# HG changeset patch
# User devteam
# Date 1447263397 18000
# Node ID f666895cbebdd876a8643df696f669d64c55b199
# Parent  f2ab5b44870d47fff5baac9c52f32c0b0fc9fb6e
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fasta_clipping_histogram commit a1517c9d22029095120643bbe2c8fa53754dd2b7

diff -r f2ab5b44870d -r f666895cbebd fasta_clipping_histogram.xml
--- a/fasta_clipping_histogram.xml	Wed Sep 25 14:55:11 2013 -0400
+++ b/fasta_clipping_histogram.xml	Wed Nov 11 12:36:37 2015 -0500
@@ -1,19 +1,20 @@
 <tool id="cshl_fasta_clipping_histogram" name="Length Distribution" version="1.0.0">
-	<description>chart</description>
+    <description>chart</description>
     <requirements>
         <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
     </requirements>
-	<command>fasta_clipping_histogram.pl $input $outfile</command>
-	
-	<inputs>
-		<param format="fasta" name="input" type="data" label="Library to analyze" />
-	</inputs>
+    <command>fasta_clipping_histogram.pl $input $outfile</command>
+
+    <inputs>
+        <param format="fasta" name="input" type="data" label="Library to analyze" />
+    </inputs>
 
-	<outputs>
-		<data format="png" name="outfile" metadata_source="input" />
-	</outputs>
-<help>
-
+    <outputs>
+        <data format="png" name="outfile" metadata_source="input" />
+    </outputs>
+    <tests>
+    </tests>
+    <help>
 **What it does**
 
 This tool creates a histogram image of sequence lengths distribution in a given fasta dataset file.
@@ -24,21 +25,18 @@
 
 **Output Examples**
 
-In the following library, most sequences are 24-mers to 27-mers. 
+In the following library, most sequences are 24-mers to 27-mers.
 This could indicate an abundance of endo-siRNAs (depending of course of what you've tried to sequence in the first place).
 
 .. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_1.png
 
-
-In the following library, most sequences are 19,22 or 23-mers. 
+In the following library, most sequences are 19,22 or 23-mers.
 This could indicate an abundance of miRNAs (depending of course of what you've tried to sequence in the first place).
 
 .. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_2.png
 
-
 -----
 
-
 **Input Formats**
 
 This tool accepts short-reads FASTA files. The reads don't have to be short, but they do have to be on a single line, like so::
@@ -50,7 +48,6 @@
    >sequence3
    CCTTGAGATTAACGCTAATCAAGTAAAC
 
-
 If the sequences span over multiple lines::
 
    >sequence1
@@ -63,11 +60,8 @@
    >sequence1
    CAGCATCTACATAATATGATCGCTATTAAACTTAAATCTCCTTGACGGAGTCTTCGGTCATAACACAAACCCAGACCTACGTATATGACAAAGCTAATAGaactggtctttacctTTAAGTTG
 
-
 -----
 
-
-
 **Multiplicity counts (a.k.a reads-count)**
 
 If the sequence identifier (the text after the '>') contains a dash and a number, it is treated as a multiplicity count value (i.e. how many times that individual sequence repeated in the original FASTA file, before collapsing).
@@ -85,7 +79,6 @@
 
 .. image:: ${static_path}/fastx_icons/fasta_clipping_histogram_3.png
 
-
 Example 2 - The following FASTA file have multiplicity counts::
 
     >seq1-2
@@ -106,7 +99,5 @@
 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
 
  .. __: http://hannonlab.cshl.edu/fastx_toolkit/
- 
-</help>
-<!-- FASTA-Clipping-Histogram is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
-</tool>
\ No newline at end of file
+    </help>
+</tool>
diff -r f2ab5b44870d -r f666895cbebd tool_dependencies.xml
--- a/tool_dependencies.xml	Wed Sep 25 14:55:11 2013 -0400
+++ b/tool_dependencies.xml	Wed Nov 11 12:36:37 2015 -0500
@@ -1,6 +1,6 @@
 <?xml version="1.0"?>
 <tool_dependency>
     <package name="fastx_toolkit" version="0.0.13">
-        <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" />
+        <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" />
     </package>
 </tool_dependency>