annotate fasta_nucleotide_changer.xml @ 0:4b41e3076a50

Uploaded tool tarball.

<tool id="cshl_fasta_nucleotides_changer" version="1.0.0" name="RNA/DNA" >
	<description>converter</description>
    <requirements>
        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
    </requirements>
	<command>zcat -f '$input' | fasta_nucleotide_changer -$mode -v -o $output</command>
	<inputs>
		<param format="fasta" version="1.0.0" name="input" type="data" label="Library to convert" />

		<param version="1.0.0" name="mode" type="select" label="Convert">
			<option value="d">RNA to DNA (U to T)</option>
			<option value="r">DNA to RNA (T to U)</option>
		</param>
	</inputs>

    <!-- 
    Functional tests with param value starting with - fail.
     -->
	<tests>
		<test>
			<param version="1.0.0" name="input" value="fasta_nuc_changer1.fasta" /> 
			<param version="1.0.0" name="mode" value="r" /> 
			<output version="1.0.0" name="output" file="fasta_nuc_change1.out" />
		</test>
		<test>
			<param version="1.0.0" name="input" value="fasta_nuc_changer2.fasta" /> 
			<param version="1.0.0" name="mode" value="d" /> 
			<output version="1.0.0" name="output" file="fasta_nuc_change2.out" />
		</test>
	</tests>
  
	<outputs>
		<data format="input" version="1.0.0" name="output" metadata_source="input" />
	</outputs>

<help>
**What it does**

This tool converts RNA FASTA files to DNA (and vice-versa).

In **RNA-to-DNA** mode, U's are changed into T's.

In **DNA-to-RNA** mode, T's are changed into U's.

--------

**Example**

Input RNA FASTA file ( from Sanger's mirBase )::

    >cel-let-7 MIMAT0000001 Caenorhabditis elegans let-7
    UGAGGUAGUAGGUUGUAUAGUU
    >cel-lin-4 MIMAT0000002 Caenorhabditis elegans lin-4
    UCCCUGAGACCUCAAGUGUGA
    >cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1
    UGGAAUGUAAAGAAGUAUGUA

Output DNA FASTA file (with RNA-to-DNA mode)::

    >cel-let-7 MIMAT0000001 Caenorhabditis elegans let-7
    TGAGGTAGTAGGTTGTATAGTT
    >cel-lin-4 MIMAT0000002 Caenorhabditis elegans lin-4
    TCCCTGAGACCTCAAGTGTGA
    >cel-miR-1 MIMAT0000003 Caenorhabditis elegans miR-1
    TGGAATGTAAAGAAGTATGTA


------

This tool is based on `FASTX-toolkit`__ by Assaf Gordon.

 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
 
</help>
</tool>