diff emboss_isochore.xml @ 10:d49956b87f7e draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/emboss_5 commit 2bfbb5ae6b801e43355fdc3f964a5111fe3fe3a1

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_isochore.xml	Wed Feb 08 12:42:22 2017 -0500
@@ -0,0 +1,77 @@
+<tool id="EMBOSS: isochore47" name="isochore" version="5.0.0.1">
+  <description>Plots isochores in large DNA sequences</description>
+  <macros>
+    <import>macros.xml</import>
+  </macros>
+  <expand macro="requirements" />
+  <command>perl '$__tool_directory__/emboss_single_outputfile_wrapper.pl' isochore -sequence '$input1' -outfile '$ofile2' -goutfile '$ofile1' -graph png -window $window -shift $shift -auto</command>
+  <inputs>
+    <param name="input1" type="data" format="fasta" label="Sequences" />
+    <param name="window" type="integer" value="1000" label="Window size" />
+    <param name="shift" type="integer" value="100" label="Shift increment" />
+  </inputs>
+  <outputs>
+    <data name="ofile1" format="png" />
+    <data name="ofile2" format="isochore" />
+  </outputs>
+  <!-- <tests>
+    <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="window" value="1000"/>
+      <param name="shift" value="100"/>
+      <output name="ofile1" file="emboss_isochore_out.isochore"/>
+      <output name="ofile2" file="emboss_isochore_out.isochore"/>
+    </test>
+         <test>
+      <param name="input1" value="2.fasta"/>
+      <param name="window" value="1000"/>
+      <param name="shift" value="100"/>
+      <output name="ofile2" file="emboss_isochore_out.isochore"/>
+    </test>
+  </tests>-->
+  <help>
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+**Syntax**
+
+This application plots GC content over a sequence. It is intended for large sequences such as complete chromosomes or large genomic contigs, although interesting results can also be obtained from shorter sequences. You can view the original documentation here_.
+
+    .. _here: http://galaxy-iuc.github.io/emboss-5.0-docs/isochore.html
+
+- Both **Window size** and **Shift increment** are intergers.
+
+-----
+
+**Example**
+
+- Input sequences::
+
+    >hg18_dna range=chrX:151073054-151073376 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none
+    TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA
+    GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTGTCTTTATGCCTCAGATT
+    TGGAGTGCTCAGAGCCTCTGCAGCAAAGATTTGGCATGTGTCCTAGGCCT
+    GCTCAGAGCAGCAAATCCCACCCTCTTGGAGAATGAGACTCATAGAGGGA
+    CAGCTCCCTCCTCAGAGGCTTCTCTAATGGGACTCCAAAGAGCAAACACT
+    CAGCCCCATGAGGACTGGCCAGGCCAAGTGGTGTGTGGGAACAGGGAGCA
+    GCGGTTTCCAAGAGGATACAGTA
+
+- Output data file::
+
+    Position	Percent G+C 1 .. 323
+    80	0.422
+    112	0.460
+    144	0.509
+    176	0.534
+    208	0.553
+    240	0.553
+
+- Output graphics file:
+
+.. image:: ./static/emboss_icons/isochore.png
+  </help>
+  <expand macro="citations" />
+</tool>