0	0.00	0
+phiX174:2615	0	0.00	0
+phiX174:2616	0	0.00	0
+phiX174:2617	0	0.00	0
+phiX174:2618	0	0.00	0
+phiX174:2619	0	0.00	0
+phiX174:2620	0	0.00	0
+phiX174:2621	0	0.00	0
+phiX174:2622	0	0.00	0
+phiX174:2623	0	0.00	0
+phiX174:2624	0	0.00	0
+phiX174:2625	0	0.00	0
+phiX174:2626	0	0.00	0
+phiX174:2627	0	0.00	0
+phiX174:2628	0	0.00	0
+phiX174:2629	0	0.00	0
+phiX174:2630	0	0.00	0
+phiX174:2631	0	0.00	0
+phiX174:2632	0	0.00	0
+phiX174:2633	0	0.00	0
+phiX174:2634	0	0.00	0
+phiX174:2635	0	0.00	0
+phiX174:2636	0	0.00	0
+phiX174:2637	0	0.00	0
+phiX174:2638	0	0.00	0
+phiX174:2639	0	0.00	0
+phiX174:2640	0	0.00	0
+phiX174:2641	0	0.00	0
+phiX174:2642	0	0.00	0
+phiX174:2643	0	0.00	0
+phiX174:2644	0	0.00	0
+phiX174:2645	0	0.00	0
+phiX174:2646	0	0.00	0
+phiX174:2647	0	0.00	0
+phiX174:2648	0	0.00	0
+phiX174:2649	0	0.00	0
+phiX174:2650	0	0.00	0
+phiX174:2651	0	0.00	0
+phiX174:2652	0	0.00	0
+phiX174:2653	0	0.00	0
+phiX174:2654	0	0.00	0
+phiX174:2655	0	0.00	0
+phiX174:2656	0	0.00	0
+phiX174:2657	0	0.00	0
+phiX174:2658	0	0.00	0
+phiX174:2659	0	0.00	0
+phiX174:2660	0	0.00	0
+phiX174:2661	0	0.00	0
+phiX174:2662	0	0.00	0
+phiX174:2663	0	0.00	0
+phiX174:2664	0	0.00	0
+phiX174:2665	0	0.00	0
+phiX174:2666	0	0.00	0
+phiX174:2667	0	0.00	0
+phiX174:2668	0	0.00	0
+phiX174:2669	0	0.00	0
+phiX174:2670	0	0.00	0
+phiX174:2671	0	0.00	0
+phiX174:2672	0	0.00	0
+phiX174:2673	0	0.00	0
+phiX174:2674	0	0.00	0
+phiX174:2675	0	0.00	0
+phiX174:2676	0	0.00	0
+phiX174:2677	0	0.00	0
+phiX174:2678	0	0.00	0
+phiX174:2679	0	0.00	0
+phiX174:2680	0	0.00	0
+phiX174:2681	0	0.00	0
+phiX174:2682	0	0.00	0
+phiX174:2683	0	0.00	0
+phiX174:2684	0	0.00	0
+phiX174:2685	0	0.00	0
+phiX174:2686	0	0.00	0
+phiX174:2687	0	0.00	0
+phiX174:2688	0	0.00	0
+phiX174:2689	0	0.00	0
+phiX174:2690	0	0.00	0
+phiX174:2691	0	0.00	0
+phiX174:2692	0	0.00	0
+phiX174:2693	0	0.00	0
+phiX174:2694	0	0.00	0
+phiX174:2695	0	0.00	0
+phiX174:2696	0	0.00	0
+phiX174:2697	0	0.00	0
+phiX174:2698	0	0.00	0
+phiX174:2699	0	0.00	0
+phiX174:2700	0	0.00	0
+phiX174:2701	0	0.00	0
+phiX174:2702	0	0.00	0
+phiX174:2703	0	0.00	0
+phiX174:2704	0	0.00	0
+phiX174:2705	0	0.00	0
+phiX174:2706	0	0.00	0
+phiX174:2707	0	0.00	0
+phiX174:2708	0	0.00	0
+phiX174:2709	0	0.00	0
+phiX174:2710	0	0.00	0
+phiX174:2711	0	0.00	0
+phiX174:2712	0	0.00	0
+phiX174:2713	0	0.00	0
+phiX174:2714	0	0.00	0
+phiX174:2715	0	0.00	0
+phiX174:2716	0	0.00	0
+phiX174:2717	0	0.00	0
+phiX174:2718	0	0.00	0
+phiX174:2719	0	0.00	0
+phiX174:2720	0	0.00	0
+phiX174:2721	0	0.00	0
+phiX174:2722	0	0.00	0
+phiX174:2723	0	0.00	0
+phiX174:2724	0	0.00	0
+phiX174:2725	0	0.00	0
+phiX174:2726	0	0.00	0
+phiX174:2727	0	0.00	0
+phiX174:2728	0	0.00	0
+phiX174:2729	0	0.00	0
+phiX174:2730	0	0.00	0
+phiX174:2731	0	0.00	0
+phiX174:2732	0	0.00	0
+phiX174:2733	0	0.00	0
+phiX174:2734	0	0.00	0
+phiX174:2735	0	0.00	0
+phiX174:2736	0	0.00	0
+phiX174:2737	0	0.00	0
+phiX174:2738	0	0.00	0
+phiX174:2739	0	0.00	0
+phiX174:2740	0	0.00	0
+phiX174:2741	0	0.00	0
+phiX174:2742	0	0.00	0
+phiX174:2743	0	0.00	0
+phiX174:2744	0	0.00	0
+phiX174:2745	0	0.00	0
+phiX174:2746	0	0.00	0
+phiX174:2747	0	0.00	0
+phiX174:2748	0	0.00	0
+phiX174:2749	0	0.00	0
+phiX174:2750	0	0.00	0
+phiX174:2751	0	0.00	0
+phiX174:2752	0	0.00	0
+phiX174:2753	0	0.00	0
+phiX174:2754	0	0.00	0
+phiX174:2755	0	0.00	0
+phiX174:2756	0	0.00	0
+phiX174:2757	0	0.00	0
+phiX174:2758	0	0.00	0
+phiX174:2759	0	0.00	0
+phiX174:2760	0	0.00	0
+phiX174:2761	0	0.00	0
+phiX174:2762	0	0.00	0
+phiX174:2763	0	0.00	0
+phiX174:2764	0	0.00	0
+phiX174:2765	0	0.00	0
+phiX174:2766	0	0.00	0
+phiX174:2767	0	0.00	0
+phiX174:2768	0	0.00	0
+phiX174:2769	0	0.00	0
+phiX174:2770	0	0.00	0
+phiX174:2771	0	0.00	0
+phiX174:2772	0	0.00	0
+phiX174:2773	0	0.00	0
+phiX174:2774	0	0.00	0
+phiX174:2775	0	0.00	0
+phiX174:2776	0	0.00	0
+phiX174:2777	0	0.00	0
+phiX174:2778	0	0.00	0
+phiX174:2779	0	0.00	0
+phiX174:2780	0	0.00	0
+phiX174:2781	0	0.00	0
+phiX174:2782	0	0.00	0
+phiX174:2783	0	0.00	0
+phiX174:2784	0	0.00	0
+phiX174:2785	0	0.00	0
+phiX174:2786	0	0.00	0
+phiX174:2787	0	0.00	0
+phiX174:2788	0	0.00	0
+phiX174:2789	0	0.00	0
+phiX174:2790	0	0.00	0
+phiX174:2791	0	0.00	0
+phiX174:2792	0	0.00	0
+phiX174:2793	0	0.00	0
+phiX174:2794	0	0.00	0
+phiX174:2795	0	0.00	0
+phiX174:2796	0	0.00	0
+phiX174:2797	0	0.00	0
+phiX174:2798	0	0.00	0
+phiX174:2799	0	0.00	0
+phiX174:2800	0	0.00	0
+phiX174:2801	0	0.00	0
+phiX174:2802	0	0.00	0
+phiX174:2803	0	0.00	0
+phiX174:2804	0	0.00	0
+phiX174:2805	0	0.00	0
+phiX174:2806	0	0.00	0
+phiX174:2807	0	0.00	0
+phiX174:2808	0	0.00	0
+phiX174:2809	0	0.00	0
+phiX174:2810	0	0.00	0
+phiX174:2811	0	0.00	0
+phiX174:2812	0	0.00	0
+phiX174:2813	0	0.00	0
+phiX174:2814	0	0.00	0
+phiX174:2815	0	0.00	0
+phiX174:2816	0	0.00	0
+phiX174:2817	0	0.00	0
+phiX174:2818	0	0.00	0
+phiX174:2819	0	0.00	0
+phiX174:2820	0	0.00	0
+phiX174:2821	0	0.00	0
+phiX174:2822	0	0.00	0
+phiX174:2823	0	0.00	0
+phiX174:2824	0	0.00	0
+phiX174:2825	0	0.00	0
+phiX174:2826	0	0.00	0
+phiX174:2827	0	0.00	0
+phiX174:2828	0	0.00	0
+phiX174:2829	0	0.00	0
+phiX174:2830	0	0.00	0
+phiX174:2831	0	0.00	0
+phiX174:2832	0	0.00	0
+phiX174:2833	0	0.00	0
+phiX174:2834	0	0.00	0
+phiX174:2835	0	0.00	0
+phiX174:2836	0	0.00	0
+phiX174:2837	0	0.00	0
+phiX174:2838	0	0.00	0
+phiX174:2839	0	0.00	0
+phiX174:2840	0	0.00	0
+phiX174:2841	0	0.00	0
+phiX174:2842	0	0.00	0
+phiX174:2843	0	0.00	0
+phiX174:2844	0	0.00	0
+phiX174:2845	0	0.00	0
+phiX174:2846	0	0.00	0
+phiX174:2847	0	0.00	0
+phiX174:2848	0	0.00	0
+phiX174:2849	0	0.00	0
+phiX174:2850	0	0.00	0
+phiX174:2851	0	0.00	0
+phiX174:2852	0	0.00	0
+phiX174:2853	0	0.00	0
+phiX174:2854	0	0.00	0
+phiX174:2855	0	0.00	0
+phiX174:2856	0	0.00	0
+phiX174:2857	0	0.00	0
+phiX174:2858	0	0.00	0
+phiX174:2859	0	0.00	0
+phiX174:2860	0	0.00	0
+phiX174:2861	0	0.00	0
+phiX174:2862	0	0.00	0
+phiX174:2863	0	0.00	0
+phiX174:2864	0	0.00	0
+phiX174:2865	0	0.00	0
+phiX174:2866	0	0.00	0
+phiX174:2867	0	0.00	0
+phiX174:2868	0	0.00	0
+phiX174:2869	0	0.00	0
+phiX174:2870	0	0.00	0
+phiX174:2871	0	0.00	0
+phiX174:2872	0	0.00	0
+phiX174:2873	0	0.00	0
+phiX174:2874	0	0.00	0
+phiX174:2875	0	0.00	0
+phiX174:2876	0	0.00	0
+phiX174:2877	0	0.00	0
+phiX174:2878	0	0.00	0
+phiX174:2879	0	0.00	0
+phiX174:2880	0	0.00	0
+phiX174:2881	0	0.00	0
+phiX174:2882	0	0.00	0
+phiX174:2883	0	0.00	0
+phiX174:2884	0	0.00	0
+phiX174:2885	0	0.00	0
+phiX174:2886	0	0.00	0
+phiX174:2887	0	0.00	0
+phiX174:2888	0	0.00	0
+phiX174:2889	0	0.00	0
+phiX174:2890	0	0.00	0
+phiX174:2891	0	0.00	0
+phiX174:2892	0	0.00	0
+phiX174:2893	0	0.00	0
+phiX174:2894	0	0.00	0
+phiX174:2895	0	0.00	0
+phiX174:2896	0	0.00	0
+phiX174:2897	0	0.00	0
+phiX174:2898	0	0.00	0
+phiX174:2899	0	0.00	0
+phiX174:2900	0	0.00	0
+phiX174:2901	0	0.00	0
+phiX174:2902	0	0.00	0
+phiX174:2903	0	0.00	0
+phiX174:2904	0	0.00	0
+phiX174:2905	0	0.00	0
+phiX174:2906	0	0.00	0
+phiX174:2907	0	0.00	0
+phiX174:2908	0	0.00	0
+phiX174:2909	0	0.00	0
+phiX174:2910	0	0.00	0
+phiX174:2911	0	0.00	0
+phiX174:2912	0	0.00	0
+phiX174:2913	0	0.00	0
+phiX174:2914	0	0.00	0
+phiX174:2915	0	0.00	0
+phiX174:2916	0	0.00	0
+phiX174:2917	0	0.00	0
+phiX174:2918	0	0.00	0
+phiX174:2919	0	0.00	0
+phiX174:2920	0	0.00	0
+phiX174:2921	0	0.00	0
+phiX174:2922	0	0.00	0
+phiX174:2923	0	0.00	0
+phiX174:2924	0	0.00	0
+phiX174:2925	0	0.00	0
+phiX174:2926	0	0.00	0
+phiX174:2927	0	0.00	0
+phiX174:2928	0	0.00	0
+phiX174:2929	0	0.00	0
+phiX174:2930	0	0.00	0
+phiX174:2931	0	0.00	0
+phiX174:2932	0	0.00	0
+phiX174:2933	0	0.00	0
+phiX174:2934	0	0.00	0
+phiX174:2935	0	0.00	0
+phiX174:2936	0	0.00	0
+phiX174:2937	0	0.00	0
+phiX174:2938	0	0.00	0
+phiX174:2939	0	0.00	0
+phiX174:2940	0	0.00	0
+phiX174:2941	0	0.00	0
+phiX174:2942	0	0.00	0
+phiX174:2943	0	0.00	0
+phiX174:2944	0	0.00	0
+phiX174:2945	0	0.00	0
+phiX174:2946	0	0.00	0
+phiX174:2947	0	0.00	0
+phiX174:2948	0	0.00	0
+phiX174:2949	0	0.00	0
+phiX174:2950	0	0.00	0
+phiX174:2951	0	0.00	0
+phiX174:2952	0	0.00	0
+phiX174:2953	0	0.00	0
+phiX174:2954	0	0.00	0
+phiX174:2955	0	0.00	0
+phiX174:2956	0	0.00	0
+phiX174:2957	0	0.00	0
+phiX174:2958	0	0.00	0
+phiX174:2959	0	0.00	0
+phiX174:2960	0	0.00	0
+phiX174:2961	0	0.00	0
+phiX174:2962	0	0.00	0
+phiX174:2963	0	0.00	0
+phiX174:2964	0	0.00	0
+phiX174:2965	0	0.00	0
+phiX174:2966	0	0.00	0
+phiX174:2967	0	0.00	0
+phiX174:2968	0	0.00	0
+phiX174:2969	0	0.00	0
+phiX174:2970	0	0.00	0
+phiX174:2971	0	0.00	0
+phiX174:2972	0	0.00	0
+phiX174:2973	0	0.00	0
+phiX174:2974	0	0.00	0
+phiX174:2975	0	0.00	0
+phiX174:2976	0	0.00	0
+phiX174:2977	0	0.00	0
+phiX174:2978	0	0.00	0
+phiX174:2979	0	0.00	0
+phiX174:2980	0	0.00	0
+phiX174:2981	0	0.00	0
+phiX174:2982	0	0.00	0
+phiX174:2983	0	0.00	0
+phiX174:2984	0	0.00	0
+phiX174:2985	0	0.00	0
+phiX174:2986	0	0.00	0
+phiX174:2987	0	0.00	0
+phiX174:2988	0	0.00	0
+phiX174:2989	0	0.00	0
+phiX174:2990	0	0.00	0
+phiX174:2991	0	0.00	0
+phiX174:2992	0	0.00	0
+phiX174:2993	0	0.00	0
+phiX174:2994	0	0.00	0
+phiX174:2995	0	0.00	0
+phiX174:2996	0	0.00	0
+phiX174:2997	0	0.00	0
+phiX174:2998	0	0.00	0
+phiX174:2999	0	0.00	0
+phiX174:3000	0	0.00	0
+phiX174:3001	0	0.00	0
+phiX174:3002	0	0.00	0
+phiX174:3003	0	0.00	0
+phiX174:3004	0	0.00	0
+phiX174:3005	0	0.00	0
+phiX174:3006	0	0.00	0
+phiX174:3007	0	0.00	0
+phiX174:3008	0	0.00	0
+phiX174:3009	0	0.00	0
+phiX174:3010	0	0.00	0
+phiX174:3011	0	0.00	0
+phiX174:3012	0	0.00	0
+phiX174:3013	0	0.00	0
+phiX174:3014	0	0.00	0
+phiX174:3015	0	0.00	0
+phiX174:3016	0	0.00	0
+phiX174:3017	0	0.00	0
+phiX174:3018	0	0.00	0
+phiX174:3019	0	0.00	0
+phiX174:3020	0	0.00	0
+phiX174:3021	0	0.00	0
+phiX174:3022	0	0.00	0
+phiX174:3023	0	0.00	0
+phiX174:3024	0	0.00	0
+phiX174:3025	0	0.00	0
+phiX174:3026	0	0.00	0
+phiX174:3027	0	0.00	0
+phiX174:3028	0	0.00	0
+phiX174:3029	0	0.00	0
+phiX174:3030	0	0.00	0
+phiX174:3031	0	0.00	0
+phiX174:3032	0	0.00	0
+phiX174:3033	0	0.00	0
+phiX174:3034	0	0.00	0
+phiX174:3035	0	0.00	0
+phiX174:3036	0	0.00	0
+phiX174:3037	0	0.00	0
+phiX174:3038	0	0.00	0
+phiX174:3039	0	0.00	0
+phiX174:3040	0	0.00	0
+phiX174:3041	0	0.00	0
+phiX174:3042	0	0.00	0
+phiX174:3043	0	0.00	0
+phiX174:3044	0	0.00	0
+phiX174:3045	0	0.00	0
+phiX174:3046	0	0.00	0
+phiX174:3047	0	0.00	0
+phiX174:3048	0	0.00	0
+phiX174:3049	0	0.00	0
+phiX174:3050	0	0.00	0
+phiX174:3051	0	0.00	0
+phiX174:3052	0	0.00	0
+phiX174:3053	0	0.00	0
+phiX174:3054	0	0.00	0
+phiX174:3055	0	0.00	0
+phiX174:3056	0	0.00	0
+phiX174:3057	0	0.00	0
+phiX174:3058	0	0.00	0
+phiX174:3059	0	0.00	0
+phiX174:3060	0	0.00	0
+phiX174:3061	0	0.00	0
+phiX174:3062	0	0.00	0
+phiX174:3063	0	0.00	0
+phiX174:3064	0	0.00	0
+phiX174:3065	0	0.00	0
+phiX174:3066	0	0.00	0
+phiX174:3067	0	0.00	0
+phiX174:3068	0	0.00	0
+phiX174:3069	0	0.00	0
+phiX174:3070	0	0.00	0
+phiX174:3071	0	0.00	0
+phiX174:3072	0	0.00	0
+phiX174:3073	0	0.00	0
+phiX174:3074	0	0.00	0
+phiX174:3075	0	0.00	0
+phiX174:3076	0	0.00	0
+phiX174:3077	0	0.00	0
+phiX174:3078	0	0.00	0
+phiX174:3079	0	0.00	0
+phiX174:3080	0	0.00	0
+phiX174:3081	0	0.00	0
+phiX174:3082	0	0.00	0
+phiX174:3083	0	0.00	0
+phiX174:3084	0	0.00	0
+phiX174:3085	0	0.00	0
+phiX174:3086	0	0.00	0
+phiX174:3087	0	0.00	0
+phiX174:3088	0	0.00	0
+phiX174:3089	0	0.00	0
+phiX174:3090	0	0.00	0
+phiX174:3091	0	0.00	0
+phiX174:3092	0	0.00	0
+phiX174:3093	0	0.00	0
+phiX174:3094	0	0.00	0
+phiX174:3095	0	0.00	0
+phiX174:3096	0	0.00	0
+phiX174:3097	0	0.00	0
+phiX174:3098	0	0.00	0
+phiX174:3099	0	0.00	0
+phiX174:3100	0	0.00	0
+phiX174:3101	0	0.00	0
+phiX174:3102	0	0.00	0
+phiX174:3103	0	0.00	0
+phiX174:3104	0	0.00	0
+phiX174:3105	0	0.00	0
+phiX174:3106	0	0.00	0
+phiX174:3107	0	0.00	0
+phiX174:3108	0	0.00	0
+phiX174:3109	0	0.00	0
+phiX174:3110	0	0.00	0
+phiX174:3111	0	0.00	0
+phiX174:3112	0	0.00	0
+phiX174:3113	0	0.00	0
+phiX174:3114	0	0.00	0
+phiX174:3115	0	0.00	0
+phiX174:3116	0	0.00	0
+phiX174:3117	0	0.00	0
+phiX174:3118	0	0.00	0
+phiX174:3119	0	0.00	0
+phiX174:3120	0	0.00	0
+phiX174:3121	0	0.00	0
+phiX174:3122	0	0.00	0
+phiX174:3123	0	0.00	0
+phiX174:3124	0	0.00	0
+phiX174:3125	0	0.00	0
+phiX174:3126	0	0.00	0
+phiX174:3127	0	0.00	0
+phiX174:3128	0	0.00	0
+phiX174:3129	0	0.00	0
+phiX174:3130	0	0.00	0
+phiX174:3131	0	0.00	0
+phiX174:3132	0	0.00	0
+phiX174:3133	0	0.00	0
+phiX174:3134	0	0.00	0
+phiX174:3135	0	0.00	0
+phiX174:3136	0	0.00	0
+phiX174:3137	0	0.00	0
+phiX174:3138	0	0.00	0
+phiX174:3139	0	0.00	0
+phiX174:3140	0	0.00	0
+phiX174:3141	0	0.00	0
+phiX174:3142	0	0.00	0
+phiX174:3143	0	0.00	0
+phiX174:3144	0	0.00	0
+phiX174:3145	0	0.00	0
+phiX174:3146	0	0.00	0
+phiX174:3147	0	0.00	0
+phiX174:3148	0	0.00	0
+phiX174:3149	0	0.00	0
+phiX174:3150	0	0.00	0
+phiX174:3151	0	0.00	0
+phiX174:3152	0	0.00	0
+phiX174:3153	0	0.00	0
+phiX174:3154	0	0.00	0
+phiX174:3155	0	0.00	0
+phiX174:3156	0	0.00	0
+phiX174:3157	0	0.00	0
+phiX174:3158	0	0.00	0
+phiX174:3159	0	0.00	0
+phiX174:3160	0	0.00	0
+phiX174:3161	0	0.00	0
+phiX174:3162	0	0.00	0
+phiX174:3163	0	0.00	0
+phiX174:3164	0	0.00	0
+phiX174:3165	0	0.00	0
+phiX174:3166	0	0.00	0
+phiX174:3167	0	0.00	0
+phiX174:3168	0	0.00	0
+phiX174:3169	0	0.00	0
+phiX174:3170	0	0.00	0
+phiX174:3171	0	0.00	0
+phiX174:3172	0	0.00	0
+phiX174:3173	0	0.00	0
+phiX174:3174	0	0.00	0
+phiX174:3175	0	0.00	0
+phiX174:3176	0	0.00	0
+phiX174:3177	0	0.00	0
+phiX174:3178	0	0.00	0
+phiX174:3179	0	0.00	0
+phiX174:3180	0	0.00	0
+phiX174:3181	0	0.00	0
+phiX174:3182	0	0.00	0
+phiX174:3183	0	0.00	0
+phiX174:3184	0	0.00	0
+phiX174:3185	0	0.00	0
+phiX174:3186	0	0.00	0
+phiX174:3187	0	0.00	0
+phiX174:3188	0	0.00	0
+phiX174:3189	0	0.00	0
+phiX174:3190	0	0.00	0
+phiX174:3191	0	0.00	0
+phiX174:3192	0	0.00	0
+phiX174:3193	0	0.00	0
+phiX174:3194	0	0.00	0
+phiX174:3195	0	0.00	0
+phiX174:3196	0	0.00	0
+phiX174:3197	0	0.00	0
+phiX174:3198	0	0.00	0
+phiX174:3199	0	0.00	0
+phiX174:3200	0	0.00	0
+phiX174:3201	0	0.00	0
+phiX174:3202	0	0.00	0
+phiX174:3203	0	0.00	0
+phiX174:3204	0	0.00	0
+phiX174:3205	0	0.00	0
+phiX174:3206	0	0.00	0
+phiX174:3207	0	0.00	0
+phiX174:3208	0	0.00	0
+phiX174:3209	0	0.00	0
+phiX174:3210	0	0.00	0
+phiX174:3211	0	0.00	0
+phiX174:3212	0	0.00	0
+phiX174:3213	0	0.00	0
+phiX174:3214	0	0.00	0
+phiX174:3215	0	0.00	0
+phiX174:3216	0	0.00	0
+phiX174:3217	0	0.00	0
+phiX174:3218	0	0.00	0
+phiX174:3219	0	0.00	0
+phiX174:3220	0	0.00	0
+phiX174:3221	0	0.00	0
+phiX174:3222	0	0.00	0
+phiX174:3223	0	0.00	0
+phiX174:3224	0	0.00	0
+phiX174:3225	0	0.00	0
+phiX174:3226	0	0.00	0
+phiX174:3227	0	0.00	0
+phiX174:3228	0	0.00	0
+phiX174:3229	0	0.00	0
+phiX174:3230	0	0.00	0
+phiX174:3231	0	0.00	0
+phiX174:3232	0	0.00	0
+phiX174:3233	0	0.00	0
+phiX174:3234	0	0.00	0
+phiX174:3235	0	0.00	0
+phiX174:3236	0	0.00	0
+phiX174:3237	0	0.00	0
+phiX174:3238	0	0.00	0
+phiX174:3239	0	0.00	0
+phiX174:3240	0	0.00	0
+phiX174:3241	0	0.00	0
+phiX174:3242	0	0.00	0
+phiX174:3243	0	0.00	0
+phiX174:3244	0	0.00	0
+phiX174:3245	0	0.00	0
+phiX174:3246	0	0.00	0
+phiX174:3247	0	0.00	0
+phiX174:3248	0	0.00	0
+phiX174:3249	0	0.00	0
+phiX174:3250	0	0.00	0
+phiX174:3251	0	0.00	0
+phiX174:3252	0	0.00	0
+phiX174:3253	0	0.00	0
+phiX174:3254	0	0.00	0
+phiX174:3255	0	0.00	0
+phiX174:3256	0	0.00	0
+phiX174:3257	0	0.00	0
+phiX174:3258	0	0.00	0
+phiX174:3259	0	0.00	0
+phiX174:3260	0	0.00	0
+phiX174:3261	0	0.00	0
+phiX174:3262	0	0.00	0
+phiX174:3263	0	0.00	0
+phiX174:3264	0	0.00	0
+phiX174:3265	0	0.00	0
+phiX174:3266	0	0.00	0
+phiX174:3267	0	0.00	0
+phiX174:3268	0	0.00	0
+phiX174:3269	0	0.00	0
+phiX174:3270	0	0.00	0
+phiX174:3271	0	0.00	0
+phiX174:3272	0	0.00	0
+phiX174:3273	0	0.00	0
+phiX174:3274	0	0.00	0
+phiX174:3275	0	0.00	0
+phiX174:3276	0	0.00	0
+phiX174:3277	0	0.00	0
+phiX174:3278	0	0.00	0
+phiX174:3279	0	0.00	0
+phiX174:3280	0	0.00	0
+phiX174:3281	0	0.00	0
+phiX174:3282	0	0.00	0
+phiX174:3283	0	0.00	0
+phiX174:3284	0	0.00	0
+phiX174:3285	0	0.00	0
+phiX174:3286	0	0.00	0
+phiX174:3287	0	0.00	0
+phiX174:3288	0	0.00	0
+phiX174:3289	0	0.00	0
+phiX174:3290	0	0.00	0
+phiX174:3291	0	0.00	0
+phiX174:3292	0	0.00	0
+phiX174:3293	0	0.00	0
+phiX174:3294	0	0.00	0
+phiX174:3295	0	0.00	0
+phiX174:3296	0	0.00	0
+phiX174:3297	0	0.00	0
+phiX174:3298	0	0.00	0
+phiX174:3299	0	0.00	0
+phiX174:3300	0	0.00	0
+phiX174:3301	0	0.00	0
+phiX174:3302	0	0.00	0
+phiX174:3303	0	0.00	0
+phiX174:3304	0	0.00	0
+phiX174:3305	0	0.00	0
+phiX174:3306	0	0.00	0
+phiX174:3307	0	0.00	0
+phiX174:3308	0	0.00	0
+phiX174:3309	0	0.00	0
+phiX174:3310	0	0.00	0
+phiX174:3311	0	0.00	0
+phiX174:3312	0	0.00	0
+phiX174:3313	0	0.00	0
+phiX174:3314	0	0.00	0
+phiX174:3315	0	0.00	0
+phiX174:3316	0	0.00	0
+phiX174:3317	0	0.00	0
+phiX174:3318	0	0.00	0
+phiX174:3319	0	0.00	0
+phiX174:3320	0	0.00	0
+phiX174:3321	0	0.00	0
+phiX174:3322	0	0.00	0
+phiX174:3323	0	0.00	0
+phiX174:3324	0	0.00	0
+phiX174:3325	0	0.00	0
+phiX174:3326	0	0.00	0
+phiX174:3327	0	0.00	0
+phiX174:3328	0	0.00	0
+phiX174:3329	0	0.00	0
+phiX174:3330	0	0.00	0
+phiX174:3331	0	0.00	0
+phiX174:3332	0	0.00	0
+phiX174:3333	0	0.00	0
+phiX174:3334	0	0.00	0
+phiX174:3335	0	0.00	0
+phiX174:3336	0	0.00	0
+phiX174:3337	0	0.00	0
+phiX174:3338	0	0.00	0
+phiX174:3339	0	0.00	0
+phiX174:3340	0	0.00	0
+phiX174:3341	0	0.00	0
+phiX174:3342	0	0.00	0
+phiX174:3343	0	0.00	0
+phiX174:3344	0	0.00	0
+phiX174:3345	0	0.00	0
+phiX174:3346	0	0.00	0
+phiX174:3347	0	0.00	0
+phiX174:3348	0	0.00	0
+phiX174:3349	0	0.00	0
+phiX174:3350	0	0.00	0
+phiX174:3351	0	0.00	0
+phiX174:3352	0	0.00	0
+phiX174:3353	0	0.00	0
+phiX174:3354	0	0.00	0
+phiX174:3355	0	0.00	0
+phiX174:3356	0	0.00	0
+phiX174:3357	0	0.00	0
+phiX174:3358	0	0.00	0
+phiX174:3359	0	0.00	0
+phiX174:3360	0	0.00	0
+phiX174:3361	0	0.00	0
+phiX174:3362	0	0.00	0
+phiX174:3363	0	0.00	0
+phiX174:3364	0	0.00	0
+phiX174:3365	0	0.00	0
+phiX174:3366	0	0.00	0
+phiX174:3367	0	0.00	0
+phiX174:3368	0	0.00	0
+phiX174:3369	0	0.00	0
+phiX174:3370	0	0.00	0
+phiX174:3371	0	0.00	0
+phiX174:3372	0	0.00	0
+phiX174:3373	0	0.00	0
+phiX174:3374	0	0.00	0
+phiX174:3375	0	0.00	0
+phiX174:3376	0	0.00	0
+phiX174:3377	0	0.00	0
+phiX174:3378	0	0.00	0
+phiX174:3379	0	0.00	0
+phiX174:3380	0	0.00	0
+phiX174:3381	0	0.00	0
+phiX174:3382	0	0.00	0
+phiX174:3383	0	0.00	0
+phiX174:3384	0	0.00	0
+phiX174:3385	0	0.00	0
+phiX174:3386	0	0.00	0
+phiX174:3387	0	0.00	0
+phiX174:3388	0	0.00	0
+phiX174:3389	0	0.00	0
+phiX174:3390	0	0.00	0
+phiX174:3391	0	0.00	0
+phiX174:3392	0	0.00	0
+phiX174:3393	0	0.00	0
+phiX174:3394	0	0.00	0
+phiX174:3395	0	0.00	0
+phiX174:3396	0	0.00	0
+phiX174:3397	0	0.00	0
+phiX174:3398	0	0.00	0
+phiX174:3399	0	0.00	0
+phiX174:3400	0	0.00	0
+phiX174:3401	0	0.00	0
+phiX174:3402	0	0.00	0
+phiX174:3403	0	0.00	0
+phiX174:3404	0	0.00	0
+phiX174:3405	0	0.00	0
+phiX174:3406	0	0.00	0
+phiX174:3407	0	0.00	0
+phiX174:3408	0	0.00	0
+phiX174:3409	0	0.00	0
+phiX174:3410	0	0.00	0
+phiX174:3411	0	0.00	0
+phiX174:3412	0	0.00	0
+phiX174:3413	0	0.00	0
+phiX174:3414	0	0.00	0
+phiX174:3415	0	0.00	0
+phiX174:3416	0	0.00	0
+phiX174:3417	0	0.00	0
+phiX174:3418	0	0.00	0
+phiX174:3419	0	0.00	0
+phiX174:3420	0	0.00	0
+phiX174:3421	0	0.00	0
+phiX174:3422	0	0.00	0
+phiX174:3423	0	0.00	0
+phiX174:3424	0	0.00	0
+phiX174:3425	0	0.00	0
+phiX174:3426	0	0.00	0
+phiX174:3427	0	0.00	0
+phiX174:3428	0	0.00	0
+phiX174:3429	0	0.00	0
+phiX174:3430	0	0.00	0
+phiX174:3431	0	0.00	0
+phiX174:3432	0	0.00	0
+phiX174:3433	0	0.00	0
+phiX174:3434	0	0.00	0
+phiX174:3435	0	0.00	0
+phiX174:3436	0	0.00	0
+phiX174:3437	0	0.00	0
+phiX174:3438	0	0.00	0
+phiX174:3439	0	0.00	0
+phiX174:3440	0	0.00	0
+phiX174:3441	0	0.00	0
+phiX174:3442	0	0.00	0
+phiX174:3443	0	0.00	0
+phiX174:3444	0	0.00	0
+phiX174:3445	0	0.00	0
+phiX174:3446	0	0.00	0
+phiX174:3447	0	0.00	0
+phiX174:3448	0	0.00	0
+phiX174:3449	0	0.00	0
+phiX174:3450	0	0.00	0
+phiX174:3451	0	0.00	0
+phiX174:3452	0	0.00	0
+phiX174:3453	0	0.00	0
+phiX174:3454	0	0.00	0
+phiX174:3455	0	0.00	0
+phiX174:3456	0	0.00	0
+phiX174:3457	0	0.00	0
+phiX174:3458	0	0.00	0
+phiX174:3459	0	0.00	0
+phiX174:3460	0	0.00	0
+phiX174:3461	0	0.00	0
+phiX174:3462	0	0.00	0
+phiX174:3463	0	0.00	0
+phiX174:3464	0	0.00	0
+phiX174:3465	0	0.00	0
+phiX174:3466	0	0.00	0
+phiX174:3467	0	0.00	0
+phiX174:3468	0	0.00	0
+phiX174:3469	0	0.00	0
+phiX174:3470	0	0.00	0
+phiX174:3471	0	0.00	0
+phiX174:3472	0	0.00	0
+phiX174:3473	0	0.00	0
+phiX174:3474	0	0.00	0
+phiX174:3475	0	0.00	0
+phiX174:3476	0	0.00	0
+phiX174:3477	0	0.00	0
+phiX174:3478	0	0.00	0
+phiX174:3479	0	0.00	0
+phiX174:3480	0	0.00	0
+phiX174:3481	0	0.00	0
+phiX174:3482	0	0.00	0
+phiX174:3483	0	0.00	0
+phiX174:3484	0	0.00	0
+phiX174:3485	0	0.00	0
+phiX174:3486	0	0.00	0
+phiX174:3487	0	0.00	0
+phiX174:3488	0	0.00	0
+phiX174:3489	0	0.00	0
+phiX174:3490	0	0.00	0
+phiX174:3491	0	0.00	0
+phiX174:3492	0	0.00	0
+phiX174:3493	0	0.00	0
+phiX174:3494	0	0.00	0
+phiX174:3495	0	0.00	0
+phiX174:3496	0	0.00	0
+phiX174:3497	0	0.00	0
+phiX174:3498	0	0.00	0
+phiX174:3499	0	0.00	0
+phiX174:3500	0	0.00	0
+phiX174:3501	0	0.00	0
+phiX174:3502	0	0.00	0
+phiX174:3503	0	0.00	0
+phiX174:3504	0	0.00	0
+phiX174:3505	0	0.00	0
+phiX174:3506	0	0.00	0
+phiX174:3507	0	0.00	0
+phiX174:3508	0	0.00	0
+phiX174:3509	0	0.00	0
+phiX174:3510	0	0.00	0
+phiX174:3511	0	0.00	0
+phiX174:3512	0	0.00	0
+phiX174:3513	0	0.00	0
+phiX174:3514	0	0.00	0
+phiX174:3515	0	0.00	0
+phiX174:3516	0	0.00	0
+phiX174:3517	0	0.00	0
+phiX174:3518	0	0.00	0
+phiX174:3519	0	0.00	0
+phiX174:3520	0	0.00	0
+phiX174:3521	0	0.00	0
+phiX174:3522	0	0.00	0
+phiX174:3523	0	0.00	0
+phiX174:3524	0	0.00	0
+phiX174:3525	0	0.00	0
+phiX174:3526	0	0.00	0
+phiX174:3527	0	0.00	0
+phiX174:3528	0	0.00	0
+phiX174:3529	0	0.00	0
+phiX174:3530	0	0.00	0
+phiX174:3531	0	0.00	0
+phiX174:3532	0	0.00	0
+phiX174:3533	0	0.00	0
+phiX174:3534	0	0.00	0
+phiX174:3535	0	0.00	0
+phiX174:3536	0	0.00	0
+phiX174:3537	0	0.00	0
+phiX174:3538	0	0.00	0
+phiX174:3539	0	0.00	0
+phiX174:3540	0	0.00	0
+phiX174:3541	0	0.00	0
+phiX174:3542	0	0.00	0
+phiX174:3543	0	0.00	0
+phiX174:3544	0	0.00	0
+phiX174:3545	0	0.00	0
+phiX174:3546	0	0.00	0
+phiX174:3547	0	0.00	0
+phiX174:3548	0	0.00	0
+phiX174:3549	0	0.00	0
+phiX174:3550	0	0.00	0
+phiX174:3551	0	0.00	0
+phiX174:3552	0	0.00	0
+phiX174:3553	0	0.00	0
+phiX174:3554	0	0.00	0
+phiX174:3555	0	0.00	0
+phiX174:3556	0	0.00	0
+phiX174:3557	0	0.00	0
+phiX174:3558	0	0.00	0
+phiX174:3559	0	0.00	0
+phiX174:3560	0	0.00	0
+phiX174:3561	0	0.00	0
+phiX174:3562	0	0.00	0
+phiX174:3563	0	0.00	0
+phiX174:3564	0	0.00	0
+phiX174:3565	0	0.00	0
+phiX174:3566	0	0.00	0
+phiX174:3567	0	0.00	0
+phiX174:3568	0	0.00	0
+phiX174:3569	0	0.00	0
+phiX174:3570	0	0.00	0
+phiX174:3571	0	0.00	0
+phiX174:3572	0	0.00	0
+phiX174:3573	0	0.00	0
+phiX174:3574	0	0.00	0
+phiX174:3575	0	0.00	0
+phiX174:3576	0	0.00	0
+phiX174:3577	0	0.00	0
+phiX174:3578	0	0.00	0
+phiX174:3579	0	0.00	0
+phiX174:3580	0	0.00	0
+phiX174:3581	0	0.00	0
+phiX174:3582	0	0.00	0
+phiX174:3583	0	0.00	0
+phiX174:3584	0	0.00	0
+phiX174:3585	0	0.00	0
+phiX174:3586	0	0.00	0
+phiX174:3587	0	0.00	0
+phiX174:3588	0	0.00	0
+phiX174:3589	0	0.00	0
+phiX174:3590	0	0.00	0
+phiX174:3591	0	0.00	0
+phiX174:3592	0	0.00	0
+phiX174:3593	0	0.00	0
+phiX174:3594	0	0.00	0
+phiX174:3595	0	0.00	0
+phiX174:3596	0	0.00	0
+phiX174:3597	0	0.00	0
+phiX174:3598	0	0.00	0
+phiX174:3599	0	0.00	0
+phiX174:3600	0	0.00	0
+phiX174:3601	0	0.00	0
+phiX174:3602	0	0.00	0
+phiX174:3603	0	0.00	0
+phiX174:3604	0	0.00	0
+phiX174:3605	0	0.00	0
+phiX174:3606	0	0.00	0
+phiX174:3607	0	0.00	0
+phiX174:3608	0	0.00	0
+phiX174:3609	0	0.00	0
+phiX174:3610	0	0.00	0
+phiX174:3611	0	0.00	0
+phiX174:3612	0	0.00	0
+phiX174:3613	0	0.00	0
+phiX174:3614	0	0.00	0
+phiX174:3615	0	0.00	0
+phiX174:3616	0	0.00	0
+phiX174:3617	0	0.00	0
+phiX174:3618	0	0.00	0
+phiX174:3619	0	0.00	0
+phiX174:3620	0	0.00	0
+phiX174:3621	0	0.00	0
+phiX174:3622	0	0.00	0
+phiX174:3623	0	0.00	0
+phiX174:3624	0	0.00	0
+phiX174:3625	0	0.00	0
+phiX174:3626	0	0.00	0
+phiX174:3627	0	0.00	0
+phiX174:3628	0	0.00	0
+phiX174:3629	0	0.00	0
+phiX174:3630	0	0.00	0
+phiX174:3631	0	0.00	0
+phiX174:3632	0	0.00	0
+phiX174:3633	0	0.00	0
+phiX174:3634	0	0.00	0
+phiX174:3635	0	0.00	0
+phiX174:3636	0	0.00	0
+phiX174:3637	0	0.00	0
+phiX174:3638	0	0.00	0
+phiX174:3639	0	0.00	0
+phiX174:3640	0	0.00	0
+phiX174:3641	0	0.00	0
+phiX174:3642	0	0.00	0
+phiX174:3643	0	0.00	0
+phiX174:3644	0	0.00	0
+phiX174:3645	0	0.00	0
+phiX174:3646	0	0.00	0
+phiX174:3647	0	0.00	0
+phiX174:3648	0	0.00	0
+phiX174:3649	0	0.00	0
+phiX174:3650	0	0.00	0
+phiX174:3651	0	0.00	0
+phiX174:3652	0	0.00	0
+phiX174:3653	0	0.00	0
+phiX174:3654	0	0.00	0
+phiX174:3655	0	0.00	0
+phiX174:3656	0	0.00	0
+phiX174:3657	0	0.00	0
+phiX174:3658	0	0.00	0
+phiX174:3659	0	0.00	0
+phiX174:3660	0	0.00	0
+phiX174:3661	0	0.00	0
+phiX174:3662	0	0.00	0
+phiX174:3663	0	0.00	0
+phiX174:3664	0	0.00	0
+phiX174:3665	0	0.00	0
+phiX174:3666	0	0.00	0
+phiX174:3667	0	0.00	0
+phiX174:3668	0	0.00	0
+phiX174:3669	0	0.00	0
+phiX174:3670	0	0.00	0
+phiX174:3671	0	0.00	0
+phiX174:3672	0	0.00	0
+phiX174:3673	0	0.00	0
+phiX174:3674	0	0.00	0
+phiX174:3675	0	0.00	0
+phiX174:3676	0	0.00	0
+phiX174:3677	0	0.00	0
+phiX174:3678	0	0.00	0
+phiX174:3679	0	0.00	0
+phiX174:3680	0	0.00	0
+phiX174:3681	0	0.00	0
+phiX174:3682	0	0.00	0
+phiX174:3683	0	0.00	0
+phiX174:3684	0	0.00	0
+phiX174:3685	0	0.00	0
+phiX174:3686	0	0.00	0
+phiX174:3687	0	0.00	0
+phiX174:3688	0	0.00	0
+phiX174:3689	0	0.00	0
+phiX174:3690	0	0.00	0
+phiX174:3691	0	0.00	0
+phiX174:3692	0	0.00	0
+phiX174:3693	0	0.00	0
+phiX174:3694	0	0.00	0
+phiX174:3695	0	0.00	0
+phiX174:3696	0	0.00	0
+phiX174:3697	0	0.00	0
+phiX174:3698	0	0.00	0
+phiX174:3699	0	0.00	0
+phiX174:3700	0	0.00	0
+phiX174:3701	0	0.00	0
+phiX174:3702	0	0.00	0
+phiX174:3703	0	0.00	0
+phiX174:3704	0	0.00	0
+phiX174:3705	0	0.00	0
+phiX174:3706	0	0.00	0
+phiX174:3707	0	0.00	0
+phiX174:3708	0	0.00	0
+phiX174:3709	0	0.00	0
+phiX174:3710	0	0.00	0
+phiX174:3711	0	0.00	0
+phiX174:3712	0	0.00	0
+phiX174:3713	0	0.00	0
+phiX174:3714	0	0.00	0
+phiX174:3715	0	0.00	0
+phiX174:3716	0	0.00	0
+phiX174:3717	0	0.00	0
+phiX174:3718	0	0.00	0
+phiX174:3719	0	0.00	0
+phiX174:3720	0	0.00	0
+phiX174:3721	0	0.00	0
+phiX174:3722	0	0.00	0
+phiX174:3723	0	0.00	0
+phiX174:3724	0	0.00	0
+phiX174:3725	0	0.00	0
+phiX174:3726	0	0.00	0
+phiX174:3727	0	0.00	0
+phiX174:3728	0	0.00	0
+phiX174:3729	0	0.00	0
+phiX174:3730	0	0.00	0
+phiX174:3731	0	0.00	0
+phiX174:3732	0	0.00	0
+phiX174:3733	0	0.00	0
+phiX174:3734	0	0.00	0
+phiX174:3735	0	0.00	0
+phiX174:3736	0	0.00	0
+phiX174:3737	0	0.00	0
+phiX174:3738	0	0.00	0
+phiX174:3739	0	0.00	0
+phiX174:3740	0	0.00	0
+phiX174:3741	0	0.00	0
+phiX174:3742	0	0.00	0
+phiX174:3743	0	0.00	0
+phiX174:3744	0	0.00	0
+phiX174:3745	0	0.00	0
+phiX174:3746	0	0.00	0
+phiX174:3747	0	0.00	0
+phiX174:3748	0	0.00	0
+phiX174:3749	0	0.00	0
+phiX174:3750	0	0.00	0
+phiX174:3751	0	0.00	0
+phiX174:3752	0	0.00	0
+phiX174:3753	0	0.00	0
+phiX174:3754	0	0.00	0
+phiX174:3755	0	0.00	0
+phiX174:3756	0	0.00	0
+phiX174:3757	0	0.00	0
+phiX174:3758	0	0.00	0
+phiX174:3759	0	0.00	0
+phiX174:3760	0	0.00	0
+phiX174:3761	0	0.00	0
+phiX174:3762	0	0.00	0
+phiX174:3763	0	0.00	0
+phiX174:3764	0	0.00	0
+phiX174:3765	0	0.00	0
+phiX174:3766	0	0.00	0
+phiX174:3767	0	0.00	0
+phiX174:3768	0	0.00	0
+phiX174:3769	0	0.00	0
+phiX174:3770	0	0.00	0
+phiX174:3771	0	0.00	0
+phiX174:3772	0	0.00	0
+phiX174:3773	0	0.00	0
+phiX174:3774	0	0.00	0
+phiX174:3775	0	0.00	0
+phiX174:3776	0	0.00	0
+phiX174:3777	0	0.00	0
+phiX174:3778	0	0.00	0
+phiX174:3779	0	0.00	0
+phiX174:3780	0	0.00	0
+phiX174:3781	0	0.00	0
+phiX174:3782	0	0.00	0
+phiX174:3783	0	0.00	0
+phiX174:3784	0	0.00	0
+phiX174:3785	0	0.00	0
+phiX174:3786	0	0.00	0
+phiX174:3787	0	0.00	0
+phiX174:3788	0	0.00	0
+phiX174:3789	0	0.00	0
+phiX174:3790	0	0.00	0
+phiX174:3791	0	0.00	0
+phiX174:3792	0	0.00	0
+phiX174:3793	0	0.00	0
+phiX174:3794	0	0.00	0
+phiX174:3795	0	0.00	0
+phiX174:3796	0	0.00	0
+phiX174:3797	0	0.00	0
+phiX174:3798	0	0.00	0
+phiX174:3799	0	0.00	0
+phiX174:3800	0	0.00	0
+phiX174:3801	0	0.00	0
+phiX174:3802	0	0.00	0
+phiX174:3803	0	0.00	0
+phiX174:3804	0	0.00	0
+phiX174:3805	0	0.00	0
+phiX174:3806	0	0.00	0
+phiX174:3807	0	0.00	0
+phiX174:3808	0	0.00	0
+phiX174:3809	0	0.00	0
+phiX174:3810	0	0.00	0
+phiX174:3811	0	0.00	0
+phiX174:3812	0	0.00	0
+phiX174:3813	0	0.00	0
+phiX174:3814	0	0.00	0
+phiX174:3815	0	0.00	0
+phiX174:3816	0	0.00	0
+phiX174:3817	0	0.00	0
+phiX174:3818	0	0.00	0
+phiX174:3819	0	0.00	0
+phiX174:3820	0	0.00	0
+phiX174:3821	0	0.00	0
+phiX174:3822	0	0.00	0
+phiX174:3823	0	0.00	0
+phiX174:3824	0	0.00	0
+phiX174:3825	0	0.00	0
+phiX174:3826	0	0.00	0
+phiX174:3827	0	0.00	0
+phiX174:3828	0	0.00	0
+phiX174:3829	0	0.00	0
+phiX174:3830	0	0.00	0
+phiX174:3831	0	0.00	0
+phiX174:3832	0	0.00	0
+phiX174:3833	0	0.00	0
+phiX174:3834	0	0.00	0
+phiX174:3835	0	0.00	0
+phiX174:3836	0	0.00	0
+phiX174:3837	0	0.00	0
+phiX174:3838	0	0.00	0
+phiX174:3839	0	0.00	0
+phiX174:3840	0	0.00	0
+phiX174:3841	0	0.00	0
+phiX174:3842	0	0.00	0
+phiX174:3843	0	0.00	0
+phiX174:3844	0	0.00	0
+phiX174:3845	0	0.00	0
+phiX174:3846	0	0.00	0
+phiX174:3847	0	0.00	0
+phiX174:3848	0	0.00	0
+phiX174:3849	0	0.00	0
+phiX174:3850	0	0.00	0
+phiX174:3851	0	0.00	0
+phiX174:3852	0	0.00	0
+phiX174:3853	0	0.00	0
+phiX174:3854	0	0.00	0
+phiX174:3855	0	0.00	0
+phiX174:3856	0	0.00	0
+phiX174:3857	0	0.00	0
+phiX174:3858	0	0.00	0
+phiX174:3859	0	0.00	0
+phiX174:3860	0	0.00	0
+phiX174:3861	0	0.00	0
+phiX174:3862	0	0.00	0
+phiX174:3863	0	0.00	0
+phiX174:3864	0	0.00	0
+phiX174:3865	0	0.00	0
+phiX174:3866	0	0.00	0
+phiX174:3867	0	0.00	0
+phiX174:3868	0	0.00	0
+phiX174:3869	0	0.00	0
+phiX174:3870	0	0.00	0
+phiX174:3871	0	0.00	0
+phiX174:3872	0	0.00	0
+phiX174:3873	0	0.00	0
+phiX174:3874	0	0.00	0
+phiX174:3875	0	0.00	0
+phiX174:3876	0	0.00	0
+phiX174:3877	0	0.00	0
+phiX174:3878	0	0.00	0
+phiX174:3879	0	0.00	0
+phiX174:3880	0	0.00	0
+phiX174:3881	0	0.00	0
+phiX174:3882	0	0.00	0
+phiX174:3883	0	0.00	0
+phiX174:3884	0	0.00	0
+phiX174:3885	0	0.00	0
+phiX174:3886	0	0.00	0
+phiX174:3887	0	0.00	0
+phiX174:3888	0	0.00	0
+phiX174:3889	0	0.00	0
+phiX174:3890	0	0.00	0
+phiX174:3891	0	0.00	0
+phiX174:3892	0	0.00	0
+phiX174:3893	0	0.00	0
+phiX174:3894	0	0.00	0
+phiX174:3895	0	0.00	0
+phiX174:3896	0	0.00	0
+phiX174:3897	0	0.00	0
+phiX174:3898	0	0.00	0
+phiX174:3899	0	0.00	0
+phiX174:3900	0	0.00	0
+phiX174:3901	0	0.00	0
+phiX174:3902	0	0.00	0
+phiX174:3903	0	0.00	0
+phiX174:3904	0	0.00	0
+phiX174:3905	0	0.00	0
+phiX174:3906	0	0.00	0
+phiX174:3907	0	0.00	0
+phiX174:3908	0	0.00	0
+phiX174:3909	0	0.00	0
+phiX174:3910	0	0.00	0
+phiX174:3911	0	0.00	0
+phiX174:3912	0	0.00	0
+phiX174:3913	0	0.00	0
+phiX174:3914	0	0.00	0
+phiX174:3915	0	0.00	0
+phiX174:3916	0	0.00	0
+phiX174:3917	0	0.00	0
+phiX174:3918	0	0.00	0
+phiX174:3919	0	0.00	0
+phiX174:3920	0	0.00	0
+phiX174:3921	0	0.00	0
+phiX174:3922	0	0.00	0
+phiX174:3923	0	0.00	0
+phiX174:3924	0	0.00	0
+phiX174:3925	0	0.00	0
+phiX174:3926	0	0.00	0
+phiX174:3927	0	0.00	0
+phiX174:3928	0	0.00	0
+phiX174:3929	0	0.00	0
+phiX174:3930	0	0.00	0
+phiX174:3931	0	0.00	0
+phiX174:3932	0	0.00	0
+phiX174:3933	0	0.00	0
+phiX174:3934	0	0.00	0
+phiX174:3935	0	0.00	0
+phiX174:3936	0	0.00	0
+phiX174:3937	0	0.00	0
+phiX174:3938	0	0.00	0
+phiX174:3939	0	0.00	0
+phiX174:3940	0	0.00	0
+phiX174:3941	0	0.00	0
+phiX174:3942	0	0.00	0
+phiX174:3943	0	0.00	0
+phiX174:3944	0	0.00	0
+phiX174:3945	0	0.00	0
+phiX174:3946	0	0.00	0
+phiX174:3947	0	0.00	0
+phiX174:3948	0	0.00	0
+phiX174:3949	0	0.00	0
+phiX174:3950	0	0.00	0
+phiX174:3951	0	0.00	0
+phiX174:3952	0	0.00	0
+phiX174:3953	0	0.00	0
+phiX174:3954	0	0.00	0
+phiX174:3955	0	0.00	0
+phiX174:3956	0	0.00	0
+phiX174:3957	0	0.00	0
+phiX174:3958	0	0.00	0
+phiX174:3959	0	0.00	0
+phiX174:3960	0	0.00	0
+phiX174:3961	0	0.00	0
+phiX174:3962	0	0.00	0
+phiX174:3963	0	0.00	0
+phiX174:3964	0	0.00	0
+phiX174:3965	0	0.00	0
+phiX174:3966	0	0.00	0
+phiX174:3967	0	0.00	0
+phiX174:3968	0	0.00	0
+phiX174:3969	0	0.00	0
+phiX174:3970	0	0.00	0
+phiX174:3971	0	0.00	0
+phiX174:3972	0	0.00	0
+phiX174:3973	0	0.00	0
+phiX174:3974	0	0.00	0
+phiX174:3975	0	0.00	0
+phiX174:3976	0	0.00	0
+phiX174:3977	0	0.00	0
+phiX174:3978	0	0.00	0
+phiX174:3979	0	0.00	0
+phiX174:3980	0	0.00	0
+phiX174:3981	0	0.00	0
+phiX174:3982	0	0.00	0
+phiX174:3983	0	0.00	0
+phiX174:3984	0	0.00	0
+phiX174:3985	0	0.00	0
+phiX174:3986	0	0.00	0
+phiX174:3987	0	0.00	0
+phiX174:3988	0	0.00	0
+phiX174:3989	0	0.00	0
+phiX174:3990	0	0.00	0
+phiX174:3991	0	0.00	0
+phiX174:3992	0	0.00	0
+phiX174:3993	0	0.00	0
+phiX174:3994	0	0.00	0
+phiX174:3995	0	0.00	0
+phiX174:3996	0	0.00	0
+phiX174:3997	0	0.00	0
+phiX174:3998	0	0.00	0
+phiX174:3999	0	0.00	0
+phiX174:4000	0	0.00	0
+phiX174:4001	0	0.00	0
+phiX174:4002	0	0.00	0
+phiX174:4003	0	0.00	0
+phiX174:4004	0	0.00	0
+phiX174:4005	0	0.00	0
+phiX174:4006	0	0.00	0
+phiX174:4007	0	0.00	0
+phiX174:4008	0	0.00	0
+phiX174:4009	0	0.00	0
+phiX174:4010	0	0.00	0
+phiX174:4011	0	0.00	0
+phiX174:4012	0	0.00	0
+phiX174:4013	0	0.00	0
+phiX174:4014	0	0.00	0
+phiX174:4015	0	0.00	0
+phiX174:4016	0	0.00	0
+phiX174:4017	0	0.00	0
+phiX174:4018	0	0.00	0
+phiX174:4019	0	0.00	0
+phiX174:4020	0	0.00	0
+phiX174:4021	0	0.00	0
+phiX174:4022	0	0.00	0
+phiX174:4023	0	0.00	0
+phiX174:4024	0	0.00	0
+phiX174:4025	0	0.00	0
+phiX174:4026	0	0.00	0
+phiX174:4027	0	0.00	0
+phiX174:4028	0	0.00	0
+phiX174:4029	0	0.00	0
+phiX174:4030	0	0.00	0
+phiX174:4031	0	0.00	0
+phiX174:4032	0	0.00	0
+phiX174:4033	0	0.00	0
+phiX174:4034	0	0.00	0
+phiX174:4035	0	0.00	0
+phiX174:4036	0	0.00	0
+phiX174:4037	0	0.00	0
+phiX174:4038	0	0.00	0
+phiX174:4039	0	0.00	0
+phiX174:4040	0	0.00	0
+phiX174:4041	0	0.00	0
+phiX174:4042	0	0.00	0
+phiX174:4043	0	0.00	0
+phiX174:4044	0	0.00	0
+phiX174:4045	0	0.00	0
+phiX174:4046	0	0.00	0
+phiX174:4047	0	0.00	0
+phiX174:4048	0	0.00	0
+phiX174:4049	0	0.00	0
+phiX174:4050	0	0.00	0
+phiX174:4051	0	0.00	0
+phiX174:4052	0	0.00	0
+phiX174:4053	0	0.00	0
+phiX174:4054	0	0.00	0
+phiX174:4055	0	0.00	0
+phiX174:4056	0	0.00	0
+phiX174:4057	0	0.00	0
+phiX174:4058	0	0.00	0
+phiX174:4059	0	0.00	0
+phiX174:4060	0	0.00	0
+phiX174:4061	0	0.00	0
+phiX174:4062	0	0.00	0
+phiX174:4063	0	0.00	0
+phiX174:4064	0	0.00	0
+phiX174:4065	0	0.00	0
+phiX174:4066	0	0.00	0
+phiX174:4067	0	0.00	0
+phiX174:4068	0	0.00	0
+phiX174:4069	0	0.00	0
+phiX174:4070	0	0.00	0
+phiX174:4071	0	0.00	0
+phiX174:4072	0	0.00	0
+phiX174:4073	0	0.00	0
+phiX174:4074	0	0.00	0
+phiX174:4075	0	0.00	0
+phiX174:4076	0	0.00	0
+phiX174:4077	0	0.00	0
+phiX174:4078	0	0.00	0
+phiX174:4079	0	0.00	0
+phiX174:4080	0	0.00	0
+phiX174:4081	0	0.00	0
+phiX174:4082	0	0.00	0
+phiX174:4083	0	0.00	0
+phiX174:4084	0	0.00	0
+phiX174:4085	0	0.00	0
+phiX174:4086	0	0.00	0
+phiX174:4087	0	0.00	0
+phiX174:4088	0	0.00	0
+phiX174:4089	0	0.00	0
+phiX174:4090	0	0.00	0
+phiX174:4091	0	0.00	0
+phiX174:4092	0	0.00	0
+phiX174:4093	0	0.00	0
+phiX174:4094	0	0.00	0
+phiX174:4095	0	0.00	0
+phiX174:4096	0	0.00	0
+phiX174:4097	0	0.00	0
+phiX174:4098	0	0.00	0
+phiX174:4099	0	0.00	0
+phiX174:4100	0	0.00	0
+phiX174:4101	0	0.00	0
+phiX174:4102	0	0.00	0
+phiX174:4103	0	0.00	0
+phiX174:4104	0	0.00	0
+phiX174:4105	0	0.00	0
+phiX174:4106	0	0.00	0
+phiX174:4107	0	0.00	0
+phiX174:4108	0	0.00	0
+phiX174:4109	0	0.00	0
+phiX174:4110	0	0.00	0
+phiX174:4111	0	0.00	0
+phiX174:4112	0	0.00	0
+phiX174:4113	0	0.00	0
+phiX174:4114	0	0.00	0
+phiX174:4115	0	0.00	0
+phiX174:4116	0	0.00	0
+phiX174:4117	0	0.00	0
+phiX174:4118	0	0.00	0
+phiX174:4119	0	0.00	0
+phiX174:4120	0	0.00	0
+phiX174:4121	0	0.00	0
+phiX174:4122	0	0.00	0
+phiX174:4123	0	0.00	0
+phiX174:4124	0	0.00	0
+phiX174:4125	0	0.00	0
+phiX174:4126	0	0.00	0
+phiX174:4127	0	0.00	0
+phiX174:4128	0	0.00	0
+phiX174:4129	0	0.00	0
+phiX174:4130	0	0.00	0
+phiX174:4131	0	0.00	0
+phiX174:4132	0	0.00	0
+phiX174:4133	0	0.00	0
+phiX174:4134	0	0.00	0
+phiX174:4135	0	0.00	0
+phiX174:4136	0	0.00	0
+phiX174:4137	0	0.00	0
+phiX174:4138	0	0.00	0
+phiX174:4139	0	0.00	0
+phiX174:4140	0	0.00	0
+phiX174:4141	0	0.00	0
+phiX174:4142	0	0.00	0
+phiX174:4143	0	0.00	0
+phiX174:4144	0	0.00	0
+phiX174:4145	0	0.00	0
+phiX174:4146	0	0.00	0
+phiX174:4147	0	0.00	0
+phiX174:4148	0	0.00	0
+phiX174:4149	0	0.00	0
+phiX174:4150	0	0.00	0
+phiX174:4151	0	0.00	0
+phiX174:4152	0	0.00	0
+phiX174:4153	0	0.00	0
+phiX174:4154	0	0.00	0
+phiX174:4155	0	0.00	0
+phiX174:4156	0	0.00	0
+phiX174:4157	0	0.00	0
+phiX174:4158	0	0.00	0
+phiX174:4159	0	0.00	0
+phiX174:4160	0	0.00	0
+phiX174:4161	0	0.00	0
+phiX174:4162	0	0.00	0
+phiX174:4163	0	0.00	0
+phiX174:4164	0	0.00	0
+phiX174:4165	0	0.00	0
+phiX174:4166	0	0.00	0
+phiX174:4167	0	0.00	0
+phiX174:4168	0	0.00	0
+phiX174:4169	0	0.00	0
+phiX174:4170	0	0.00	0
+phiX174:4171	0	0.00	0
+phiX174:4172	0	0.00	0
+phiX174:4173	0	0.00	0
+phiX174:4174	0	0.00	0
+phiX174:4175	0	0.00	0
+phiX174:4176	0	0.00	0
+phiX174:4177	0	0.00	0
+phiX174:4178	0	0.00	0
+phiX174:4179	0	0.00	0
+phiX174:4180	0	0.00	0
+phiX174:4181	0	0.00	0
+phiX174:4182	0	0.00	0
+phiX174:4183	0	0.00	0
+phiX174:4184	0	0.00	0
+phiX174:4185	0	0.00	0
+phiX174:4186	0	0.00	0
+phiX174:4187	0	0.00	0
+phiX174:4188	0	0.00	0
+phiX174:4189	0	0.00	0
+phiX174:4190	0	0.00	0
+phiX174:4191	0	0.00	0
+phiX174:4192	0	0.00	0
+phiX174:4193	0	0.00	0
+phiX174:4194	0	0.00	0
+phiX174:4195	0	0.00	0
+phiX174:4196	0	0.00	0
+phiX174:4197	0	0.00	0
+phiX174:4198	0	0.00	0
+phiX174:4199	0	0.00	0
+phiX174:4200	0	0.00	0
+phiX174:4201	0	0.00	0
+phiX174:4202	0	0.00	0
+phiX174:4203	0	0.00	0
+phiX174:4204	0	0.00	0
+phiX174:4205	0	0.00	0
+phiX174:4206	0	0.00	0
+phiX174:4207	0	0.00	0
+phiX174:4208	0	0.00	0
+phiX174:4209	0	0.00	0
+phiX174:4210	0	0.00	0
+phiX174:4211	0	0.00	0
+phiX174:4212	0	0.00	0
+phiX174:4213	0	0.00	0
+phiX174:4214	0	0.00	0
+phiX174:4215	0	0.00	0
+phiX174:4216	0	0.00	0
+phiX174:4217	0	0.00	0
+phiX174:4218	0	0.00	0
+phiX174:4219	0	0.00	0
+phiX174:4220	0	0.00	0
+phiX174:4221	0	0.00	0
+phiX174:4222	0	0.00	0
+phiX174:4223	0	0.00	0
+phiX174:4224	0	0.00	0
+phiX174:4225	0	0.00	0
+phiX174:4226	0	0.00	0
+phiX174:4227	0	0.00	0
+phiX174:4228	0	0.00	0
+phiX174:4229	0	0.00	0
+phiX174:4230	0	0.00	0
+phiX174:4231	0	0.00	0
+phiX174:4232	0	0.00	0
+phiX174:4233	0	0.00	0
+phiX174:4234	0	0.00	0
+phiX174:4235	0	0.00	0
+phiX174:4236	0	0.00	0
+phiX174:4237	0	0.00	0
+phiX174:4238	0	0.00	0
+phiX174:4239	0	0.00	0
+phiX174:4240	0	0.00	0
+phiX174:4241	0	0.00	0
+phiX174:4242	0	0.00	0
+phiX174:4243	0	0.00	0
+phiX174:4244	0	0.00	0
+phiX174:4245	0	0.00	0
+phiX174:4246	0	0.00	0
+phiX174:4247	0	0.00	0
+phiX174:4248	0	0.00	0
+phiX174:4249	0	0.00	0
+phiX174:4250	0	0.00	0
+phiX174:4251	0	0.00	0
+phiX174:4252	0	0.00	0
+phiX174:4253	0	0.00	0
+phiX174:4254	0	0.00	0
+phiX174:4255	0	0.00	0
+phiX174:4256	0	0.00	0
+phiX174:4257	0	0.00	0
+phiX174:4258	0	0.00	0
+phiX174:4259	0	0.00	0
+phiX174:4260	0	0.00	0
+phiX174:4261	0	0.00	0
+phiX174:4262	0	0.00	0
+phiX174:4263	0	0.00	0
+phiX174:4264	0	0.00	0
+phiX174:4265	0	0.00	0
+phiX174:4266	0	0.00	0
+phiX174:4267	0	0.00	0
+phiX174:4268	0	0.00	0
+phiX174:4269	0	0.00	0
+phiX174:4270	0	0.00	0
+phiX174:4271	0	0.00	0
+phiX174:4272	0	0.00	0
+phiX174:4273	0	0.00	0
+phiX174:4274	0	0.00	0
+phiX174:4275	0	0.00	0
+phiX174:4276	0	0.00	0
+phiX174:4277	0	0.00	0
+phiX174:4278	0	0.00	0
+phiX174:4279	0	0.00	0
+phiX174:4280	0	0.00	0
+phiX174:4281	0	0.00	0
+phiX174:4282	0	0.00	0
+phiX174:4283	0	0.00	0
+phiX174:4284	0	0.00	0
+phiX174:4285	0	0.00	0
+phiX174:4286	0	0.00	0
+phiX174:4287	0	0.00	0
+phiX174:4288	0	0.00	0
+phiX174:4289	0	0.00	0
+phiX174:4290	0	0.00	0
+phiX174:4291	0	0.00	0
+phiX174:4292	0	0.00	0
+phiX174:4293	0	0.00	0
+phiX174:4294	0	0.00	0
+phiX174:4295	0	0.00	0
+phiX174:4296	0	0.00	0
+phiX174:4297	0	0.00	0
+phiX174:4298	0	0.00	0
+phiX174:4299	0	0.00	0
+phiX174:4300	0	0.00	0
+phiX174:4301	0	0.00	0
+phiX174:4302	0	0.00	0
+phiX174:4303	0	0.00	0
+phiX174:4304	0	0.00	0
+phiX174:4305	0	0.00	0
+phiX174:4306	0	0.00	0
+phiX174:4307	0	0.00	0
+phiX174:4308	0	0.00	0
+phiX174:4309	0	0.00	0
+phiX174:4310	0	0.00	0
+phiX174:4311	0	0.00	0
+phiX174:4312	0	0.00	0
+phiX174:4313	0	0.00	0
+phiX174:4314	0	0.00	0
+phiX174:4315	0	0.00	0
+phiX174:4316	0	0.00	0
+phiX174:4317	0	0.00	0
+phiX174:4318	0	0.00	0
+phiX174:4319	0	0.00	0
+phiX174:4320	0	0.00	0
+phiX174:4321	0	0.00	0
+phiX174:4322	0	0.00	0
+phiX174:4323	0	0.00	0
+phiX174:4324	0	0.00	0
+phiX174:4325	0	0.00	0
+phiX174:4326	0	0.00	0
+phiX174:4327	0	0.00	0
+phiX174:4328	0	0.00	0
+phiX174:4329	0	0.00	0
+phiX174:4330	0	0.00	0
+phiX174:4331	0	0.00	0
+phiX174:4332	0	0.00	0
+phiX174:4333	0	0.00	0
+phiX174:4334	0	0.00	0
+phiX174:4335	0	0.00	0
+phiX174:4336	0	0.00	0
+phiX174:4337	0	0.00	0
+phiX174:4338	0	0.00	0
+phiX174:4339	0	0.00	0
+phiX174:4340	0	0.00	0
+phiX174:4341	0	0.00	0
+phiX174:4342	0	0.00	0
+phiX174:4343	0	0.00	0
+phiX174:4344	0	0.00	0
+phiX174:4345	0	0.00	0
+phiX174:4346	0	0.00	0
+phiX174:4347	0	0.00	0
+phiX174:4348	0	0.00	0
+phiX174:4349	0	0.00	0
+phiX174:4350	0	0.00	0
+phiX174:4351	0	0.00	0
+phiX174:4352	0	0.00	0
+phiX174:4353	0	0.00	0
+phiX174:4354	0	0.00	0
+phiX174:4355	0	0.00	0
+phiX174:4356	0	0.00	0
+phiX174:4357	0	0.00	0
+phiX174:4358	0	0.00	0
+phiX174:4359	0	0.00	0
+phiX174:4360	0	0.00	0
+phiX174:4361	0	0.00	0
+phiX174:4362	0	0.00	0
+phiX174:4363	0	0.00	0
+phiX174:4364	0	0.00	0
+phiX174:4365	0	0.00	0
+phiX174:4366	0	0.00	0
+phiX174:4367	0	0.00	0
+phiX174:4368	0	0.00	0
+phiX174:4369	0	0.00	0
+phiX174:4370	0	0.00	0
+phiX174:4371	0	0.00	0
+phiX174:4372	0	0.00	0
+phiX174:4373	0	0.00	0
+phiX174:4374	0	0.00	0
+phiX174:4375	0	0.00	0
+phiX174:4376	0	0.00	0
+phiX174:4377	0	0.00	0
+phiX174:4378	0	0.00	0
+phiX174:4379	0	0.00	0
+phiX174:4380	0	0.00	0
+phiX174:4381	0	0.00	0
+phiX174:4382	0	0.00	0
+phiX174:4383	0	0.00	0
+phiX174:4384	0	0.00	0
+phiX174:4385	0	0.00	0
+phiX174:4386	0	0.00	0
+phiX174:4387	0	0.00	0
+phiX174:4388	0	0.00	0
+phiX174:4389	0	0.00	0
+phiX174:4390	0	0.00	0
+phiX174:4391	0	0.00	0
+phiX174:4392	0	0.00	0
+phiX174:4393	0	0.00	0
+phiX174:4394	0	0.00	0
+phiX174:4395	0	0.00	0
+phiX174:4396	0	0.00	0
+phiX174:4397	0	0.00	0
+phiX174:4398	0	0.00	0
+phiX174:4399	0	0.00	0
+phiX174:4400	0	0.00	0
+phiX174:4401	0	0.00	0
+phiX174:4402	0	0.00	0
+phiX174:4403	0	0.00	0
+phiX174:4404	0	0.00	0
+phiX174:4405	0	0.00	0
+phiX174:4406	0	0.00	0
+phiX174:4407	0	0.00	0
+phiX174:4408	0	0.00	0
+phiX174:4409	0	0.00	0
+phiX174:4410	0	0.00	0
+phiX174:4411	0	0.00	0
+phiX174:4412	0	0.00	0
+phiX174:4413	0	0.00	0
+phiX174:4414	0	0.00	0
+phiX174:4415	0	0.00	0
+phiX174:4416	0	0.00	0
+phiX174:4417	0	0.00	0
+phiX174:4418	0	0.00	0
+phiX174:4419	0	0.00	0
+phiX174:4420	0	0.00	0
+phiX174:4421	0	0.00	0
+phiX174:4422	0	0.00	0
+phiX174:4423	0	0.00	0
+phiX174:4424	0	0.00	0
+phiX174:4425	0	0.00	0
+phiX174:4426	0	0.00	0
+phiX174:4427	0	0.00	0
+phiX174:4428	0	0.00	0
+phiX174:4429	0	0.00	0
+phiX174:4430	0	0.00	0
+phiX174:4431	0	0.00	0
+phiX174:4432	0	0.00	0
+phiX174:4433	0	0.00	0
+phiX174:4434	0	0.00	0
+phiX174:4435	0	0.00	0
+phiX174:4436	0	0.00	0
+phiX174:4437	0	0.00	0
+phiX174:4438	0	0.00	0
+phiX174:4439	0	0.00	0
+phiX174:4440	0	0.00	0
+phiX174:4441	0	0.00	0
+phiX174:4442	0	0.00	0
+phiX174:4443	0	0.00	0
+phiX174:4444	0	0.00	0
+phiX174:4445	0	0.00	0
+phiX174:4446	0	0.00	0
+phiX174:4447	0	0.00	0
+phiX174:4448	0	0.00	0
+phiX174:4449	0	0.00	0
+phiX174:4450	0	0.00	0
+phiX174:4451	0	0.00	0
+phiX174:4452	0	0.00	0
+phiX174:4453	0	0.00	0
+phiX174:4454	0	0.00	0
+phiX174:4455	0	0.00	0
+phiX174:4456	0	0.00	0
+phiX174:4457	0	0.00	0
+phiX174:4458	0	0.00	0
+phiX174:4459	0	0.00	0
+phiX174:4460	0	0.00	0
+phiX174:4461	0	0.00	0
+phiX174:4462	0	0.00	0
+phiX174:4463	0	0.00	0
+phiX174:4464	0	0.00	0
+phiX174:4465	0	0.00	0
+phiX174:4466	0	0.00	0
+phiX174:4467	0	0.00	0
+phiX174:4468	0	0.00	0
+phiX174:4469	0	0.00	0
+phiX174:4470	0	0.00	0
+phiX174:4471	0	0.00	0
+phiX174:4472	0	0.00	0
+phiX174:4473	0	0.00	0
+phiX174:4474	0	0.00	0
+phiX174:4475	0	0.00	0
+phiX174:4476	0	0.00	0
+phiX174:4477	0	0.00	0
+phiX174:4478	0	0.00	0
+phiX174:4479	0	0.00	0
+phiX174:4480	0	0.00	0
+phiX174:4481	0	0.00	0
+phiX174:4482	0	0.00	0
+phiX174:4483	0	0.00	0
+phiX174:4484	0	0.00	0
+phiX174:4485	0	0.00	0
+phiX174:4486	0	0.00	0
+phiX174:4487	0	0.00	0
+phiX174:4488	0	0.00	0
+phiX174:4489	0	0.00	0
+phiX174:4490	0	0.00	0
+phiX174:4491	0	0.00	0
+phiX174:4492	0	0.00	0
+phiX174:4493	0	0.00	0
+phiX174:4494	0	0.00	0
+phiX174:4495	0	0.00	0
+phiX174:4496	0	0.00	0
+phiX174:4497	0	0.00	0
+phiX174:4498	0	0.00	0
+phiX174:4499	0	0.00	0
+phiX174:4500	0	0.00	0
+phiX174:4501	0	0.00	0
+phiX174:4502	0	0.00	0
+phiX174:4503	0	0.00	0
+phiX174:4504	0	0.00	0
+phiX174:4505	0	0.00	0
+phiX174:4506	0	0.00	0
+phiX174:4507	0	0.00	0
+phiX174:4508	0	0.00	0
+phiX174:4509	0	0.00	0
+phiX174:4510	0	0.00	0
+phiX174:4511	0	0.00	0
+phiX174:4512	0	0.00	0
+phiX174:4513	0	0.00	0
+phiX174:4514	0	0.00	0
+phiX174:4515	0	0.00	0
+phiX174:4516	0	0.00	0
+phiX174:4517	0	0.00	0
+phiX174:4518	0	0.00	0
+phiX174:4519	0	0.00	0
+phiX174:4520	0	0.00	0
+phiX174:4521	0	0.00	0
+phiX174:4522	0	0.00	0
+phiX174:4523	0	0.00	0
+phiX174:4524	0	0.00	0
+phiX174:4525	0	0.00	0
+phiX174:4526	0	0.00	0
+phiX174:4527	0	0.00	0
+phiX174:4528	0	0.00	0
+phiX174:4529	0	0.00	0
+phiX174:4530	0	0.00	0
+phiX174:4531	0	0.00	0
+phiX174:4532	0	0.00	0
+phiX174:4533	0	0.00	0
+phiX174:4534	0	0.00	0
+phiX174:4535	0	0.00	0
+phiX174:4536	0	0.00	0
+phiX174:4537	0	0.00	0
+phiX174:4538	0	0.00	0
+phiX174:4539	0	0.00	0
+phiX174:4540	0	0.00	0
+phiX174:4541	0	0.00	0
+phiX174:4542	0	0.00	0
+phiX174:4543	0	0.00	0
+phiX174:4544	0	0.00	0
+phiX174:4545	0	0.00	0
+phiX174:4546	0	0.00	0
+phiX174:4547	0	0.00	0
+phiX174:4548	0	0.00	0
+phiX174:4549	0	0.00	0
+phiX174:4550	0	0.00	0
+phiX174:4551	0	0.00	0
+phiX174:4552	0	0.00	0
+phiX174:4553	0	0.00	0
+phiX174:4554	0	0.00	0
+phiX174:4555	0	0.00	0
+phiX174:4556	0	0.00	0
+phiX174:4557	0	0.00	0
+phiX174:4558	0	0.00	0
+phiX174:4559	0	0.00	0
+phiX174:4560	0	0.00	0
+phiX174:4561	0	0.00	0
+phiX174:4562	0	0.00	0
+phiX174:4563	0	0.00	0
+phiX174:4564	0	0.00	0
+phiX174:4565	0	0.00	0
+phiX174:4566	0	0.00	0
+phiX174:4567	0	0.00	0
+phiX174:4568	0	0.00	0
+phiX174:4569	0	0.00	0
+phiX174:4570	0	0.00	0
+phiX174:4571	0	0.00	0
+phiX174:4572	0	0.00	0
+phiX174:4573	0	0.00	0
+phiX174:4574	0	0.00	0
+phiX174:4575	0	0.00	0
+phiX174:4576	0	0.00	0
+phiX174:4577	0	0.00	0
+phiX174:4578	0	0.00	0
+phiX174:4579	0	0.00	0
+phiX174:4580	0	0.00	0
+phiX174:4581	0	0.00	0
+phiX174:4582	0	0.00	0
+phiX174:4583	0	0.00	0
+phiX174:4584	0	0.00	0
+phiX174:4585	0	0.00	0
+phiX174:4586	0	0.00	0
+phiX174:4587	0	0.00	0
+phiX174:4588	0	0.00	0
+phiX174:4589	0	0.00	0
+phiX174:4590	0	0.00	0
+phiX174:4591	0	0.00	0
+phiX174:4592	0	0.00	0
+phiX174:4593	0	0.00	0
+phiX174:4594	0	0.00	0
+phiX174:4595	0	0.00	0
+phiX174:4596	0	0.00	0
+phiX174:4597	0	0.00	0
+phiX174:4598	0	0.00	0
+phiX174:4599	0	0.00	0
+phiX174:4600	0	0.00	0
+phiX174:4601	0	0.00	0
+phiX174:4602	0	0.00	0
+phiX174:4603	0	0.00	0
+phiX174:4604	0	0.00	0
+phiX174:4605	0	0.00	0
+phiX174:4606	0	0.00	0
+phiX174:4607	0	0.00	0
+phiX174:4608	0	0.00	0
+phiX174:4609	0	0.00	0
+phiX174:4610	0	0.00	0
+phiX174:4611	0	0.00	0
+phiX174:4612	0	0.00	0
+phiX174:4613	0	0.00	0
+phiX174:4614	0	0.00	0
+phiX174:4615	0	0.00	0
+phiX174:4616	0	0.00	0
+phiX174:4617	0	0.00	0
+phiX174:4618	0	0.00	0
+phiX174:4619	0	0.00	0
+phiX174:4620	0	0.00	0
+phiX174:4621	0	0.00	0
+phiX174:4622	0	0.00	0
+phiX174:4623	0	0.00	0
+phiX174:4624	0	0.00	0
+phiX174:4625	0	0.00	0
+phiX174:4626	0	0.00	0
+phiX174:4627	0	0.00	0
+phiX174:4628	0	0.00	0
+phiX174:4629	0	0.00	0
+phiX174:4630	0	0.00	0
+phiX174:4631	0	0.00	0
+phiX174:4632	0	0.00	0
+phiX174:4633	0	0.00	0
+phiX174:4634	0	0.00	0
+phiX174:4635	0	0.00	0
+phiX174:4636	0	0.00	0
+phiX174:4637	0	0.00	0
+phiX174:4638	0	0.00	0
+phiX174:4639	0	0.00	0
+phiX174:4640	0	0.00	0
+phiX174:4641	0	0.00	0
+phiX174:4642	0	0.00	0
+phiX174:4643	0	0.00	0
+phiX174:4644	0	0.00	0
+phiX174:4645	0	0.00	0
+phiX174:4646	0	0.00	0
+phiX174:4647	0	0.00	0
+phiX174:4648	0	0.00	0
+phiX174:4649	0	0.00	0
+phiX174:4650	0	0.00	0
+phiX174:4651	0	0.00	0
+phiX174:4652	0	0.00	0
+phiX174:4653	0	0.00	0
+phiX174:4654	0	0.00	0
+phiX174:4655	0	0.00	0
+phiX174:4656	0	0.00	0
+phiX174:4657	0	0.00	0
+phiX174:4658	0	0.00	0
+phiX174:4659	0	0.00	0
+phiX174:4660	0	0.00	0
+phiX174:4661	0	0.00	0
+phiX174:4662	0	0.00	0
+phiX174:4663	0	0.00	0
+phiX174:4664	0	0.00	0
+phiX174:4665	0	0.00	0
+phiX174:4666	0	0.00	0
+phiX174:4667	0	0.00	0
+phiX174:4668	0	0.00	0
+phiX174:4669	0	0.00	0
+phiX174:4670	0	0.00	0
+phiX174:4671	0	0.00	0
+phiX174:4672	0	0.00	0
+phiX174:4673	0	0.00	0
+phiX174:4674	0	0.00	0
+phiX174:4675	0	0.00	0
+phiX174:4676	0	0.00	0
+phiX174:4677	0	0.00	0
+phiX174:4678	0	0.00	0
+phiX174:4679	0	0.00	0
+phiX174:4680	0	0.00	0
+phiX174:4681	0	0.00	0
+phiX174:4682	0	0.00	0
+phiX174:4683	0	0.00	0
+phiX174:4684	0	0.00	0
+phiX174:4685	0	0.00	0
+phiX174:4686	0	0.00	0
+phiX174:4687	0	0.00	0
+phiX174:4688	0	0.00	0
+phiX174:4689	0	0.00	0
+phiX174:4690	0	0.00	0
+phiX174:4691	0	0.00	0
+phiX174:4692	0	0.00	0
+phiX174:4693	0	0.00	0
+phiX174:4694	0	0.00	0
+phiX174:4695	0	0.00	0
+phiX174:4696	0	0.00	0
+phiX174:4697	0	0.00	0
+phiX174:4698	0	0.00	0
+phiX174:4699	0	0.00	0
+phiX174:4700	0	0.00	0
+phiX174:4701	0	0.00	0
+phiX174:4702	0	0.00	0
+phiX174:4703	0	0.00	0
+phiX174:4704	0	0.00	0
+phiX174:4705	0	0.00	0
+phiX174:4706	0	0.00	0
+phiX174:4707	0	0.00	0
+phiX174:4708	0	0.00	0
+phiX174:4709	0	0.00	0
+phiX174:4710	0	0.00	0
+phiX174:4711	0	0.00	0
+phiX174:4712	0	0.00	0
+phiX174:4713	0	0.00	0
+phiX174:4714	0	0.00	0
+phiX174:4715	0	0.00	0
+phiX174:4716	0	0.00	0
+phiX174:4717	0	0.00	0
+phiX174:4718	0	0.00	0
+phiX174:4719	0	0.00	0
+phiX174:4720	0	0.00	0
+phiX174:4721	0	0.00	0
+phiX174:4722	0	0.00	0
+phiX174:4723	0	0.00	0
+phiX174:4724	0	0.00	0
+phiX174:4725	0	0.00	0
+phiX174:4726	0	0.00	0
+phiX174:4727	0	0.00	0
+phiX174:4728	0	0.00	0
+phiX174:4729	0	0.00	0
+phiX174:4730	0	0.00	0
+phiX174:4731	0	0.00	0
+phiX174:4732	0	0.00	0
+phiX174:4733	0	0.00	0
+phiX174:4734	0	0.00	0
+phiX174:4735	0	0.00	0
+phiX174:4736	0	0.00	0
+phiX174:4737	0	0.00	0
+phiX174:4738	0	0.00	0
+phiX174:4739	0	0.00	0
+phiX174:4740	0	0.00	0
+phiX174:4741	0	0.00	0
+phiX174:4742	0	0.00	0
+phiX174:4743	0	0.00	0
+phiX174:4744	0	0.00	0
+phiX174:4745	0	0.00	0
+phiX174:4746	0	0.00	0
+phiX174:4747	0	0.00	0
+phiX174:4748	0	0.00	0
+phiX174:4749	0	0.00	0
+phiX174:4750	0	0.00	0
+phiX174:4751	0	0.00	0
+phiX174:4752	0	0.00	0
+phiX174:4753	0	0.00	0
+phiX174:4754	0	0.00	0
+phiX174:4755	0	0.00	0
+phiX174:4756	0	0.00	0
+phiX174:4757	0	0.00	0
+phiX174:4758	0	0.00	0
+phiX174:4759	0	0.00	0
+phiX174:4760	0	0.00	0
+phiX174:4761	0	0.00	0
+phiX174:4762	0	0.00	0
+phiX174:4763	0	0.00	0
+phiX174:4764	0	0.00	0
+phiX174:4765	0	0.00	0
+phiX174:4766	0	0.00	0
+phiX174:4767	0	0.00	0
+phiX174:4768	0	0.00	0
+phiX174:4769	0	0.00	0
+phiX174:4770	0	0.00	0
+phiX174:4771	0	0.00	0
+phiX174:4772	0	0.00	0
+phiX174:4773	0	0.00	0
+phiX174:4774	0	0.00	0
+phiX174:4775	0	0.00	0
+phiX174:4776	0	0.00	0
+phiX174:4777	0	0.00	0
+phiX174:4778	0	0.00	0
+phiX174:4779	0	0.00	0
+phiX174:4780	0	0.00	0
+phiX174:4781	0	0.00	0
+phiX174:4782	0	0.00	0
+phiX174:4783	0	0.00	0
+phiX174:4784	0	0.00	0
+phiX174:4785	0	0.00	0
+phiX174:4786	0	0.00	0
+phiX174:4787	0	0.00	0
+phiX174:4788	0	0.00	0
+phiX174:4789	0	0.00	0
+phiX174:4790	0	0.00	0
+phiX174:4791	0	0.00	0
+phiX174:4792	0	0.00	0
+phiX174:4793	0	0.00	0
+phiX174:4794	0	0.00	0
+phiX174:4795	0	0.00	0
+phiX174:4796	0	0.00	0
+phiX174:4797	0	0.00	0
+phiX174:4798	0	0.00	0
+phiX174:4799	0	0.00	0
+phiX174:4800	0	0.00	0
+phiX174:4801	0	0.00	0
+phiX174:4802	0	0.00	0
+phiX174:4803	0	0.00	0
+phiX174:4804	0	0.00	0
+phiX174:4805	0	0.00	0
+phiX174:4806	0	0.00	0
+phiX174:4807	0	0.00	0
+phiX174:4808	0	0.00	0
+phiX174:4809	0	0.00	0
+phiX174:4810	0	0.00	0
+phiX174:4811	0	0.00	0
+phiX174:4812	0	0.00	0
+phiX174:4813	0	0.00	0
+phiX174:4814	0	0.00	0
+phiX174:4815	0	0.00	0
+phiX174:4816	0	0.00	0
+phiX174:4817	0	0.00	0
+phiX174:4818	0	0.00	0
+phiX174:4819	0	0.00	0
+phiX174:4820	0	0.00	0
+phiX174:4821	0	0.00	0
+phiX174:4822	0	0.00	0
+phiX174:4823	0	0.00	0
+phiX174:4824	0	0.00	0
+phiX174:4825	0	0.00	0
+phiX174:4826	0	0.00	0
+phiX174:4827	0	0.00	0
+phiX174:4828	0	0.00	0
+phiX174:4829	0	0.00	0
+phiX174:4830	0	0.00	0
+phiX174:4831	0	0.00	0
+phiX174:4832	0	0.00	0
+phiX174:4833	0	0.00	0
+phiX174:4834	0	0.00	0
+phiX174:4835	0	0.00	0
+phiX174:4836	0	0.00	0
+phiX174:4837	0	0.00	0
+phiX174:4838	0	0.00	0
+phiX174:4839	0	0.00	0
+phiX174:4840	0	0.00	0
+phiX174:4841	0	0.00	0
+phiX174:4842	0	0.00	0
+phiX174:4843	0	0.00	0
+phiX174:4844	0	0.00	0
+phiX174:4845	0	0.00	0
+phiX174:4846	0	0.00	0
+phiX174:4847	0	0.00	0
+phiX174:4848	0	0.00	0
+phiX174:4849	0	0.00	0
+phiX174:4850	0	0.00	0
+phiX174:4851	0	0.00	0
+phiX174:4852	0	0.00	0
+phiX174:4853	0	0.00	0
+phiX174:4854	0	0.00	0
+phiX174:4855	0	0.00	0
+phiX174:4856	0	0.00	0
+phiX174:4857	0	0.00	0
+phiX174:4858	0	0.00	0
+phiX174:4859	0	0.00	0
+phiX174:4860	0	0.00	0
+phiX174:4861	0	0.00	0
+phiX174:4862	0	0.00	0
+phiX174:4863	0	0.00	0
+phiX174:4864	0	0.00	0
+phiX174:4865	0	0.00	0
+phiX174:4866	0	0.00	0
+phiX174:4867	0	0.00	0
+phiX174:4868	0	0.00	0
+phiX174:4869	0	0.00	0
+phiX174:4870	0	0.00	0
+phiX174:4871	0	0.00	0
+phiX174:4872	0	0.00	0
+phiX174:4873	0	0.00	0
+phiX174:4874	0	0.00	0
+phiX174:4875	0	0.00	0
+phiX174:4876	0	0.00	0
+phiX174:4877	0	0.00	0
+phiX174:4878	0	0.00	0
+phiX174:4879	0	0.00	0
+phiX174:4880	0	0.00	0
+phiX174:4881	0	0.00	0
+phiX174:4882	0	0.00	0
+phiX174:4883	0	0.00	0
+phiX174:4884	0	0.00	0
+phiX174:4885	0	0.00	0
+phiX174:4886	0	0.00	0
+phiX174:4887	0	0.00	0
+phiX174:4888	0	0.00	0
+phiX174:4889	0	0.00	0
+phiX174:4890	0	0.00	0
+phiX174:4891	0	0.00	0
+phiX174:4892	0	0.00	0
+phiX174:4893	0	0.00	0
+phiX174:4894	0	0.00	0
+phiX174:4895	0	0.00	0
+phiX174:4896	0	0.00	0
+phiX174:4897	0	0.00	0
+phiX174:4898	0	0.00	0
+phiX174:4899	0	0.00	0
+phiX174:4900	0	0.00	0
+phiX174:4901	0	0.00	0
+phiX174:4902	0	0.00	0
+phiX174:4903	0	0.00	0
+phiX174:4904	0	0.00	0
+phiX174:4905	0	0.00	0
+phiX174:4906	0	0.00	0
+phiX174:4907	0	0.00	0
+phiX174:4908	0	0.00	0
+phiX174:4909	0	0.00	0
+phiX174:4910	0	0.00	0
+phiX174:4911	0	0.00	0
+phiX174:4912	0	0.00	0
+phiX174:4913	0	0.00	0
+phiX174:4914	0	0.00	0
+phiX174:4915	0	0.00	0
+phiX174:4916	0	0.00	0
+phiX174:4917	0	0.00	0
+phiX174:4918	0	0.00	0
+phiX174:4919	0	0.00	0
+phiX174:4920	0	0.00	0
+phiX174:4921	0	0.00	0
+phiX174:4922	0	0.00	0
+phiX174:4923	0	0.00	0
+phiX174:4924	0	0.00	0
+phiX174:4925	0	0.00	0
+phiX174:4926	0	0.00	0
+phiX174:4927	0	0.00	0
+phiX174:4928	0	0.00	0
+phiX174:4929	0	0.00	0
+phiX174:4930	0	0.00	0
+phiX174:4931	0	0.00	0
+phiX174:4932	0	0.00	0
+phiX174:4933	0	0.00	0
+phiX174:4934	0	0.00	0
+phiX174:4935	0	0.00	0
+phiX174:4936	0	0.00	0
+phiX174:4937	0	0.00	0
+phiX174:4938	0	0.00	0
+phiX174:4939	0	0.00	0
+phiX174:4940	0	0.00	0
+phiX174:4941	0	0.00	0
+phiX174:4942	0	0.00	0
+phiX174:4943	0	0.00	0
+phiX174:4944	0	0.00	0
+phiX174:4945	0	0.00	0
+phiX174:4946	0	0.00	0
+phiX174:4947	0	0.00	0
+phiX174:4948	0	0.00	0
+phiX174:4949	0	0.00	0
+phiX174:4950	0	0.00	0
+phiX174:4951	0	0.00	0
+phiX174:4952	0	0.00	0
+phiX174:4953	0	0.00	0
+phiX174:4954	0	0.00	0
+phiX174:4955	0	0.00	0
+phiX174:4956	0	0.00	0
+phiX174:4957	0	0.00	0
+phiX174:4958	0	0.00	0
+phiX174:4959	0	0.00	0
+phiX174:4960	0	0.00	0
+phiX174:4961	0	0.00	0
+phiX174:4962	0	0.00	0
+phiX174:4963	0	0.00	0
+phiX174:4964	0	0.00	0
+phiX174:4965	0	0.00	0
+phiX174:4966	0	0.00	0
+phiX174:4967	0	0.00	0
+phiX174:4968	0	0.00	0
+phiX174:4969	0	0.00	0
+phiX174:4970	0	0.00	0
+phiX174:4971	0	0.00	0
+phiX174:4972	0	0.00	0
+phiX174:4973	0	0.00	0
+phiX174:4974	0	0.00	0
+phiX174:4975	0	0.00	0
+phiX174:4976	0	0.00	0
+phiX174:4977	0	0.00	0
+phiX174:4978	0	0.00	0
+phiX174:4979	0	0.00	0
+phiX174:4980	0	0.00	0
+phiX174:4981	0	0.00	0
+phiX174:4982	0	0.00	0
+phiX174:4983	0	0.00	0
+phiX174:4984	0	0.00	0
+phiX174:4985	0	0.00	0
+phiX174:4986	0	0.00	0
+phiX174:4987	0	0.00	0
+phiX174:4988	0	0.00	0
+phiX174:4989	0	0.00	0
+phiX174:4990	0	0.00	0
+phiX174:4991	0	0.00	0
+phiX174:4992	0	0.00	0
+phiX174:4993	0	0.00	0
+phiX174:4994	0	0.00	0
+phiX174:4995	0	0.00	0
+phiX174:4996	0	0.00	0
+phiX174:4997	0	0.00	0
+phiX174:4998	0	0.00	0
+phiX174:4999	0	0.00	0
+phiX174:5000	0	0.00	0
+phiX174:5001	0	0.00	0
+phiX174:5002	0	0.00	0
+phiX174:5003	0	0.00	0
+phiX174:5004	0	0.00	0
+phiX174:5005	0	0.00	0
+phiX174:5006	0	0.00	0
+phiX174:5007	0	0.00	0
+phiX174:5008	0	0.00	0
+phiX174:5009	0	0.00	0
+phiX174:5010	0	0.00	0
+phiX174:5011	0	0.00	0
+phiX174:5012	0	0.00	0
+phiX174:5013	0	0.00	0
+phiX174:5014	0	0.00	0
+phiX174:5015	0	0.00	0
+phiX174:5016	0	0.00	0
+phiX174:5017	0	0.00	0
+phiX174:5018	0	0.00	0
+phiX174:5019	0	0.00	0
+phiX174:5020	0	0.00	0
+phiX174:5021	0	0.00	0
+phiX174:5022	0	0.00	0
+phiX174:5023	0	0.00	0
+phiX174:5024	0	0.00	0
+phiX174:5025	0	0.00	0
+phiX174:5026	0	0.00	0
+phiX174:5027	0	0.00	0
+phiX174:5028	0	0.00	0
+phiX174:5029	0	0.00	0
+phiX174:5030	0	0.00	0
+phiX174:5031	0	0.00	0
+phiX174:5032	0	0.00	0
+phiX174:5033	0	0.00	0
+phiX174:5034	0	0.00	0
+phiX174:5035	0	0.00	0
+phiX174:5036	0	0.00	0
+phiX174:5037	0	0.00	0
+phiX174:5038	0	0.00	0
+phiX174:5039	0	0.00	0
+phiX174:5040	0	0.00	0
+phiX174:5041	0	0.00	0
+phiX174:5042	0	0.00	0
+phiX174:5043	0	0.00	0
+phiX174:5044	0	0.00	0
+phiX174:5045	0	0.00	0
+phiX174:5046	0	0.00	0
+phiX174:5047	0	0.00	0
+phiX174:5048	0	0.00	0
+phiX174:5049	0	0.00	0
+phiX174:5050	0	0.00	0
+phiX174:5051	0	0.00	0
+phiX174:5052	0	0.00	0
+phiX174:5053	0	0.00	0
+phiX174:5054	0	0.00	0
+phiX174:5055	0	0.00	0
+phiX174:5056	0	0.00	0
+phiX174:5057	0	0.00	0
+phiX174:5058	0	0.00	0
+phiX174:5059	0	0.00	0
+phiX174:5060	0	0.00	0
+phiX174:5061	0	0.00	0
+phiX174:5062	0	0.00	0
+phiX174:5063	0	0.00	0
+phiX174:5064	0	0.00	0
+phiX174:5065	0	0.00	0
+phiX174:5066	0	0.00	0
+phiX174:5067	0	0.00	0
+phiX174:5068	0	0.00	0
+phiX174:5069	0	0.00	0
+phiX174:5070	0	0.00	0
+phiX174:5071	0	0.00	0
+phiX174:5072	0	0.00	0
+phiX174:5073	0	0.00	0
+phiX174:5074	0	0.00	0
+phiX174:5075	0	0.00	0
+phiX174:5076	0	0.00	0
+phiX174:5077	0	0.00	0
+phiX174:5078	0	0.00	0
+phiX174:5079	0	0.00	0
+phiX174:5080	0	0.00	0
+phiX174:5081	0	0.00	0
+phiX174:5082	0	0.00	0
+phiX174:5083	0	0.00	0
+phiX174:5084	0	0.00	0
+phiX174:5085	0	0.00	0
+phiX174:5086	0	0.00	0
+phiX174:5087	0	0.00	0
+phiX174:5088	0	0.00	0
+phiX174:5089	0	0.00	0
+phiX174:5090	0	0.00	0
+phiX174:5091	0	0.00	0
+phiX174:5092	0	0.00	0
+phiX174:5093	0	0.00	0
+phiX174:5094	0	0.00	0
+phiX174:5095	0	0.00	0
+phiX174:5096	0	0.00	0
+phiX174:5097	0	0.00	0
+phiX174:5098	0	0.00	0
+phiX174:5099	0	0.00	0
+phiX174:5100	0	0.00	0
+phiX174:5101	0	0.00	0
+phiX174:5102	0	0.00	0
+phiX174:5103	0	0.00	0
+phiX174:5104	0	0.00	0
+phiX174:5105	0	0.00	0
+phiX174:5106	0	0.00	0
+phiX174:5107	0	0.00	0
+phiX174:5108	0	0.00	0
+phiX174:5109	0	0.00	0
+phiX174:5110	0	0.00	0
+phiX174:5111	0	0.00	0
+phiX174:5112	0	0.00	0
+phiX174:5113	0	0.00	0
+phiX174:5114	0	0.00	0
+phiX174:5115	0	0.00	0
+phiX174:5116	0	0.00	0
+phiX174:5117	0	0.00	0
+phiX174:5118	0	0.00	0
+phiX174:5119	0	0.00	0
+phiX174:5120	0	0.00	0
+phiX174:5121	0	0.00	0
+phiX174:5122	0	0.00	0
+phiX174:5123	0	0.00	0
+phiX174:5124	0	0.00	0
+phiX174:5125	0	0.00	0
+phiX174:5126	0	0.00	0
+phiX174:5127	0	0.00	0
+phiX174:5128	0	0.00	0
+phiX174:5129	0	0.00	0
+phiX174:5130	0	0.00	0
+phiX174:5131	0	0.00	0
+phiX174:5132	0	0.00	0
+phiX174:5133	0	0.00	0
+phiX174:5134	0	0.00	0
+phiX174:5135	0	0.00	0
+phiX174:5136	0	0.00	0
+phiX174:5137	0	0.00	0
+phiX174:5138	0	0.00	0
+phiX174:5139	0	0.00	0
+phiX174:5140	0	0.00	0
+phiX174:5141	0	0.00	0
+phiX174:5142	0	0.00	0
+phiX174:5143	0	0.00	0
+phiX174:5144	0	0.00	0
+phiX174:5145	0	0.00	0
+phiX174:5146	0	0.00	0
+phiX174:5147	0	0.00	0
+phiX174:5148	0	0.00	0
+phiX174:5149	0	0.00	0
+phiX174:5150	0	0.00	0
+phiX174:5151	0	0.00	0
+phiX174:5152	0	0.00	0
+phiX174:5153	0	0.00	0
+phiX174:5154	0	0.00	0
+phiX174:5155	0	0.00	0
+phiX174:5156	0	0.00	0
+phiX174:5157	0	0.00	0
+phiX174:5158	0	0.00	0
+phiX174:5159	0	0.00	0
+phiX174:5160	0	0.00	0
+phiX174:5161	0	0.00	0
+phiX174:5162	0	0.00	0
+phiX174:5163	0	0.00	0
+phiX174:5164	0	0.00	0
+phiX174:5165	0	0.00	0
+phiX174:5166	0	0.00	0
+phiX174:5167	0	0.00	0
+phiX174:5168	0	0.00	0
+phiX174:5169	0	0.00	0
+phiX174:5170	0	0.00	0
+phiX174:5171	0	0.00	0
+phiX174:5172	0	0.00	0
+phiX174:5173	0	0.00	0
+phiX174:5174	0	0.00	0
+phiX174:5175	0	0.00	0
+phiX174:5176	0	0.00	0
+phiX174:5177	0	0.00	0
+phiX174:5178	0	0.00	0
+phiX174:5179	0	0.00	0
+phiX174:5180	0	0.00	0
+phiX174:5181	0	0.00	0
+phiX174:5182	0	0.00	0
+phiX174:5183	0	0.00	0
+phiX174:5184	0	0.00	0
+phiX174:5185	0	0.00	0
+phiX174:5186	0	0.00	0
+phiX174:5187	0	0.00	0
+phiX174:5188	0	0.00	0
+phiX174:5189	0	0.00	0
+phiX174:5190	0	0.00	0
+phiX174:5191	0	0.00	0
+phiX174:5192	0	0.00	0
+phiX174:5193	0	0.00	0
+phiX174:5194	0	0.00	0
+phiX174:5195	0	0.00	0
+phiX174:5196	0	0.00	0
+phiX174:5197	0	0.00	0
+phiX174:5198	0	0.00	0
+phiX174:5199	0	0.00	0
+phiX174:5200	0	0.00	0
+phiX174:5201	0	0.00	0
+phiX174:5202	0	0.00	0
+phiX174:5203	0	0.00	0
+phiX174:5204	0	0.00	0
+phiX174:5205	0	0.00	0
+phiX174:5206	0	0.00	0
+phiX174:5207	0	0.00	0
+phiX174:5208	0	0.00	0
+phiX174:5209	0	0.00	0
+phiX174:5210	0	0.00	0
+phiX174:5211	0	0.00	0
+phiX174:5212	0	0.00	0
+phiX174:5213	0	0.00	0
+phiX174:5214	0	0.00	0
+phiX174:5215	0	0.00	0
+phiX174:5216	0	0.00	0
+phiX174:5217	0	0.00	0
+phiX174:5218	0	0.00	0
+phiX174:5219	0	0.00	0
+phiX174:5220	0	0.00	0
+phiX174:5221	0	0.00	0
+phiX174:5222	0	0.00	0
+phiX174:5223	0	0.00	0
+phiX174:5224	0	0.00	0
+phiX174:5225	0	0.00	0
+phiX174:5226	0	0.00	0
+phiX174:5227	0	0.00	0
+phiX174:5228	0	0.00	0
+phiX174:5229	0	0.00	0
+phiX174:5230	0	0.00	0
+phiX174:5231	0	0.00	0
+phiX174:5232	0	0.00	0
+phiX174:5233	0	0.00	0
+phiX174:5234	0	0.00	0
+phiX174:5235	0	0.00	0
+phiX174:5236	0	0.00	0
+phiX174:5237	0	0.00	0
+phiX174:5238	0	0.00	0
+phiX174:5239	0	0.00	0
+phiX174:5240	0	0.00	0
+phiX174:5241	0	0.00	0
+phiX174:5242	0	0.00	0
+phiX174:5243	0	0.00	0
+phiX174:5244	0	0.00	0
+phiX174:5245	0	0.00	0
+phiX174:5246	0	0.00	0
+phiX174:5247	0	0.00	0
+phiX174:5248	0	0.00	0
+phiX174:5249	0	0.00	0
+phiX174:5250	0	0.00	0
+phiX174:5251	0	0.00	0
+phiX174:5252	0	0.00	0
+phiX174:5253	0	0.00	0
+phiX174:5254	0	0.00	0
+phiX174:5255	0	0.00	0
+phiX174:5256	0	0.00	0
+phiX174:5257	0	0.00	0
+phiX174:5258	0	0.00	0
+phiX174:5259	0	0.00	0
+phiX174:5260	0	0.00	0
+phiX174:5261	0	0.00	0
+phiX174:5262	0	0.00	0
+phiX174:5263	0	0.00	0
+phiX174:5264	0	0.00	0
+phiX174:5265	0	0.00	0
+phiX174:5266	0	0.00	0
+phiX174:5267	0	0.00	0
+phiX174:5268	0	0.00	0
+phiX174:5269	0	0.00	0
+phiX174:5270	0	0.00	0
+phiX174:5271	0	0.00	0
+phiX174:5272	0	0.00	0
+phiX174:5273	0	0.00	0
+phiX174:5274	0	0.00	0
+phiX174:5275	0	0.00	0
+phiX174:5276	0	0.00	0
+phiX174:5277	0	0.00	0
+phiX174:5278	0	0.00	0
+phiX174:5279	0	0.00	0
+phiX174:5280	0	0.00	0
+phiX174:5281	0	0.00	0
+phiX174:5282	0	0.00	0
+phiX174:5283	0	0.00	0
+phiX174:5284	0	0.00	0
+phiX174:5285	0	0.00	0
+phiX174:5286	0	0.00	0
+phiX174:5287	0	0.00	0
+phiX174:5288	0	0.00	0
+phiX174:5289	0	0.00	0
+phiX174:5290	0	0.00	0
+phiX174:5291	0	0.00	0
+phiX174:5292	0	0.00	0
+phiX174:5293	0	0.00	0
+phiX174:5294	0	0.00	0
+phiX174:5295	0	0.00	0
+phiX174:5296	0	0.00	0
+phiX174:5297	0	0.00	0
+phiX174:5298	0	0.00	0
+phiX174:5299	0	0.00	0
+phiX174:5300	0	0.00	0
+phiX174:5301	0	0.00	0
+phiX174:5302	0	0.00	0
+phiX174:5303	0	0.00	0
+phiX174:5304	0	0.00	0
+phiX174:5305	0	0.00	0
+phiX174:5306	0	0.00	0
+phiX174:5307	0	0.00	0
+phiX174:5308	0	0.00	0
+phiX174:5309	0	0.00	0
+phiX174:5310	0	0.00	0
+phiX174:5311	0	0.00	0
+phiX174:5312	0	0.00	0
+phiX174:5313	0	0.00	0
+phiX174:5314	0	0.00	0
+phiX174:5315	0	0.00	0
+phiX174:5316	0	0.00	0
+phiX174:5317	0	0.00	0
+phiX174:5318	0	0.00	0
+phiX174:5319	0	0.00	0
+phiX174:5320	0	0.00	0
+phiX174:5321	0	0.00	0
+phiX174:5322	0	0.00	0
+phiX174:5323	0	0.00	0
+phiX174:5324	0	0.00	0
+phiX174:5325	0	0.00	0
+phiX174:5326	0	0.00	0
+phiX174:5327	0	0.00	0
+phiX174:5328	0	0.00	0
+phiX174:5329	0	0.00	0
+phiX174:5330	0	0.00	0
+phiX174:5331	0	0.00	0
+phiX174:5332	0	0.00	0
+phiX174:5333	0	0.00	0
+phiX174:5334	0	0.00	0
+phiX174:5335	0	0.00	0
+phiX174:5336	0	0.00	0
+phiX174:5337	0	0.00	0
+phiX174:5338	0	0.00	0
+phiX174:5339	0	0.00	0
+phiX174:5340	0	0.00	0
+phiX174:5341	0	0.00	0
+phiX174:5342	0	0.00	0
+phiX174:5343	0	0.00	0
+phiX174:5344	0	0.00	0
+phiX174:5345	0	0.00	0
+phiX174:5346	0	0.00	0
+phiX174:5347	0	0.00	0
+phiX174:5348	0	0.00	0
+phiX174:5349	0	0.00	0
+phiX174:5350	0	0.00	0
+phiX174:5351	0	0.00	0
+phiX174:5352	0	0.00	0
+phiX174:5353	0	0.00	0
+phiX174:5354	0	0.00	0
+phiX174:5355	0	0.00	0
+phiX174:5356	0	0.00	0
+phiX174:5357	0	0.00	0
+phiX174:5358	0	0.00	0
+phiX174:5359	0	0.00	0
+phiX174:5360	0	0.00	0
+phiX174:5361	0	0.00	0
+phiX174:5362	0	0.00	0
+phiX174:5363	0	0.00	0
+phiX174:5364	0	0.00	0
+phiX174:5365	0	0.00	0
+phiX174:5366	0	0.00	0
+phiX174:5367	0	0.00	0
+phiX174:5368	0	0.00	0
+phiX174:5369	0	0.00	0
+phiX174:5370	0	0.00	0
+phiX174:5371	0	0.00	0
+phiX174:5372	0	0.00	0
+phiX174:5373	0	0.00	0
+phiX174:5374	0	0.00	0
+phiX174:5375	0	0.00	0
+phiX174:5376	0	0.00	0
+phiX174:5377	0	0.00	0
+phiX174:5378	0	0.00	0
+phiX174:5379	0	0.00	0
+phiX174:5380	0	0.00	0
+phiX174:5381	0	0.00	0
+phiX174:5382	0	0.00	0
+phiX174:5383	0	0.00	0
+phiX174:5384	0	0.00	0
+phiX174:5385	0	0.00	0
+phiX174:5386	0	0.00	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_statistics_sample.tabular	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,2 @@
+Source_of_reads	from_0_to_1)	from_1_to_2)	from_2_to_3)	from_3_to_4)	from_4_to_5)	from_5_to_6)	from_6_to_7)	from_7_to_8)	from_8_to_9)	from_9_to_10)	from_10_to_11)	from_11_to_12)	from_12_to_13)	from_13_to_14)	from_14_to_15)	from_15_to_16)	from_16_to_17)	from_17_to_18)	from_18_to_19)	from_19_to_20)	from_20_to_21)	from_21_to_22)	from_22_to_23)	from_23_to_24)	from_24_to_25)	from_25_to_26)	from_26_to_27)	from_27_to_28)	from_28_to_29)	from_29_to_30)	from_30_to_31)	from_31_to_32)	from_32_to_33)	from_33_to_34)	from_34_to_35)	from_35_to_36)	from_36_to_37)	from_37_to_38)	from_38_to_39)	from_39_to_40)	from_40_to_41)	from_41_to_42)	from_42_to_43)	from_43_to_44)	from_44_to_45)	from_45_to_46)	from_46_to_47)	from_47_to_48)	from_48_to_49)	from_49_to_50)	from_50_to_51)	from_51_to_52)	from_52_to_53)	from_53_to_54)	from_54_to_55)	from_55_to_56)	from_56_to_57)	from_57_to_58)	from_58_to_59)	from_59_to_60)	from_60_to_61)	from_61_to_62)	from_62_to_63)	from_63_to_64)	from_64_to_65)	from_65_to_66)	from_66_to_67)	from_67_to_68)	from_68_to_69)	from_69_to_70)	from_70_to_71)	from_71_to_72)	from_72_to_73)	from_73_to_74)	from_74_to_75)	from_75_to_76)	from_76_to_77)	from_77_to_78)	from_78_to_79)	from_79_to_80)	from_80_to_81)	from_81_to_82)	from_82_to_83)	from_83_to_84)	from_84_to_85)	from_85_to_86)	from_86_to_87)	from_87_to_88)	from_88_to_89)	from_89_to_90)	from_90_to_91)	from_91_to_92)	from_92_to_93)	from_93_to_94)	from_94_to_95)	from_95_to_96)	from_96_to_97)	from_97_to_98)	from_98_to_99)	from_99_to_100)	from_100_to_101)	from_101_to_102)	from_102_to_103)	from_103_to_104)	from_104_to_105)	from_105_to_106)	from_106_to_107)	from_107_to_108)	from_108_to_109)	from_109_to_110)	from_110_to_111)	from_111_to_112)	from_112_to_113)	from_113_to_114)	from_114_to_115)	from_115_to_116)	from_116_to_117)	from_117_to_118)	from_118_to_119)	from_119_to_120)	from_120_to_121)	from_121_to_122)	from_122_to_123)	from_123_to_124)	from_124_to_125)	from_125_to_126)	from_126_to_127)	from_127_to_128)	from_128_to_129)	from_129_to_130)	from_130_to_131)	from_131_to_132)	from_132_to_133)	from_133_to_134)	from_134_to_135)	from_135_to_136)	from_136_to_137)	from_137_to_138)	from_138_to_139)	from_139_to_140)	from_140_to_141)	from_141_to_142)	from_142_to_143)	from_143_to_144)	from_144_to_145)	from_145_to_146)	from_146_to_147)	from_147_to_148)	from_148_to_149)	from_149_to_150)	from_150_to_151)	from_151_to_152)	from_152_to_153)	from_153_to_154)	from_154_to_155)	from_155_to_156)	from_156_to_157)	from_157_to_158)	from_158_to_159)	from_159_to_160)	from_160_to_161)	from_161_to_162)	from_162_to_163)	from_163_to_164)	from_164_to_165)	from_165_to_166)	from_166_to_167)	from_167_to_168)	from_168_to_169)	from_169_to_170)	from_170_to_171)	from_171_to_172)	from_172_to_173)	from_173_to_174)	from_174_to_175)	from_175_to_176)	from_176_to_177)	from_177_to_178)	from_178_to_179)	from_179_to_180)	from_180_to_181)	from_181_to_182)	from_182_to_183)	from_183_to_184)	from_184_to_185)	from_185_to_186)	from_186_to_187)	from_187_to_188)	from_188_to_189)	from_189_to_190)	from_190_to_191)	from_191_to_192)	from_192_to_193)	from_193_to_194)	from_194_to_195)	from_195_to_196)	from_196_to_197)	from_197_to_198)	from_198_to_199)	from_199_to_200)	from_200_to_201)	from_201_to_202)	from_202_to_203)	from_203_to_204)	from_204_to_205)	from_205_to_206)	from_206_to_207)	from_207_to_208)	from_208_to_209)	from_209_to_210)	from_210_to_211)	from_211_to_212)	from_212_to_213)	from_213_to_214)	from_214_to_215)	from_215_to_216)	from_216_to_217)	from_217_to_218)	from_218_to_219)	from_219_to_220)	from_220_to_221)	from_221_to_222)	from_222_to_223)	from_223_to_224)	from_224_to_225)	from_225_to_226)	from_226_to_227)	from_227_to_228)	from_228_to_229)	from_229_to_230)	from_230_to_231)	from_231_to_232)	from_232_to_233)	from_233_to_234)	from_234_to_235)	from_235_to_236)	from_236_to_237)	from_237_to_238)	from_238_to_239)	from_239_to_240)	from_240_to_241)	from_241_to_242)	from_242_to_243)	from_243_to_244)	from_244_to_245)	from_245_to_246)	from_246_to_247)	from_247_to_248)	from_248_to_249)	from_249_to_250)	from_250_to_251)	from_251_to_252)	from_252_to_253)	from_253_to_254)	from_254_to_255)	from_255_to_256)	from_256_to_257)	from_257_to_258)	from_258_to_259)	from_259_to_260)	from_260_to_261)	from_261_to_262)	from_262_to_263)	from_263_to_264)	from_264_to_265)	from_265_to_266)	from_266_to_267)	from_267_to_268)	from_268_to_269)	from_269_to_270)	from_270_to_271)	from_271_to_272)	from_272_to_273)	from_273_to_274)	from_274_to_275)	from_275_to_276)	from_276_to_277)	from_277_to_278)	from_278_to_279)	from_279_to_280)	from_280_to_281)	from_281_to_282)	from_282_to_283)	from_283_to_284)	from_284_to_285)	from_285_to_286)	from_286_to_287)	from_287_to_288)	from_288_to_289)	from_289_to_290)	from_290_to_291)	from_291_to_292)	from_292_to_293)	from_293_to_294)	from_294_to_295)	from_295_to_296)	from_296_to_297)	from_297_to_298)	from_298_to_299)	from_299_to_300)	from_300_to_301)	from_301_to_302)	from_302_to_303)	from_303_to_304)	from_304_to_305)	from_305_to_306)	from_306_to_307)	from_307_to_308)	from_308_to_309)	from_309_to_310)	from_310_to_311)	from_311_to_312)	from_312_to_313)	from_313_to_314)	from_314_to_315)	from_315_to_316)	from_316_to_317)	from_317_to_318)	from_318_to_319)	from_319_to_320)	from_320_to_321)	from_321_to_322)	from_322_to_323)	from_323_to_324)	from_324_to_325)	from_325_to_326)	from_326_to_327)	from_327_to_328)	from_328_to_329)	from_329_to_330)	from_330_to_331)	from_331_to_332)	from_332_to_333)	from_333_to_334)	from_334_to_335)	from_335_to_336)	from_336_to_337)	from_337_to_338)	from_338_to_339)	from_339_to_340)	from_340_to_341)	from_341_to_342)	from_342_to_343)	from_343_to_344)	from_344_to_345)	from_345_to_346)	from_346_to_347)	from_347_to_348)	from_348_to_349)	from_349_to_350)	from_350_to_351)	from_351_to_352)	from_352_to_353)	from_353_to_354)	from_354_to_355)	from_355_to_356)	from_356_to_357)	from_357_to_358)	from_358_to_359)	from_359_to_360)	from_360_to_361)	from_361_to_362)	from_362_to_363)	from_363_to_364)	from_364_to_365)	from_365_to_366)	from_366_to_367)	from_367_to_368)	from_368_to_369)	from_369_to_370)	from_370_to_371)	from_371_to_372)	from_372_to_373)	from_373_to_374)	from_374_to_375)	from_375_to_376)	from_376_to_377)	from_377_to_378)	from_378_to_379)	from_379_to_380)	from_380_to_381)	from_381_to_382)	from_382_to_383)	from_383_to_384)	from_384_to_385)	from_385_to_386)	from_386_to_387)	from_387_to_388)	from_388_to_389)	from_389_to_390)	from_390_to_391)	from_391_to_392)	from_392_to_393)	from_393_to_394)	from_394_to_395)	from_395_to_396)	from_396_to_397)	from_397_to_398)	from_398_to_399)	from_399_to_400)	from_400_to_401)	from_401_to_402)	from_402_to_403)	from_403_to_404)	from_404_to_405)	from_405_to_406)	from_406_to_407)	from_407_to_408)	from_408_to_409)	from_409_to_410)	from_410_to_411)	from_411_to_412)	from_412_to_413)	from_413_to_414)	from_414_to_415)	from_415_to_416)	from_416_to_417)	from_417_to_418)	from_418_to_419)	from_419_to_420)	from_420_to_421)	from_421_to_422)	from_422_to_423)	from_423_to_424)	from_424_to_425)	from_425_to_426)	from_426_to_427)	from_427_to_428)	from_428_to_429)	from_429_to_430)	from_430_to_431)	from_431_to_432)	from_432_to_433)	from_433_to_434)	from_434_to_435)	from_435_to_436)	from_436_to_437)	from_437_to_438)	from_438_to_439)	from_439_to_440)	from_440_to_441)	from_441_to_442)	from_442_to_443)	from_443_to_444)	from_444_to_445)	from_445_to_446)	from_446_to_447)	from_447_to_448)	from_448_to_449)	from_449_to_450)	from_450_to_451)	from_451_to_452)	from_452_to_453)	from_453_to_454)	from_454_to_455)	from_455_to_456)	from_456_to_457)	from_457_to_458)	from_458_to_459)	from_459_to_460)	from_460_to_461)	from_461_to_462)	from_462_to_463)	from_463_to_464)	from_464_to_465)	from_465_to_466)	from_466_to_467)	from_467_to_468)	from_468_to_469)	from_469_to_470)	from_470_to_471)	from_471_to_472)	from_472_to_473)	from_473_to_474)	from_474_to_475)	from_475_to_476)	from_476_to_477)	from_477_to_478)	from_478_to_479)	from_479_to_480)	from_480_to_481)	from_481_to_482)	from_482_to_483)	from_483_to_484)	from_484_to_485)	from_485_to_486)	from_486_to_487)	from_487_to_488)	from_488_to_489)	from_489_to_490)	from_490_to_491)	from_491_to_492)	from_492_to_493)	from_493_to_494)	from_494_to_495)	from_495_to_496)	from_496_to_497)	from_497_to_498)	from_498_to_499)	from_499_to_500)	from_500_to_inf
+sample_A Fake phiX Sample	5343	2	1	2	1	1	2	2	2	1	29	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_depth_of_coverage/gatk_depth_of_coverage_out_1_output_summary_sample.tabular	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,3 @@
+sample_id	total	mean	granular_third_quartile	granular_median	granular_first_quartile	%_bases_above_15
+A Fake phiX Sample	360	0.07	1	1	1	0.0
+Total	360	0.07	N/A	N/A	N/A
Binary file test-data/gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phiX.fasta	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,79 @@
+>phiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/gatk_sorted_picard_index.loc.sample	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,26 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Picard dict and associated files. You will need
+#to create these data files and then create a picard_index.loc file 
+#similar to this one (store it in this directory) that points to 
+#the directories in which those files are stored. The picard_index.loc 
+#file has this format (longer white space is the TAB character):
+#
+#<unique_build_id>	<dbkey>		<display_name>		<fasta_file_path>
+#
+#So, for example, if you had hg18 indexed and stored in 
+#/depot/data2/galaxy/srma/hg18/,
+#then the srma_index.loc entry would look like this:
+#
+#hg18	hg18	hg18 Pretty		/depot/data2/galaxy/picard/hg18/hg18.fa
+#
+#and your /depot/data2/galaxy/srma/hg18/ directory
+#would contain the following three files:
+#hg18.fa
+#hg18.dict
+#hg18.fa.fai
+#
+#The dictionary file for each reference (ex. hg18.dict) must be 
+#created via Picard (http://picard.sourceforge.net). Note that
+#the dict file does not have the .fa extension although the
+#path list in the loc file does include it.
+#
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,8 @@
+<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc-->
+<tables>
+    <!-- Location of Picard dict files valid for GATK -->
+    <table name="gatk_picard_indexes" comment_char="#">
+        <columns>value, dbkey, name, path</columns>
+        <file path="tool-data/gatk_sorted_picard_index.loc" />
+    </table>
+</tables>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Tue Apr 01 10:50:51 2014 -0400
@@ -0,0 +1,9 @@
+<?xml version="1.0"?>
+<tool_dependency>
+  <package name="gatk" version="1.4">
+      <repository changeset_revision="ec95ec570854" name="package_gatk_1_4" owner="devteam" prior_installation_required="False" toolshed="http://toolshed.g2.bx.psu.edu" />
+    </package>
+    <package name="samtools" version="0.1.18">
+      <repository changeset_revision="171cd8bc208d" name="package_samtools_0_1_18" owner="devteam" prior_installation_required="False" toolshed="http://toolshed.g2.bx.psu.edu" />
+    </package>
+</tool_dependency>