# HG changeset patch # User iuc # Date 1524503109 14400 # Node ID 832c203296905bf8d773e8258a72034a7e675bce # Parent 1b6538ec8b560b8829320652f0f520e654d8b52e planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/emboss_5 commit ca9a6baaede679d619675e48d665748a91950115 diff -r 1b6538ec8b56 -r 832c20329690 emboss_iep.xml --- a/emboss_iep.xml Thu Feb 23 09:43:47 2017 -0500 +++ b/emboss_iep.xml Mon Apr 23 13:05:09 2018 -0400 @@ -15,7 +15,7 @@ - + diff -r 1b6538ec8b56 -r 832c20329690 emboss_tranalign.xml --- a/emboss_tranalign.xml Thu Feb 23 09:43:47 2017 -0500 +++ b/emboss_tranalign.xml Mon Apr 23 13:05:09 2018 -0400 @@ -1,82 +1,90 @@ - Align nucleic coding regions given the aligned proteins - - macros.xml - - - - tranalign -asequence '$input1' -bsequence '$input2' -outseq '$out_file1' -table $table -osformat3 $out_format1 -auto - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - You can view the original documentation here_. + Align nucleic coding regions given the aligned proteins + + macros.xml + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + - +.. _here: http://galaxy-iuc.github.io/emboss-5.0-docs/tranalign.html + ]]> + diff -r 1b6538ec8b56 -r 832c20329690 emboss_transeq.xml --- a/emboss_transeq.xml Thu Feb 23 09:43:47 2017 -0500 +++ b/emboss_transeq.xml Mon Apr 23 13:05:09 2018 -0400 @@ -1,130 +1,129 @@ - Translate nucleic acid sequences - - macros.xml - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - + Translate nucleic acid sequences + + macros.xml + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + - +.. _here: http://galaxy-iuc.github.io/emboss-5.0-docs/transeq.html + ]]> + diff -r 1b6538ec8b56 -r 832c20329690 test-data/emboss_cai_out.cai --- a/test-data/emboss_cai_out.cai Thu Feb 23 09:43:47 2017 -0500 +++ b/test-data/emboss_cai_out.cai Mon Apr 23 13:05:09 2018 -0400 @@ -1,1 +1,1 @@ -Sequence: Sequence CAI: 0.188 \ No newline at end of file +Sequence: Sequence CAI: 0.188 diff -r 1b6538ec8b56 -r 832c20329690 test-data/emboss_newcpgseek_out.newcpgseek --- a/test-data/emboss_newcpgseek_out.newcpgseek Thu Feb 23 09:43:47 2017 -0500 +++ b/test-data/emboss_newcpgseek_out.newcpgseek Mon Apr 23 13:05:09 2018 -0400 @@ -6,4 +6,4 @@ Begin End Score CpG %CG CG/GC 121 141 34 3 57.1 1.00 261 272 43 3 75.0 1.00 -------------------------------------------- \ No newline at end of file +------------------------------------------- diff -r 1b6538ec8b56 -r 832c20329690 test-data/emboss_tranalign_out.fasta --- a/test-data/emboss_tranalign_out.fasta Thu Feb 23 09:43:47 2017 -0500 +++ b/test-data/emboss_tranalign_out.fasta Mon Apr 23 13:05:09 2018 -0400 @@ -42,4 +42,4 @@ ctgactaccctggaagtaggccgcatgctttttgga---ggtaaagttcatggttccctg gcccgtgctggaaaagtgagaggtcagactcctaaggtggccaaacaggagaagaagaag aagaagacaggtcgggctaagcggcggatgcagtacaaccggcgctttgtcaacgttgtg -cccacctttggcaagaagaagggccccaatgccaactct \ No newline at end of file +cccacctttggcaagaagaagggccccaatgccaactct