# HG changeset patch # User devteam # Date 1324407765 18000 # Node ID b94ca591877ba8c79c517c43e16a2b57024b7884 Uploaded emboss_5.tar diff -r 000000000000 -r b94ca591877b emboss_5/emboss_antigenic.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/emboss_5/emboss_antigenic.xml Tue Dec 20 14:02:45 2011 -0500 @@ -0,0 +1,58 @@ + + Predicts potentially antigenic regions of a protein sequence, using the method of Kolaskar and Tongaonkar. + emboss + antigenic -sequence $input1 -outfile $out_file1 -minlen $minlen -rformat2 $out_format1 -auto + + + On query + + + Minimum Length of region + + + Output format + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +


+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/antigenic.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+    
+  
+


\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_backtranseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_backtranseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,228 @@
+
+  Back translate a protein sequence
+  emboss
+  backtranseq -sequence $input1 -outfile $out_file1 -cfile $cfile -osformat2 $out_format1 -auto
+  
+    
+      On query
+    
+    
+      Codon Usage File
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark 
+
+The input dataset needs to be sequences. 
+
+----- 
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/backtranseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_banana.pl
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_banana.pl	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,16 @@
+#! /usr/bin/perl -w
+use strict;
+
+my $cmd_string = join (" ",@ARGV);
+#my $cmd_string = "/home/djb396/temp/emboss/bin/banana -sequence /home/djb396/universe-prototype/test.fasta -outfile result.txt -graph png -goutfile results -auto";
+my $results = `$cmd_string`;
+my @files = split("\n",$results);
+foreach my $thisLine (@files)
+{
+	if ($thisLine =~ /Created /i)
+	{
+		$thisLine =~ /[\w|\.]+$/;
+		$thisLine =$&;
+		print "outfile: $thisLine\n";
+	}
+}
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_banana.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_banana.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,32 @@
+
+  Bending and curvature plot in B-DNA
+  emboss
+  banana -sequence $input1 -outfile $out_file1 -graph none -auto
+  
+    
+      On query
+    
+  
+  
+    
+  
+  
+    
+      
+      
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/banana.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_biosed.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_biosed.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,81 @@
+
+  Replace or delete sequence sections
+  emboss
+  biosed -sequence $input1 -outseq $out_file1 -target "$target" -replace "$replace" -osformat2 "$out_format1" -auto
+  
+    
+      On query
+    
+    
+      Replace all
+    
+    
+      with
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark 
+
+The input dataset needs to be sequences. 
+
+----- 
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/biosed.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_btwisted.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_btwisted.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,32 @@
+
+  Calculates the twisting in a B-DNA sequence
+  emboss
+  btwisted -sequence $input1 -outfile $out_file1 -auto
+  
+    
+      On query
+    
+  
+  
+    
+  
+  
+    
+      
+      
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/btwisted.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_cai.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cai.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,193 @@
+
+  CAI codon adaptation index
+  emboss
+  cai -seqall $input1 -outfile $out_file1 -cfile $cfile -auto
+  
+    
+      On query
+    
+    
+      Codon Usage File
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+    
+  
+  
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cai.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_cai_custom.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cai_custom.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,35 @@
+
+  CAI codon adaptation index using custom codon usage file
+  emboss
+  cai -seqall $input1 -outfile $out_file1 -cfile $input2 -auto
+  
+    
+      On query
+    
+    
+      Codon Usage File
+    
+  
+  
+    
+  
+  
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cai_custom.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_chaos.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_chaos.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,31 @@
+
+  Create a chaos game representation plot for a sequence
+  emboss
+  emboss_single_outputfile_wrapper.pl chaos -sequence $input1 -graph png -goutfile $out_file1 -auto
+  
+    
+      On query
+    
+  
+  
+    
+  
+
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/chaos.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_charge.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_charge.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,43 @@
+
+  Protein charge plot
+  emboss
+  charge -seqall $input1 -outfile $out_file1 -window $window -auto
+  
+    
+      On query
+    
+    
+      Window Size
+    
+  
+  
+    
+  
+  
+  
+
+.. class:: warningmark 
+
+The input dataset needs to be sequences. 
+
+----- 
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/charge.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_checktrans.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_checktrans.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,95 @@
+
+  Reports STOP codons and ORF statistics of a protein
+  emboss
+  checktrans -sequence $input1 -outfile $out_file1 -outseq $out_file2 -osformat3 $out_format2 -outfeat $out_file3 -offormat4 $out_format3 -orfml $orfml -addlast $addlast -auto
+  
+    
+      On query
+    
+    
+      Minimum ORF Length to report
+    
+    
+      An asterisk in the protein sequence indicates the position of a STOP codon. Checktrans assumes that all ORFs end in a STOP codon. Forcing the sequence to end with an asterisk, if there
+      is not one there already, makes checktrans treat the end as a potential ORF. If an asterisk is added, it is not included in the reported count of STOPs
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Output Feature File Format
+      
+      
+      
+    
+  
+  
+    
+    
+    
+  
+ 
+  
+  
+
+.. class:: warningmark 
+
+The input dataset needs to be sequences. 
+
+----- 
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/checktrans.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_chips.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_chips.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,38 @@
+
+  Codon usage statistics
+  emboss
+  chips -seqall $input1 -outfile $out_file1 -sum $sum -auto
+  
+    
+      On query
+    
+    
+      Sum codons over all sequences
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/chips.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_cirdna.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cirdna.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,31 @@
+
+  Draws circular maps of DNA constructs
+  emboss
+  emboss_single_outputfile_wrapper.pl cirdna -infile $input1 -graphout png -goutfile $out_file1 -auto
+  
+    
+      On query
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cirdna.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_codcmp.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_codcmp.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,338 @@
+
+  Codon usage table comparison
+  emboss
+  codcmp -first $cfile1 -second $cfile2 -outfile $out_file1 -auto
+  
+    
+      Codon Usage File 1
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Codon Usage File 2
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/codcmp.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_coderet.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_coderet.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,81 @@
+
+  Extract CDS, mRNA and translations from feature tables
+  emboss
+  
+  coderet -seqall $input1 -outfile $out_file1 -auto
+  
+    
+      On query
+    
+    
+  
+  
+    
+  
+  
+    
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/coderet.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_compseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_compseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,50 @@
+
+  Count composition of dimer/trimer/etc words in a sequence
+  emboss
+  compseq -sequence $input1 -outfile $out_file1 -word $word -frame $frame -auto
+  
+    
+      On query
+    
+    
+      Size of word (window) to count
+    
+    
+      Frame to inspect
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+    
+  
+  
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/compseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_cpgplot.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cpgplot.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,41 @@
+
+  Plot CpG rich areas
+  emboss
+  emboss_cpgplot_wrapper.pl cpgplot -sequence $input1 -window $window -minlen $minlen -minpc $minpc -outfile $outfile -graph png -goutfile $goutfile -outfeat $outfeat -minoe $minoe -auto
+  
+    
+      On query
+    
+    
+      Window Size
+    
+    
+      Minimum length
+    
+    
+      Minimum average observed to expected ratio
+    
+    
+      Minimum average percentage of G plus C
+    
+  
+  
+    
+    
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cpgplot.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_cpgplot_wrapper.pl
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cpgplot_wrapper.pl	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,9 @@
+#! /usr/bin/perl -w
+use strict;
+use File::Copy;
+
+my $cmd_string = join (" ",@ARGV);
+my $results = `$cmd_string`;
+my @files = split("\n",$results);
+my $fileNameOut = $ARGV[14];
+move($fileNameOut.".1.png",$fileNameOut);
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_cpgreport.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cpgreport.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,57 @@
+
+  Reports all CpG rich regions
+  emboss
+  cpgreport -sequence $input1 -outfile $out_file1 -outfeat $out_file2 -offormat3 $out_format2 -score $score -auto
+  
+    
+      On query
+    
+    
+      Score for each CG sequence found (1-200)
+    
+    
+      Output Feature File Format
+      
+      
+      
+    
+  
+  
+    
+    
+  
+  
+    
+      
+      
+      
+      
+    
+    
+  
+  
+  
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cpgreport.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_cusp.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cusp.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,38 @@
+
+  Create a codon usage table
+  emboss
+  cusp -sequence $input1 -outfile $out_file1 -auto
+  
+    
+      On query
+    
+  
+  
+    
+  
+  
+    
+      
+      
+    
+  
+  
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cusp.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_cutseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_cutseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,80 @@
+
+  Removes a specified section from a sequence
+  emboss
+  cutseq -sequence $input1 -outseq $out_file1 -from $from -to $to -osformat2 $out_format1 -auto
+  
+    
+      On query
+    
+    
+      Start of region to delete
+    
+    
+      End of region to delete
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+    
+  
+  
+  
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/cutseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_dan.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_dan.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,92 @@
+
+  Calculates DNA RNA/DNA melting temperature
+  emboss
+  emboss_single_outputfile_wrapper.pl dan -sequence $input1 -windowsize $window -goutfile $out_file1 -graph png -plot $plot1 -shiftincrement $shift -dnaconc $dnaconc
+  -saltconc $saltconc -product $product -formamide $formamide -mismatch $mismatch -prodlen $prodlen -thermo $thermo -temperature $temperature -rna $rna -outfile $out_file1 -auto
+  
+    
+      On query
+    
+    
+      Window Size
+    
+    
+      Step size (shift increment)
+    
+    
+      DNA Concentration (nM)
+    
+    
+      Salt concentration (mM)
+    
+    
+      Output the DeltaG, DeltaH and DeltaS values
+      
+      
+    
+    
+      Temperature at which to calculate the DeltaG, DeltaH and DeltaS values
+    
+    
+      Sequence is RNA
+      
+      
+    
+    
+      Include percent formamide, percent of mismatches allowed and product length
+      
+      
+    
+    
+      Formamide concentration (nM)
+    
+    
+      Percent mismatch to be used in calculations
+    
+    
+      Product length to be used in calculations
+    
+    
+      Create a graph
+      
+      
+    
+  
+  
+    
+  
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/dan.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_degapseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_degapseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,66 @@
+
+  Removes gap characters from sequences
+  emboss
+  degapseq -sequence $input1 -outseq $out_file1 -osformat2 $out_format1 -auto
+  
+    
+      On query
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/degapseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_descseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_descseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,80 @@
+
+  Alter the name or description of a sequence
+  emboss
+  descseq -sequence $input1 -outseq $out_file1 -name "$seqname" -description "$desc" -append $append -osformat2 $out_format1 -auto
+  
+    
+      On query
+    
+    
+      Name of the sequence
+    
+    
+      Description of the sequence
+    
+    
+      Append the name or description on to the end of the existing name or description
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/descseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_diffseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_diffseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,72 @@
+
+  Find differences between nearly identical sequences
+  emboss
+  diffseq -asequence $input1 -bsequence $input2 -outfile $out_file1 -aoutfeat $out_file2 -boutfeat $out_file3 -wordsize $wordsize -globaldifferences $globaldifferences -rformat3
+  $out_format1 -offormat4 $out_format2 -offormat5 $out_format3 -auto
+  
+    
+      Sequence 1
+    
+    
+      Sequence 2
+    
+    
+      Wordsize
+    
+    
+      Report differences at the ends
+      
+      
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Sequence 1 Output Feature File Format
+      
+      
+      
+    
+    
+      Sequence 2 Output Feature File Format
+      
+      
+      
+    
+  
+  
+    
+    
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/diffseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_digest.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_digest.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,73 @@
+
+  Protein proteolytic enzyme or reagent cleavage digest
+  emboss
+  digest -seqall $input1 -outfile $out_file1 -menu $menu -unfavoured $unfavoured -overlap $overlap -allpartials $allpartials -rformat2 $out_format1 -auto
+  
+    
+      Sequence
+    
+    
+      Enzyme/Reagent
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Trypsin will not normally cut after a K if it is followed by (e.g.) another K or a P. Specifying this shows those cuts, as well as the favoured ones.
+      
+      
+    
+    
+      Used for partial digestion. Shows all cuts from favoured cut sites plus 1..3, 2..4, 3..5 etc but not (e.g.) 2..5. Overlaps are therefore fragments with exactly one potential cut site
+      within it.
+      
+      
+    
+    
+      As for overlap but fragments containing more than one potential cut site are included.
+      
+      
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/digest.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_dotmatcher.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_dotmatcher.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,37 @@
+
+  Displays a thresholded dotplot of two sequences
+  emboss
+  emboss_single_outputfile_wrapper.pl dotmatcher -asequence $input1 -bsequence $input2 -goutfile $out_file1 -windowsize $windowsize -threshold $threshold -graph png -xygraph png
+  -auto
+  
+    
+      Sequence 1
+    
+    
+      Sequence 2
+    
+    
+      Window size
+    
+    
+      Threshold
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/dotmatcher.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_dotpath.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_dotpath.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,44 @@
+
+  Non-overlapping wordmatch dotplot of two sequences
+  emboss
+  emboss_single_outputfile_wrapper.pl dotpath -asequence $input1 -bsequence $input2 -goutfile $out_file1 -wordsize $wordsize -overlaps $overlaps -boxit $boxit -graph png
+  -auto
+  
+    
+      Sequence 1
+    
+    
+      Sequence 2
+    
+    
+      Word size (Integer 2 or more)
+    
+    
+      Display the overlapping matches (in red) as well as the minimal set of non-overlapping matches
+      
+      
+    
+    
+      Draw a box around dotplot
+      
+      
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/dotpath.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_dottup.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_dottup.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,38 @@
+
+  Displays a wordmatch dotplot of two sequences
+  emboss
+  emboss_single_outputfile_wrapper.pl dottup -asequence $input1 -bsequence $input2 -goutfile $out_file1 -wordsize $wordsize -boxit $boxit -graph png  -xygraph png -auto
+  
+    
+      Sequence 1
+    
+    
+      Sequence 2
+    
+    
+      Word size
+    
+    
+      Draw a box around dotplot
+      
+      
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/dottup.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_dreg.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_dreg.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,30 @@
+
+  Regular expression search of a nucleotide sequence
+  emboss
+  dreg -sequence $input1 -outfile $out_file1 -pattern "$pattern" -raccshow3 "no" -rusashow3 "no" -rdesshow3 "no" -auto
+  
+    
+      Sequence 1
+    
+    
+      Regular expression pattern
+    
+  
+  
+    
+  
+    
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/dreg.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_einverted.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_einverted.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,58 @@
+
+  Finds DNA inverted repeats
+  emboss
+  einverted -sequence $input1 -outfile $out_file1 -gap $gap -threshold $threshold -match $match -mismatch $mismatch -maxrepeat $maxrepeat -auto
+  
+    
+      On query
+    
+    
+      Gap penalty
+    
+    
+      Minimum score threshold
+    
+    
+      Match score
+    
+    
+      Mismatch score
+    
+    
+      Maximum separation between the start of repeat and the end of the inverted repeat
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/einverted.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_epestfind.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_epestfind.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,73 @@
+
+  Finds PEST motifs as potential proteolytic cleavage sites
+  emboss
+  emboss_single_outputfile_wrapper.pl epestfind -sequence $input1 -goutfile $ofile2 -outfile $ofile1 -window $window -order $order -potential $potential -poor $poor
+  -invalid $invalid -map $map -graph png -auto
+  
+    
+      Sequence
+    
+    
+      Minimal distance between positively charged amino acids
+    
+    
+      Sort by
+      
+      
+      
+    
+    
+      Threshold value to discriminate weak from potential PEST motifs.
+    
+    
+      Decide whether potential PEST motifs should be printed
+      
+      
+    
+    
+      Decide whether poor PEST motifs should be printed
+      
+      
+    
+    
+      Decide whether invalid PEST motifs should be printed
+      
+      
+    
+    
+      Decide whether PEST motifs should be mapped to sequence
+      
+      
+    
+  
+  
+    
+    
+  
+
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/epestfind.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_equicktandem.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_equicktandem.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,68 @@
+
+  Finds tandem repeats
+  emboss
+  equicktandem -sequence $input1 -outfile $out_file1 -origfile $ofile2 -maxrepeat $maxrepeat -threshold $threshold -rformat2 $out_format1 -auto
+  
+    
+      Sequence
+    
+    
+      Maximum repeat size
+    
+    
+      Threshold score
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+    
+  
+    
+    
+      
+      
+      
+      
+      
+    
+  
+  
+  
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/equicktandem.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_est2genome.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_est2genome.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,111 @@
+
+  Align EST and genomic DNA sequences
+  emboss
+  est2genome -estsequence $input1 -genomesequence $input2 -outfile $out_file1 -match $match -mismatch $mismatch -gappenalty $gappenalty -intronpenalty $intronpenalty -splicepenalty
+  $splicepenalty -minscore $minscore -reverse $reverse -splice $splice -mode $mode -best $best -shuffle $shuffle -seed $seed -align $align -width $width -auto
+  
+    
+      EST sequence(s)
+    
+    
+      Genomic sequence
+    
+    
+      Score for matching two bases
+    
+    
+      Cost for mismatching two bases
+    
+    
+      Cost for deleting a single base in either sequence, excluding introns
+    
+    
+      Cost for an intron, independent of length
+    
+    
+      Cost for an intron, independent of length and starting/ending on donor-acceptor sites
+    
+    
+      Exclude alignments with scores below this threshold score
+    
+    
+      Reverse the orientation of the EST sequence
+      
+      
+    
+    
+      Use donor and acceptor splice sites
+      
+      
+    
+    
+      Comparison mode
+      
+      
+      
+    
+    
+      Only best comparisons
+      
+      
+    
+    
+      Shuffle
+    
+    
+      Random number seed
+    
+    
+      Show the alignment
+      
+      
+    
+    
+      Alignment width
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/est2genome.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_etandem.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_etandem.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,86 @@
+
+  Looks for tandem repeats in a nucleotide sequence
+  emboss
+  etandem -sequence $input1 -outfile $out_file1 -origfile $ofile2 -minrepeat $minrepeat -maxrepeat $maxrepeat -threshold $threshold -mismatch $mismatch -uniform $uniform -rformat2 $out_format1 -auto
+  
+    
+      Sequence
+    
+    
+      Minimum repeat size
+    
+    
+      Maximum repeat size
+    
+    
+      Threshold score
+    
+    
+      Allow N as a mismatch
+      
+      
+    
+    
+      Allow uniform consensus
+      
+      
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+        
+  
+    
+    
+      
+      
+      
+      
+      
+       
+      
+      
+    
+  
+  
+  
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/etandem.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
+
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_extractfeat.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_extractfeat.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,104 @@
+
+    
+  Extract features from a sequence
+  emboss
+  extractfeat -sequence $input1 -outseq $out_file1 -before $before -after $after -source "$source" -type "$type" -sense $sense -minscore $minscore -maxscore $maxscore -tag "$tag" -value
+  "$value" -join $join -featinname $featinname -describe "$describe" -osformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Number of bases or residues before the feature to include in the extracted sequence
+    
+    
+      Number of bases or residues after the feature to include in the extracted sequence
+    
+    
+      Feature source
+    
+    
+      Feature type
+    
+    
+      Feature sense
+      
+      
+      
+    
+    
+      Minimum score
+    
+    
+      Maximum score
+    
+    
+      Feature tags
+    
+    
+      Tag values
+    
+    
+      Join features
+      
+      
+    
+    
+      Put feature type in sequence name
+      
+      
+    
+    
+      Specify one or more tag names that should be added to the output sequence Description text
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/extractfeat.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_extractseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_extractseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,76 @@
+
+  Extract regions from a sequence
+  emboss
+  extractseq -sequence $input1 -outseq $out_file1 -regions $regions -separate $separate -osformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Regions to extract
+    
+    
+      Write each specified region as a separate sequence
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/extractseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_format_corrector.py
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_format_corrector.py	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,53 @@
+#EMBOSS format corrector
+
+import operator
+#from galaxy import datatypes
+
+#Properly set file formats after job run
+def exec_after_process( app, inp_data, out_data, param_dict,tool, stdout, stderr):
+#Properly set file formats before job run
+#def exec_before_job(trans, inp_data, out_data, param_dict,tool):
+    #why isn't items an ordered list?
+    items = out_data.items()
+    #lets sort it ourselves....
+    items = sorted(items, key=operator.itemgetter(0))
+    #items is now sorted...
+    
+    #normal filetype correction
+    data_count=1
+    for name, data in items:
+        outputType = param_dict.get( 'out_format'+str(data_count), None )
+        #print "data_count",data_count, "name", name, "outputType", outputType
+        if outputType !=None:
+            if outputType == 'ncbi':
+                outputType = "fasta"
+            elif outputType == 'excel':
+                outputType = "tabular"
+            elif outputType == 'text':
+                outputType = "txt"
+            data = app.datatypes_registry.change_datatype(data, outputType)
+            app.model.context.add( data )
+            app.model.context.flush()
+        data_count+=1
+    
+    #html filetype correction
+    data_count=1
+    for name, data in items:
+        wants_plot = param_dict.get( 'html_out'+str(data_count), None )
+        ext = "html"
+        if wants_plot == "yes":
+            data = app.datatypes_registry.change_datatype(data, ext)
+            app.model.context.add( data )
+            app.model.context.flush()
+        data_count+=1
+    
+    #png file correction
+    data_count=1
+    for name, data in items:
+        wants_plot = param_dict.get( 'plot'+str(data_count), None )
+        ext = "png"
+        if wants_plot == "yes":
+            data = app.datatypes_registry.change_datatype(data, ext)
+            app.model.context.add( data )
+            app.model.context.flush()
+        data_count+=1
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_freak.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_freak.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,44 @@
+
+  Residue/base frequency table or plot
+  emboss
+  freak -seqall $input1 -outfile $out_file1 -window $window -letters $letters -graph png -step $step -auto
+  
+    
+      Sequences
+    
+    
+      Residue letters
+    
+    
+      Stepping value
+    
+    
+      Averaging window
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/freak.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_fuzznuc.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_fuzznuc.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,83 @@
+
+  Nucleic acid pattern search
+  emboss
+  fuzznuc -sequence $input1 -outfile $out_file1 -pattern '$pattern' -pmismatch $mismatch -complement $complement -rformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Search pattern
+      
+        
+         
+        
+        
+          
+        
+      
+    
+    
+      Number of mismatches
+    
+    
+      Search complementary strand
+      
+      
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/fuzznuc.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_fuzzpro.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_fuzzpro.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,52 @@
+
+  Protein pattern search
+  emboss
+  fuzzpro -sequence $input1 -outfile $out_file1 -pattern "$pattern" -pmismatch $mismatch -rformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Search pattern
+    
+    
+      Number of mismatches
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/fuzzpro.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_fuzztran.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_fuzztran.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,103 @@
+
+  Protein pattern search after translation
+  emboss
+  fuzztran -sequence $input1 -outfile $out_file1 -pattern "$pattern" -pmismatch $mismatch -frame $frame -table $table -rformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Search pattern
+    
+    
+      Number of mismatches
+    
+    
+      Frame(s) to translate
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Code to use
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/fuzztran.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_garnier.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_garnier.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,66 @@
+
+  Predicts protein secondary structure
+  emboss
+  garnier -sequence $input1 -outfile $out_file1 -idc $idc -rformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      In their paper, GOR mention that if you know something about the secondary structure content of the protein you are analyzing, you can do better in prediction. 'idc' is an index into a
+      set of arrays, dharr[] and dsarr[], which provide 'decision constants' (dch, dcs), which are offsets that are applied to the weights for the helix and sheet (extend) terms. So, idc=0 says don't
+      use the decision constant offsets, and idc=1 to 6 indicates that various combinations of dch,dcs offsets should be used
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/4.0/emboss/apps/garnier.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_geecee.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_geecee.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,32 @@
+
+  Calculates fractional GC content of nucleic acid sequences
+  emboss
+  geecee -sequence $input1 -outfile $out_file1 -auto
+  
+    
+      Sequences
+    
+  
+  
+    
+  
+  
+    
+      
+      
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/geecee.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_getorf.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_getorf.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,137 @@
+
+  Finds and extracts open reading frames (ORFs)
+  emboss
+  getorf -sequence $input1 -outseq $out_file1 -table $table -minsize $minsize -maxsize $maxsize -find $find -methionine $methionine -circular $circular -reverse $reverse -flanking $flanking
+  -osformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Code to use
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Minimum nucleotide size of ORF to report
+    
+    
+      Maximum nucleotide size of ORF to report
+    
+    
+      What to output
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      All START codons to code for Methionine
+      
+      
+    
+    
+      Circular sequence
+      
+      
+    
+    
+      Find ORFs in the reverse complement
+      
+      
+    
+    
+      Number of flanking nucleotides to output
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/getorf.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_helixturnhelix.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_helixturnhelix.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,71 @@
+
+  Report nucleic acid binding motifs
+  emboss
+  helixturnhelix -sequence $input1 -outfile $out_file1 -mean $mean -sd $sd -minsd $minsd -eightyseven $eightyseven -rformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Mean value
+    
+    
+      Standard Deviation value
+    
+    
+      Minimum SD
+    
+    
+      Use the old (1987) weight data
+      
+      
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/helixturnhelix.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_hmoment.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_hmoment.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,40 @@
+
+  Hydrophobic moment calculation
+  emboss
+  hmoment -seqall $input1 -outfile $out_file1 -window $window -aangle $aangle -graph png -auto
+  
+    
+      Sequences
+    
+    
+      Window
+    
+    
+      Alpha helix angle (degrees)
+    
+  
+  
+    
+  
+    
+    
+      
+      
+      
+      
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/hmoment.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_iep.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_iep.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,46 @@
+
+  Calculates the isoelectric point of a protein
+  emboss
+  iep -sequence $input1 -outfile $out_file1 -step $step -amino $amino -graph png -termini $termini -auto
+  
+    
+      Sequences
+    
+    
+      Step value for pH
+    
+    
+      Number of N-termini
+    
+    
+      Include charge at N and C terminus
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/iep.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_infoseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_infoseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,84 @@
+
+  
+  Displays some simple information about sequences
+  emboss
+  infoseq -sequence $input1 -outfile $out_file1 -html $html_out1 -heading $heading -usa $usa -name $disname -accession $accession -gi $gi -version $version -type $type -length $length -pgc
+  $pgc -description $description -auto
+  
+    
+      Sequences
+    
+    
+      Format output as an HTML table
+      
+      
+    
+    
+      Display column headings
+      
+      
+    
+    
+      Display the USA of the sequence
+      
+      
+    
+    
+      Display 'name' column
+      
+      
+    
+    
+      Display 'accession' column
+      
+      
+    
+    
+      Display 'GI' column
+      
+      
+    
+    
+      Display 'version' column
+      
+      
+    
+    
+      Display 'type' column
+      
+      
+    
+    
+      Display 'length' column
+      
+      
+    
+    
+      Display 'percent GC content' column
+      
+      
+    
+    
+      Display 'description' column
+      
+      
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/infoseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_infoseq_wrapper.pl
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_infoseq_wrapper.pl	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,9 @@
+#! /usr/bin/perl -w
+use strict;
+
+my $cmd_string = join (" ",@ARGV);
+my $results = `$cmd_string`;
+if ($ARGV[6]=~/yes/)
+{
+	print "Extension: html\n";
+}
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_isochore.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_isochore.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,90 @@
+
+  Plots isochores in large DNA sequences
+  emboss
+  emboss_single_outputfile_wrapper.pl isochore -sequence $input1 -outfile $ofile2 -goutfile $ofile1 -graph png -window $window -shift $shift -auto
+  
+  
+    
+      Sequences
+    
+    
+      Window size
+    
+    
+      Shift increment
+    
+  
+  
+    
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+**Syntax**
+
+This application plots GC content over a sequence. It is intended for large sequences such as complete chromosomes or large genomic contigs, although interesting results can also be obtained from shorter sequences. You can view the original documentation here_.    
+
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/isochore.html
+
+- Both **Window size** and **Shift increment** are intergers.
+
+-----
+
+**Example**
+
+- Input sequences::
+
+    >hg18_dna range=chrX:151073054-151073376 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none
+    TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA
+    GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTGTCTTTATGCCTCAGATT
+    TGGAGTGCTCAGAGCCTCTGCAGCAAAGATTTGGCATGTGTCCTAGGCCT
+    GCTCAGAGCAGCAAATCCCACCCTCTTGGAGAATGAGACTCATAGAGGGA
+    CAGCTCCCTCCTCAGAGGCTTCTCTAATGGGACTCCAAAGAGCAAACACT
+    CAGCCCCATGAGGACTGGCCAGGCCAAGTGGTGTGTGGGAACAGGGAGCA
+    GCGGTTTCCAAGAGGATACAGTA
+
+- Output data file::
+
+    Position	Percent G+C 1 .. 323
+    80	0.422
+    112	0.460
+    144	0.509
+    176	0.534
+    208	0.553
+    240	0.553
+
+- Output graphics file:
+
+.. image:: ./static/emboss_icons/isochore.png
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_lindna.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_lindna.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,107 @@
+
+  
+  Draws linear maps of DNA constructs
+  emboss
+  lindna -infile $input1 -graphout png -goutfile $out_file1 -ruler $ruler -blocktype $blocktype -maxgroups $maxgroups -maxlabels $maxlabels -intersymbol $intersymbol -intercolour $intercolour
+  -interticks $interticks -gapsize $gapsize -ticklines $ticklines -textheight $textheight -textlength $textlength -margin $margin -tickheight $tickheight -blockheight $blockheight -rangeheight
+  $rangeheight -gapgroup $gapgroup -postext $postext -auto
+  
+    
+      Sequences
+    
+    
+      Draw a ruler
+      
+      
+    
+    
+      Type of blocks
+      
+      
+      
+    
+    
+      Maximum number of groups
+    
+    
+      Maximum number of labels
+    
+    
+      Type of blocks
+      
+    
+    
+      Colour of junctions between blocks
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Horizontal junctions between ticks
+      
+      
+    
+    
+      Interval between ticks in the ruler
+    
+    
+      Vertical lines at the ruler's ticks
+      
+      
+    
+    
+      Height of text. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively
+    
+    
+      Length of text. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively
+    
+    
+      Width of left margin. This is the region left to the groups where the names of the groups are displayed. Enter a number <1.0 or >1.0 to decrease or increase the size,
+      respectively
+    
+    
+      Height of ticks. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively
+    
+    
+      Height of blocks. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively
+    
+    
+      Height of range ends. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively
+    
+    
+      Space between groups. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively
+    
+    
+      Space between text and ticks, blocks, and ranges. Enter a number <1.0 or >1.0 to decrease or increase the size, respectively
+    
+  
+  
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/lindna.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_marscan.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_marscan.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,53 @@
+
+  Finds MAR/SAR sites in nucleic sequences
+  emboss
+  marscan -sequence $input1 -outfile $out_file1 -rformat2 $out_format1 -auto
+  
+    
+      Sequence
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/marscan.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_maskfeat.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_maskfeat.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,80 @@
+
+  Mask off features of a sequence
+  emboss
+  maskfeat -sequence $input1 -outseq $out_file1 -type "$type" -tolower $tolower -maskchar "$maskchar" -osformat2 $out_format1 -auto
+  
+    
+      Sequence
+    
+    
+      Feature to mask
+    
+    
+      Mask features by converting to lowercase
+      
+      
+    
+    
+      Character to mask with
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/maskfeat.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_maskseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_maskseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,80 @@
+
+  Mask off regions of a sequence
+  emboss
+  maskseq -sequence $input1 -outseq $out_file1 -regions "$regions" -tolower $tolower -maskchar "$maskchar" -osformat2 $out_format1 -auto
+  
+    
+      Sequence
+    
+    
+      Regions to mask (Example 1-99)
+    
+    
+      mask by converting to lowercase
+      
+      
+    
+    
+      Character to use when masking
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/maskseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_matcher.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_matcher.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,65 @@
+
+  Finds the best local alignments between two sequences
+  emboss
+  matcher -asequence $input1 -bsequence $input2 -outfile $out_file1 -alternatives $alternatives -gapopen $gapopen -gapextend $gapextend -aformat3 $out_format1 -auto
+  
+    
+      Sequence 1
+    
+    
+      Sequence 2
+    
+    
+      Number of alternative matches
+    
+    
+      Gap penalty
+    
+    
+      Gap length (extension) penalty
+    
+    
+      Output Alignment File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/matcher.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_megamerger.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_megamerger.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,71 @@
+
+  Merge two large overlapping nucleic acid sequences
+  emboss
+  megamerger -asequence $input1 -bsequence $input2 -outseq $out_file1 -outfile $out_file2 -wordsize $wordsize -prefer $prefer -osformat3 $out_format1 -auto
+  
+    
+      Sequence 1
+    
+    
+      Sequence 2
+    
+    
+      Word size
+    
+    
+      Prefer first sequence when mismatches occur
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/megamerger.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_merger.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_merger.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,84 @@
+
+  Merge two overlapping nucleic acid sequences
+  emboss
+  merger -asequence $input1 -bsequence $input2 -outseq $out_file1 -outfile $out_file2 -gapopen $gapopen -gapextend $gapextend -osformat4 $out_format1 -aformat3 $out_format2 -auto
+  
+    
+      Sequence 1
+    
+    
+      Sequence 2
+    
+    
+      Gap opening penalty
+    
+    
+      Gap extension penalty
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Output Alignment File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/merger.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_msbar.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_msbar.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,125 @@
+
+  Mutate sequence beyond all recognition
+  emboss
+  msbar -sequence $input1 -outseq $out_file1 -count $count -point $point -block $block -codon $codon -inframe $inframe -minimum $minimum -maximum $maximum -osformat2 $out_format1
+  -auto
+  
+    
+      Sequence 1
+    
+    
+      Number of times to perform the mutation operations
+    
+    
+      Types of point mutations to perform
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Types of block mutations to perform
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Types of codon mutations to perform. These are only done if the sequence is nucleic
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Do 'codon' and 'block' operations in frame
+      
+      
+    
+    
+      Minimum size for a block mutation
+    
+    
+      Maximum size for a block mutation
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/msbar.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_multiple_outputfile_wrapper.pl
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_multiple_outputfile_wrapper.pl	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,19 @@
+#! /usr/bin/perl -w
+use strict;
+
+my $cmd_string = join (" ",@ARGV);
+my $results = `$cmd_string`;
+my @files = split("\n",$results);
+foreach my $thisLine (@files)
+{
+	if ($thisLine =~ /Created /)
+	{
+		$thisLine =~ /[\w|\.]+$/;
+		$thisLine =$&;
+		print "outfile: $thisLine\n";
+	}
+	else
+	{
+		print $thisLine,"\n";
+	}
+}
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_needle.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_needle.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,134 @@
+
+  Needleman-Wunsch global alignment
+  emboss
+  needle -asequence $input1 -bsequence $input2 -outfile $out_file1 -gapopen $gapopen -gapextend $gapextend -brief $brief -aformat3 $out_format1 -auto
+  
+    
+      Sequence 1
+    
+    
+      Sequence 2
+    
+    
+      Gap open penalty
+    
+    
+      Gap extension penalty
+    
+    
+      Brief identity and similarity
+      
+      
+    
+    
+      Output Alignment File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+needle reads any two sequences of the same type (DNA or protein).
+
+-----
+
+**Syntax**
+
+This tool uses the Needleman-Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length. 
+
+- **Optimal alignment:** Dynamic programming methods ensure the optimal global alignment by exploring all possible alignments and choosing the best.
+
+- **The Needleman-Wunsch algorithm** is a member of the class of algorithms that can calculate the best score and alignment in the order of mn steps, (where 'n' and 'm' are the lengths of the two sequences).
+
+- **Gap open penalty:** [10.0 for any sequence] The gap open penalty is the score taken away when a gap is created. The best value depends on the choice of comparison matrix. The default value assumes you are using the EBLOSUM62 matrix for protein sequences, and the EDNAFULL matrix for nucleotide sequences. (Floating point number from 1.0 to 100.0)
+
+- **Gap extension penalty:** [0.5 for any sequence] The gap extension, penalty is added to the standard gap penalty for each base or residue in the gap. This is how long gaps are penalized. Usually you will expect a few long gaps rather than many short gaps, so the gap extension penalty should be lower than the gap penalty. An exception is where one or both sequences are single reads with possible sequencing errors in which case you would expect many single base gaps. You can get this result by setting the gap open penalty to zero (or very low) and using the gap extension penalty to control gap scoring. (Floating point number from 0.0 to 10.0)
+
+You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/needle.html
+
+-----
+
+**Example**
+
+- Input File::
+
+    >hg18_dna range=chrX:151073054-151073136 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none
+    TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA
+    GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG
+
+- If both Sequence1 and Sequence2 take the above file as input, Gap open penalty equals 10.0, Gap extension penalty equals 0.5, Brief identity and similarity is set to Yes, Output Alignment File Format is set to SRS pairs, the output file is::
+
+    ########################################
+    # Program: needle
+    # Rundate: Mon Apr 02 2007 14:23:16
+    # Align_format: srspair
+    # Report_file: ./database/files/dataset_7.dat
+    ########################################
+     
+    #=======================================
+    #
+    # Aligned_sequences: 2
+    # 1: hg18_dna
+    # 2: hg18_dna
+    # Matrix: EDNAFULL
+    # Gap_penalty: 10.0
+    # Extend_penalty: 0.5
+    #
+    # Length: 83
+    # Identity:      83/83 (100.0%)
+    # Similarity:    83/83 (100.0%)
+    # Gaps:           0/83 ( 0.0%)
+    # Score: 415.0
+    #
+    #=======================================
+
+    hg18_dna           1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA     50
+                       ||||||||||||||||||||||||||||||||||||||||||||||||||
+    hg18_dna           1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA     50
+        
+    hg18_dna          51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG     83
+                       |||||||||||||||||||||||||||||||||
+    hg18_dna          51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG     83
+        
+    #---------------------------------------
+    #---------------------------------------
+
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_newcpgreport.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_newcpgreport.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,52 @@
+
+  Report CpG rich areas
+  emboss
+  newcpgreport -sequence $input1 -window $window -shift $shift -minlen $minlen -minpc $minpc -outfile $out_file1 -minoe $minoe -auto
+  
+    
+      Sequence
+    
+    
+      Window Size
+    
+    
+      Step size (shift)
+    
+    
+      Minimum length
+    
+    
+      Minimum average observed to expected ratio
+    
+    
+      Minimum average percentage of G plus C
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/newcpgreport.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_newcpgseek.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_newcpgseek.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,43 @@
+
+  Reports CpG rich region
+  emboss
+  newcpgseek -sequence $input1 -outfile $out_file1 -score $score -auto
+  
+    
+      Sequence
+    
+    
+      CpG score
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+    
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/newcpgseek.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_newseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_newseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,80 @@
+
+  Type in a short new sequence
+  emboss
+  newseq -outseq $out_file1 -name "$seqname" -description "$description" -type $type -sequence "$sequence" -osformat5 $out_format1 -auto
+  
+    
+      Name of of the sequence
+    
+    
+      Description of the sequence
+    
+    
+      Type of sequence
+      
+      
+    
+    
+      The sequence itself
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/newseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_noreturn.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_noreturn.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,39 @@
+
+  Removes carriage return from ASCII files
+  emboss
+  noreturn -infile $input1 -outfile $out_file1 -system $system -auto
+  
+    
+      On query
+    
+    
+      Target operating system for end-of-line format
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/noreturn.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_notseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_notseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,77 @@
+
+  Exclude a set of sequences and write out the remaining ones
+  emboss
+  notseq -sequence $input1 -outseq $out_file1 -exclude "$exclude" -osformat3 $out_format1 -auto
+  
+    
+      On query
+    
+    
+      Exclude list
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/notseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_nthseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_nthseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,77 @@
+
+  Writes one sequence from a multiple set of sequences
+  emboss
+  nthseq -sequence $input1 -outseq $out_file1 -number $number -osformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Number of the sequence to output
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/nthseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_octanol.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_octanol.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,46 @@
+
+    
+  Displays protein hydropathy
+  emboss
+  emboss_single_outputfile_wrapper.pl octanol -sequence $input1 -graph png -goutfile $out_file1 -width $width -octanolplot $octanolplot -interfaceplot $interfaceplot
+  -differenceplot $differenceplot -auto
+  
+    
+      Sequences
+    
+    
+      Window size
+    
+    
+      Display the octanol plot
+      
+      
+    
+    
+      Display the interface plot
+      
+      
+    
+    
+      Display the difference plot
+      
+      
+    
+  
+  
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/octanol.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_oddcomp.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_oddcomp.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,48 @@
+
+  
+  Find protein sequence regions with a biased composition
+  emboss
+  oddcomp -sequence $input1 -infile $input2 -outfile $out_file1 -window $window -ignorebz $ignorebz -auto
+  
+    
+      Sequences
+    
+    
+      This is a file in the format of the output produced by 'compseq' that is used to set the minimum frequencies of words in this analysis
+    
+    
+      This is the size of window in which to count. Thus if you want to count frequencies in a 40 aa stretch you should enter 40 here
+    
+    
+      The amino acid code B represents Asparagine or Aspartic acid and the code Z represents Glutamine or Glutamic acid. These are not commonly used codes and you may wish not to count words
+      containing them, just noting them in the count of 'Other' words
+      
+      
+    
+  
+  
+    
+  
+
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/oddcomp.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_palindrome.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_palindrome.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,61 @@
+
+  Looks for inverted repeats in a nucleotide sequence
+  emboss
+  palindrome -sequence $input1 -outfile $out_file1 -minpallen $minpallen -maxpallen $maxpallen -gaplimit $gaplimit -nummismatches $nummismatches -overlap $overlap -auto
+  
+    
+      Sequences
+    
+    
+      Minimum length of palindrome
+    
+    
+      Maximum length of palindrome
+    
+    
+      Maximum gap between repeated regions
+    
+    
+      Number of mismatches allowed
+    
+    
+      Report overlapping matches
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/palindrome.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_pasteseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pasteseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,81 @@
+
+  Insert one sequence into another
+  emboss
+  pasteseq -asequence $input2 -bsequence $input1 -outseq $out_file1 -pos $pos -osformat3 $out_format1 -auto
+  
+    
+      Main sequence
+    
+    
+      Sequence to insert
+    
+    
+      Position to insert after
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input datasets need to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pasteseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_patmatdb.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_patmatdb.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,57 @@
+
+  Search a protein sequence with a motif
+  emboss
+  patmatdb -sequence $input1 -outfile $out_file1 -motif "$motif" -rformat3 $out_format1 -auto
+  
+    
+      Main sequence
+    
+    
+      Motif to search for
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/patmatdb.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_pepcoil.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepcoil.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,54 @@
+
+  Predicts coiled coil regions
+  emboss
+  pepcoil -sequence $input1 -outfile $out_file1 -window $window -coil $coil -frame $frame -other $other -auto
+  
+    
+      Sequence
+    
+    
+      Window size
+    
+    
+      Report coiled coil regions
+      
+      
+    
+    
+      Show coil frameshifts
+      
+      
+    
+    
+      Report non coiled coil regions
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepcoil.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_pepinfo.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepinfo.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,36 @@
+
+  
+  Plots simple amino acid properties in parallel
+  emboss
+  emboss_single_outputfile_wrapper.pl pepinfo -sequence $input1 -outfile $out_file1 -goutfile $out_file2 -graph png -hwindow $hwindow $plot_type -auto
+  
+    
+      Sequence
+    
+    
+      Window size for hydropathy averaging
+    
+    
+      Choose a plot type
+      
+      
+    
+  
+  
+    
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepinfo.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_pepnet.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepnet.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,41 @@
+
+  
+  Displays proteins as a helical net
+  emboss
+  pepnet -sequence $input1 -graph png -goutfile $out_file1 -squares $squares -diamonds $diamonds -octags $octags -amphipathic $amphipathic -auto
+  
+    
+      Sequence
+    
+    
+      Residues to mark with squares
+    
+    
+      Residues to mark with diamonds
+    
+    
+      Residues to mark with octagons
+    
+    
+      If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked. This overrides any other markup that you may have specified
+      
+      
+    
+  
+  
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepnet.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_pepstats.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepstats.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,38 @@
+
+  Protein statistics
+  emboss
+  pepstats -sequence $input1 -outfile $out_file1 -termini $termini -auto
+  
+    
+      Sequence
+    
+    
+      Include charge at N and C terminus
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepstats.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_pepwheel.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepwheel.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,53 @@
+
+  
+  Shows protein sequences as helices
+  emboss
+  emboss_single_outputfile_wrapper.pl pepwheel -sequence $input1 -graph png -goutfile $out_file1 -squares $squares -diamonds $diamonds -octags $octags -amphipathic
+  $amphipathic -steps $steps -turns $turns -wheel $wheel -auto
+  
+    
+      Sequence
+    
+    
+      Steps, the number of residues plotted per turn is this value divided by the 'turns' value
+    
+    
+      Turns, the number of residues plotted per turn is the 'steps' value divided by this value
+    
+    
+      Residues to mark with squares
+    
+    
+      Residues to mark with diamonds
+    
+    
+      Residues to mark with octagons
+    
+    
+      Plot the wheel
+      
+      
+    
+    
+      If this is true then the residues ACFGILMVWY are marked as squares and all other residues are unmarked. This overrides any other markup that you may have specified
+      
+      
+    
+  
+  
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepwheel.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_pepwindow.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepwindow.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,30 @@
+
+  
+  Displays protein hydropathy
+  emboss
+  emboss_single_outputfile_wrapper.pl pepwindow -sequence $input1 -graph png -goutfile $out_file1 -length $length -auto
+  
+    
+      Sequence
+    
+    
+      Window size
+    
+  
+  
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepwindow.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_pepwindowall.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_pepwindowall.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,30 @@
+
+  
+  Displays protein hydropathy of a set of sequences
+  emboss
+  emboss_single_outputfile_wrapper.pl pepwindowall -sequence $input1 -graph png -goutfile $out_file1 -length $length -auto
+  
+    
+      Sequence
+    
+    
+      Window size
+    
+  
+  
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/pepwindowall.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_plotcon.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_plotcon.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,30 @@
+
+  
+  Plot quality of conservation of a sequence alignment
+  emboss
+  emboss_single_outputfile_wrapper.pl plotcon -sequences $input1 -graph png -goutfile $out_file1 -winsize $winsize -auto
+  
+    
+      Sequence
+    
+    
+      Number of columns to average alignment quality over
+    
+  
+  
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/plotcon.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_plotorf.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_plotorf.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,48 @@
+
+  
+  Plot potential open reading frames
+  emboss
+  emboss_single_outputfile_wrapper.pl plotorf -sequence $input1 -graph png -goutfile $out_file1 -start $start -stop $stop -auto
+  
+    
+      Sequence
+    
+    
+      Start codons
+    
+    
+      Stop codons
+    
+  
+  
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/plotorf.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_polydot.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_polydot.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,56 @@
+
+  
+  Displays all-against-all dotplots of a set of sequences
+  emboss
+  emboss_single_outputfile_wrapper.pl polydot -sequence $input1 -graph png -goutfile $output2 -outfeat $output1 -wordsize $wordsize -boxit $boxit -dumpfeat yes -gap
+  $gap -auto
+  
+    
+      Sequence
+    
+    
+      Word size
+    
+    
+      Draw a box around each dotplot
+      
+      
+    
+    
+      Size of gap
+    
+  
+  
+    
+    
+  
+
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/polydot.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_preg.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_preg.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,29 @@
+
+  Regular expression search of a protein sequence
+  emboss
+  preg -sequence $input1 -outfile $out_file1 -pattern "$pattern" -auto
+  
+    
+      Sequence 1
+    
+    
+      Regular expression pattern
+    
+  
+  
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/preg.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_prettyplot.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_prettyplot.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,121 @@
+
+  
+  Displays aligned sequences, with colouring and boxing
+  emboss
+  prettyplot -sequences $input1 -graph png -goutfile $out_file1 -residuesperline $residuesperline -resbreak $resbreak -ccolours $ccolours -cidentity $cidentity -csimilarity $csimilarity
+  -cother $cother -docolour $docolour -gtitle $title -pair $pair -identity $identity -box $box -boxcol $boxcol -boxcolval $boxcolval -name $name -maxnamelen $maxnamelen -number $number -listoptions
+  $listoptions -consensus $consensus -collision $collision -alternative $alternative -showscore $showscore -portrait $portrait -auto
+  
+    
+      Sequence
+    
+    
+      The number of residues to be displayed on each line
+    
+    
+      Residues before a space
+    
+    
+      Colour residues by their consensus value
+      
+      
+    
+    
+      Colour to display identical residues
+    
+    
+      Colour to display similar residues
+    
+    
+      Colour to display other residues
+    
+    
+      Colour residues by table oily, amide etc.
+      
+      
+    
+    
+      Display the title
+      
+      
+    
+    
+      Values to represent identical similar related
+    
+    
+      Only match those which are identical in all sequences
+    
+    
+      Display prettyboxes
+      
+      
+    
+    
+      Colour the background in the boxes
+      
+      
+    
+    
+      Colour to be used for background
+    
+    
+      Display the sequence names
+      
+      
+    
+    
+      Margin size for the sequence name
+    
+    
+      Display the residue number
+      
+      
+    
+    
+      Display the date and options used
+      
+      
+    
+    
+      Display the consensus
+      
+      
+    
+    
+      Allow collisions in calculating consensus
+      
+      
+    
+    
+      Use alternative collisions routine
+      
+      
+      
+      
+    
+    
+      Print residue scores
+    
+    
+      Set page to Portrait
+      
+      
+    
+  
+  
+    
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/prettyplot.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_prettyseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_prettyseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,61 @@
+
+  Output sequence with translated ranges
+  emboss
+  prettyseq -sequence $input1 -outfile $out_file1 -ruler $ruler -plabel $plabel -nlabel $nlabel -width $width -auto
+  
+    
+      Sequence
+    
+    
+      Add a ruler
+      
+      
+    
+    
+      Number translations
+      
+      
+    
+    
+      Number DNA sequence
+      
+      
+    
+    
+      Width of screen
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+    
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/prettyseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_primersearch.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_primersearch.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,41 @@
+
+  Searches DNA sequences for matches with primer pairs
+  emboss
+  primersearch -seqall $input1 -infile $input2 -outfile $out_file1 -mismatchpercent $mismatchpercent -auto
+  
+    
+      Main sequences
+    
+    
+      Primer file
+    
+    
+      Allowed percent mismatch
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+    
+  
+  
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/primersearch.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_revseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_revseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,85 @@
+
+  Reverse and complement a sequence
+  emboss
+  revseq -sequence $input1 -outseq $out_file1 -reverse $reverse -complement $complement -osformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Reverse the sequence
+      
+      
+    
+    
+      Complement the sequence
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/revseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_seqmatchall.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_seqmatchall.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,62 @@
+
+  All-against-all comparison of a set of sequences
+  emboss
+  seqmatchall -sequence $input1 -outfile $out_file1 -wordsize $wordsize -aformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Word size
+    
+    
+      Output Alignment File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    .
+  
+  
+    
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/seqmatchall.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_seqret.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_seqret.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,78 @@
+
+  Reads and writes sequences
+  emboss
+  seqret -sequence $input1 -outseq $out_file1 -feature $feature -firstonly $firstonly -osformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Use feature information
+      
+      
+    
+    
+      Read one sequence and stop
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/seqret.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_showfeat.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_showfeat.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,131 @@
+
+  
+  Show features of a sequence
+  emboss
+  showfeat -sequence $input1 -outfile $out_file1 -matchsource "$matchsource" -matchtype "$matchtype" -matchtag "$matchtag" -matchvalue "$matchvalue" -sort $sort -annotation "$annotation" -id
+  $id -description "$description" -scale "$scale" -width "$width" -collapse $collapse -forward $forward -reverse $reverse -unknown $unknown -strand $strand -source $source -position $position -type
+  $type -tags $tags -values $values -stricttags $stricttags -html $html_out1 -auto
+  
+    
+      Sequences
+    
+    
+      Format output as an HTML table
+      
+      
+    
+    
+      Feature source to match
+    
+    
+      Feature type to match
+    
+    
+      Feature tags to match
+    
+    
+      Tag values to match
+    
+    
+      Sort by
+      
+      
+      
+      
+      
+    
+    
+      Regions to annotate by marking
+    
+    
+      Display the ID name of the sequence
+      
+      
+    
+    
+      Display the description of the sequence
+      
+      
+    
+    
+      Display the scale line
+      
+      
+    
+    
+      Screen width
+    
+    
+      Collapse features
+      
+      
+    
+    
+      Display forward sense features
+      
+      
+    
+    
+      Display reverse sense features
+      
+      
+    
+    
+      Display unknown sense features
+      
+      
+    
+    
+      Display the strand of the features
+      
+      
+    
+    
+      Display the source of the features
+      
+      
+    
+    
+      SDisplay the start and end position of the features
+      
+      
+    
+    
+      Display the type of the features
+      
+      
+    
+    
+      Display the tags and values of the features
+      
+      
+    
+    
+      Display the tag values of the features
+      
+      
+    
+    
+      Display only those tag/value pairs in a feature that match the specified tag and value
+      
+      
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/showfeat.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_shuffleseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_shuffleseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,70 @@
+
+  
+  Shuffles a set of sequences maintaining composition
+  emboss
+  shuffleseq -sequence $input1 -outseq $out_file1 -shuffle "$shuffle" -osformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Number of shuffles
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/shuffleseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_sigcleave.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_sigcleave.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,63 @@
+
+  Reports protein signal cleavage sites
+  emboss
+  sigcleave -sequence $input1 -outfile $out_file1 -minweight "$minweight" -prokaryote $prokaryote -rformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Minimum scoring weight value for the predicted cleavage site
+    
+    
+      Specifies the sequence is prokaryotic and changes the default scoring data file
+      
+      
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/sigcleave.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_single_outputfile_wrapper.pl
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_single_outputfile_wrapper.pl	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,27 @@
+#! /usr/bin/perl -w
+use strict;
+use File::Copy;
+
+my $cmd_string = join (" ",@ARGV);
+my $results = `$cmd_string`;
+my @files = split("\n",$results);
+my $fileNameOut = $ARGV[6];
+my ($drive, $outputDir, $file) = File::Spec->splitpath( $fileNameOut );
+my $destination = $fileNameOut;
+
+foreach my $thisLine (@files)
+{
+	if ($thisLine =~ /Created /)
+	{
+		$thisLine =~ /[\w|\.]+$/;
+		$thisLine =$&;
+		#print "outfile: $thisLine\n";
+		#there is only one file to move, so we can quit after finding it
+		move($drive.$outputDir.$thisLine,$fileNameOut);
+		exit(1);
+	}
+	else
+	{
+		print $thisLine,"\n";
+	}
+}
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_sirna.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_sirna.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,126 @@
+
+  Finds siRNA duplexes in mRNA
+  emboss
+  sirna -sequence $input1 -outfile $ofile1 -outseq $ofile2 -poliii $poliii -aa $aa -tt $tt -polybase $polybase -context $context -rformat2 $out_format1 -osformat3 $out_format2
+  -auto
+  
+    
+      Sequences
+    
+    
+      Select only the 21 base probes that start with a purine (Pol III expression vectors)
+      
+      
+    
+    
+      Select only those 23 base regions that start with AA
+      
+      
+    
+    
+      Select only those 23 base regions that end with TT
+      
+      
+    
+    
+      Report more than those 23 base regions that have no repeat of 4 or more of any bases in a row
+      
+      
+    
+    
+      Displays the whole 23 bases of the region with the first two bases in brackets
+      
+      
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/sirna.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_sixpack.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_sixpack.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,170 @@
+
+  
+  Display a DNA sequence with 6-frame translation and ORFs
+  emboss
+  sixpack -sequence $input1 -outfile $ofile1 -outseq $ofile2 -table $table -firstorf $firstorf -lastorf $lastorf -mstart $mstart -reverse $reverse -orfminsize $orfminsize -uppercase
+  "$uppercase" -number $number -width "$width" -length "$length" -margin "$margin" -name $disp_name -description $description -offset "$offset" -html $html_out1 -osformat $out_format2 -auto
+  
+    
+      Sequences
+    
+    
+      Code to use
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Count the beginning of a sequence as a possible ORF
+      
+      
+    
+    
+      Count the end of a sequence as a possible ORF
+      
+      
+    
+    
+      Displays only ORFs starting with an M
+      
+      
+    
+    
+      Display the translation of the DNA sequence in the 3 reverse frames
+      
+      
+    
+    
+      Minimum size of Open Reading Frames (ORFs) to display in the translations
+    
+    
+      Regions to put in uppercase
+    
+    
+      Number the sequence at the beginning and the end of each line
+      
+      
+    
+    
+      Number of nucleotides displayed on each line
+    
+    
+      Line length of page
+    
+    
+      Margin around sequence for numbering
+    
+    
+      Display the ID name of the sequence
+      
+      
+    
+    
+      Display the description of the sequence
+      
+      
+    
+    
+      Number from which you want the DNA sequence to be numbered
+    
+    
+      Format output as an HTML table
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+    
+  
+
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/sixpack.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_skipseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_skipseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,67 @@
+
+  Reads and writes sequences, skipping first few
+  emboss
+  skipseq -sequence $input1 -outseq $out_file1 -skip "$skip" -feature $feature -osformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Number of sequences to skip at start
+    
+    
+      Use feature information
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/skipseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_splitter.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_splitter.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,87 @@
+
+  Split a sequence into (overlapping) smaller sequences
+  emboss
+  splitter -sequence $input1 -outseq $out_file1 -size "$size" -overlap "$overlap" -addoverlap $addoverlap -osformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Size to split at
+    
+    
+      Overlap between split sequences
+    
+    
+      Add overlap to size
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/splitter.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_supermatcher.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_supermatcher.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,72 @@
+
+  
+  Match large sequences against one or more other sequences
+  emboss
+  supermatcher -asequence $input1 -bsequence $input2 -gapopen "$gapopen" -gapextend "$gapextend" -width "$width" -wordlen "$wordlen" -outfile $ofile1 -errorfile $ofile2 -aformat3
+  $out_format1 -auto
+  
+    
+      Large sequences
+    
+    
+      Sequences to match
+    
+    
+      Gap opening penalty
+    
+    
+      Gap extension penalty
+    
+    
+      Alignment width
+    
+    
+      Word length for initial matching
+    
+    
+      Output Alignment File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+    
+  
+
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/supermatcher.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_syco.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_syco.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,205 @@
+
+  
+  Synonymous codon usage Gribskov statistic plot
+  emboss
+  emboss_single_outputfile_wrapper.pl syco -sequence $input1 -graph png -goutfile $ofile1 -outfile $ofile2 -cfile $cfile -window "$window" -uncommon $uncommon -minimum "$minimum"
+  -auto
+  
+    
+      Sequence
+    
+    
+      Codon Usage File
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Averaging window
+    
+    
+      Show common codon usage
+      
+      
+    
+    
+      Minimum value for a common codon
+    
+  
+  
+    
+    
+  
+ 
+  
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/syco.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_tcode.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_tcode.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,52 @@
+
+  Fickett TESTCODE statistic to identify protein-coding DNA
+  emboss
+  tcode -sequence $input1 -outfile $out_file1 -window "$window" -step "$step" -rformat $out_format1 -auto
+  
+    
+      Sequence
+    
+    
+      Window size
+    
+    
+      Step size
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/tcode.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_textsearch.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_textsearch.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,66 @@
+
+  Search sequence documentation. Slow, use SRS and Entrez!
+  emboss
+  textsearch -sequence $input1 -outfile $out_file1 -pattern "$pattern" -casesensitive -heading $heading -usa $usa -accession $accession -name $search_name -description $description -html
+  $html_out1 -auto
+  
+    
+      Sequence
+    
+    
+      Pattern to search for
+    
+    
+      Do a case-sensitive search
+      
+      
+    
+    
+      Display column headings
+      
+      
+    
+    
+      Display the USA of the sequence
+      
+      
+    
+    
+      Display accession column
+      
+      
+    
+    
+      Display name column
+      
+      
+    
+    
+      Display description column
+      
+      
+    
+    
+      Format output as an HTML table
+      
+      
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/textsearch.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_tmap.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_tmap.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,47 @@
+
+  Displays membrane spanning regions
+  emboss
+  emboss_single_outputfile_wrapper.pl tmap -sequences $input1 -outfile $out_file1 -goutfile $out_file2 -graph png -rformat $out_format1 -auto
+  
+    
+      Sequence
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/tmap.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_tranalign.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_tranalign.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,92 @@
+
+  Align nucleic coding regions given the aligned proteins
+  emboss
+  tranalign -asequence $input1 -bsequence $input2 -outseq $out_file1 -table $table -osformat3 $out_format1 -auto
+  
+    
+      Nucleic Sequences
+    
+    
+      Protein Sequences
+    
+    
+      Code to use
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/tranalign.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_transeq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_transeq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,130 @@
+
+  Translate nucleic acid sequences
+  emboss
+  transeq -sequence $input1 -outseq $out_file1 -frame $frame -table $table -regions "$regions" -trim $trim -clean $clean -alternative $alternative -osformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Frame(s) to translate
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Code to use
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Regions to translate
+    
+    
+      Remove all 'X' and '*' characters from the right end of the translation
+      
+      
+    
+    
+      Change all STOP codon positions from the '*' character to 'X'
+      
+      
+    
+    
+      Define frame '-1' as using the set of codons starting with the last codon of the sequence
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/transeq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_trimest.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_trimest.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,100 @@
+
+  Trim poly-A tails off EST sequences
+  emboss
+  trimest -sequence $input1 -outseq $out_file1 -minlength "$minlength" -mismatches "$mismatches" -reverse $reverse -tolower $tolower -fiveprime $fiveprime -osformat2 $out_format1
+  -auto
+  
+    
+      Sequences
+    
+    
+      Minimum length that a poly-A (or poly-T) tail must have before it is removed
+    
+    
+      Number of fewer mismatched non-A bases in a poly-A tail
+    
+    
+      Change the sequence to the forward sense when it is written out
+      
+      
+    
+    
+      Mask poly-A by converting to lowercase
+      
+      
+    
+    
+      Inspect 5' end of the sequence for poly-T tails
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark
+
+The input dataset needs to be sequences.
+
+-----
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/trimest.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_trimseq.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_trimseq.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,105 @@
+
+  Trim ambiguous bits off the ends of sequences
+  emboss
+  trimseq -sequence $input1 -outseq $out_file1 -window "$window" -percent "$percent" -strict $strict -star $star -left $left -right $right -osformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Window size
+    
+    
+      Threshold of the percentage ambiguity
+    
+    
+      Trim all ambiguity codes
+      
+      
+    
+    
+      In protein sequences, trim off not only X's, but also the *'s
+      
+      
+    
+    
+      Trim at the start
+      
+      
+    
+    
+      Trim at the end
+      
+      
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark 
+
+The input dataset needs to be sequences. 
+
+----- 
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/trimseq.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_twofeat.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_twofeat.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,138 @@
+
+  Finds neighbouring pairs of features in sequences
+  emboss
+  twofeat -sequence $input1 -outfile $out_file1 -atype "$atype" -btype "$btype" -minrange "$minrange" -maxrange "$maxrange" -asource "$asource" -asense $asense -aminscore "$aminscore"
+  -amaxscore "$amaxscore" -atag "$atag" -avalue "$avalue" -bsource "$bsource" -bsense "$bsense" -bminscore "$bminscore" -bmaxscore "$bmaxscore" -btag "$btag" -bvalue "$bvalue" -overlap $overlap
+  -rangetype $rangetype -sense $sense -order $order -twoout $twoout -typeout "$typeout" -rformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Feature type you wish to allow. Feature 1
+    
+    
+      Feature type you wish to allow. Feature 2
+    
+    
+      Minimun range
+    
+    
+      Maximum range
+    
+    
+      Feature source 1
+    
+    
+      Feature sense 1
+      
+      
+      
+    
+    
+      Feature 1 minimum score
+    
+    
+      Feature1 maxiumum score
+    
+    
+      Feature 1 tag
+    
+    
+      Tag 1 value
+    
+    
+      Feature 2 source
+    
+    
+      Feature 2 sense
+      
+      
+      
+    
+    
+      Feature 2 miniumum score
+    
+    
+      Feature 2 maximum score
+    
+    
+      Feature 2 tag
+    
+    
+      Feature 2 tag value
+    
+    
+      opverlaps allowed
+      
+      
+      
+      
+      
+      
+    
+    
+      How to determine range
+      
+      
+      
+      
+    
+    
+      Required sense
+      
+      
+      
+    
+    
+      Required order of the two features
+      
+      
+      
+    
+    
+      Write out the two features themselves
+      
+      
+    
+    
+      New feature type
+    
+    
+      Output Report File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/twofeat.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
\ No newline at end of file
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_union.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_union.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,73 @@
+
+  Reads sequence fragments and builds one sequence
+  emboss
+  union -sequence $input1 -outseq $out_file1 -osformat2 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark 
+
+The input dataset needs to be sequences. 
+
+----- 
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/union.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_vectorstrip.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_vectorstrip.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,90 @@
+
+  Strips out DNA between a pair of vector sequences
+  emboss
+  vectorstrip -sequence $input1 -vectorsfile $input2 -outseq $ofile1 -outfile $ofile2 -vectorfile yes -mismatch "$mismatch" -besthits $besthits -linkera "$linkera" -linkerb
+  "$linkerb" -osformat4 $out_format1 -auto
+  
+    
+      Sequences
+    
+    
+      Vector file
+    
+    
+      Max allowed percent mismatch
+    
+    
+      Show only the best hits (minimize mismatches)
+      
+      
+    
+    
+      The 5' sequence
+    
+    
+      The 3' sequence
+    
+    
+      Output Sequence File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+    
+  
+  
+  
+  
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/vectorstrip.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_water.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_water.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,74 @@
+
+  Smith-Waterman local alignment
+  emboss
+  water -asequence $input1 -bsequence $input2 -outfile $out_file1 -gapopen "$gapopen" -gapextend "$gapextend" -brief $brief -aformat3 $out_format1 -auto
+  
+    
+      Sequence 1
+    
+    
+      Sequence 2
+    
+    
+      Gap open penalty
+    
+    
+      Gap extension penalty
+    
+    
+      Brief identity and similarity
+      
+      
+    
+    
+      Output Alignment File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+      
+      
+      
+      
+    
+  
+  
+  
+
+.. class:: warningmark 
+
+The input datasets need to be sequences. 
+
+----- 
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/water.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_wobble.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_wobble.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,48 @@
+
+  Wobble base plot
+  emboss
+  emboss_single_outputfile_wrapper.pl wobble -sequence $input1 -graph png -goutfile $ofile1 -outfile $ofile2 -window "$window" -bases "$bases" -auto
+  
+    
+      Sequence
+    
+    
+      Window size, in codons
+    
+    
+      Bases used
+    
+  
+  
+    
+    
+  
+  
+    
+      
+      
+      
+      
+    
+  
+  
+
+.. class:: warningmark 
+
+The input dataset needs to be sequences. 
+
+----- 
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/wobble.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_wordcount.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_wordcount.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,43 @@
+
+  Counts words of a specified size in a DNA sequence
+  emboss
+  wordcount -sequence $input1 -outfile $out_file1 -wordsize "$wordsize" -auto
+  
+    
+      Sequence
+    
+    
+      Word size
+    
+  
+  
+    
+  
+  
+    
+      
+      
+      
+    
+  
+  
+
+.. class:: warningmark 
+
+The input dataset needs to be sequences. 
+
+----- 
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/wordcount.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+
diff -r 000000000000 -r b94ca591877b emboss_5/emboss_wordmatch.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/emboss_5/emboss_wordmatch.xml	Tue Dec 20 14:02:45 2011 -0500
@@ -0,0 +1,82 @@
+
+  Finds all exact matches of a given size between 2 sequences
+  emboss
+  wordmatch -asequence $input1 -bsequence $input2 -outfile $out_file1 -aoutfeat $out_file2 -boutfeat $out_file3 -wordsize "$wordsize" -aformat3 $out_format1 -offormat4 $out_format2
+  -offormat5 $out_format3 -auto
+  
+    
+      Sequence 1
+    
+    
+      Sequence 2
+    
+    
+      Word size
+    
+    
+      Output Alignment File Format
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+      
+    
+    
+      Output Feature 1 File Format
+      
+      
+      
+    
+    
+      Output Feature 2 File Format
+      
+      
+      
+    
+  
+  
+    
+    
+    
+  
+  
+  
+  
+
+.. class:: warningmark 
+
+The input datasets need to be sequences. 
+
+----- 
+
+    You can view the original documentation here_.
+    
+    .. _here: http://emboss.sourceforge.net/apps/release/5.0/emboss/apps/wordmatch.html
+
+------
+
+**Citation**
+
+For the underlying tool, please cite `Rice P, Longden I, Bleasby A. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 2000 Jun;16(6):276-7. <http://www.ncbi.nlm.nih.gov/pubmed/10827456>`_
+
+If you use this tool in Galaxy, please cite `Blankenberg D, Taylor J, Schenck I, He J, Zhang Y, Ghent M, Veeraraghavan N, Albert I, Miller W, Makova KD, Hardison RC, Nekrutenko A. A framework for collaborative analysis of ENCODE data: making large-scale analyses biologist-friendly. Genome Res. 2007 Jun;17(6):960-4. <http://www.ncbi.nlm.nih.gov/pubmed/17568012>`_
+  
+