diff fasta_to_tabular.xml @ 0:9d189d08f2ad draft

Imported from capsule None
author devteam
date Mon, 19 May 2014 12:34:27 -0400
parents
children 7e801ab2b70e
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fasta_to_tabular.xml	Mon May 19 12:34:27 2014 -0400
@@ -0,0 +1,128 @@
+<tool id="fasta2tab" name="FASTA-to-Tabular" version="1.1.0">
+	<description>converter</description>
+	<command interpreter="python">fasta_to_tabular.py $input $output $keep_first $descr_columns</command>
+	<inputs>
+		<param name="input" type="data" format="fasta" label="Convert these sequences"/>
+		<param name="descr_columns" type="integer" size="2" value="1" label="How many columns to divide title string into?" help="Typically 2 to take the ID (first word) and decription (rest) as two columns, or 1 to give a single column">
+			<validator type="in_range" min="1" />
+		</param>
+		<param name="keep_first" type="integer" size="5" value="0" label="How many title characters to keep?" help="Applies only to the first column taken from the title string ('0' = keep the whole thing), useful when your sequence identifiers are all the same length.">
+			<validator type="in_range" min="0" />
+		</param>
+	</inputs>
+	<outputs>
+		<data name="output" format="tabular"/>
+	</outputs>
+	<tests>
+		<test>
+			<param name="input" value="454.fasta" />
+			<param name="descr_columns" value="1"/>
+			<param name="keep_first" value="0"/>
+			<output name="output" file="fasta_to_tabular_out1.tabular" />
+		</test>
+		
+		<test>
+			<param name="input" value="4.fasta" />
+			<param name="descr_columns" value="1"/>
+			<param name="keep_first" value="0"/>
+			<output name="output" file="fasta_to_tabular_out2.tabular" />
+		</test>
+		
+		<test>
+			<param name="input" value="454.fasta" />
+			<param name="descr_columns" value="1"/>
+			<param name="keep_first" value="14"/>
+			<output name="output" file="fasta_to_tabular_out3.tabular" />
+		</test>
+
+		<test>
+			<param name="input" value="454.fasta" />
+			<param name="descr_columns" value="2"/>
+			<param name="keep_first" value="0"/>
+			<output name="output" file="fasta_to_tabular_out4.tabular" />
+		</test>
+
+		<test>
+			<param name="input" value="454.fasta" />
+			<param name="descr_columns" value="5"/>
+			<param name="keep_first" value="0"/>
+			<output name="output" file="fasta_to_tabular_out5.tabular" />
+		</test>
+
+		<test>
+			<param name="input" value="454.fasta" />
+			<param name="descr_columns" value="5"/>
+			<param name="keep_first" value="10"/>
+			<output name="output" file="fasta_to_tabular_out6.tabular" />
+		</test>
+
+	</tests>
+	<help>
+	
+**What it does**
+
+This tool converts FASTA formatted sequences to TAB-delimited format.
+
+Many tools consider the first word of the FASTA "&gt;" title line to be an identifier, and any remaining text to be a free form description.
+It is therefore useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**.
+In some cases the description can be usefully broken up into more columns -- see the examples .
+
+The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry.
+With the introduction of the **How many columns to divide title string into?** option this setting is of limited use, but does still allow you to truncate the identifier.
+
+-----	
+
+**Example**
+
+Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run::
+
+    &gt;EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
+    TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
+    TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
+    &gt;EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
+    AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA
+
+Running this tool with the default settings will produce this (2 column output):
+
+========================================================================== =======================================
+EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG
+EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_  AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA
+========================================================================== =======================================
+
+Having the full title line (the FASTA "&gt;" line text) as a column is not always ideal.
+
+The **How many characters to keep?** option is useful if your identifiers are all the same length.
+In this example the identifier is 14 characters, so setting **How many characters to keep?** to **14** (and leaving **How many columns to divide title string into?** as the default, **1**) will produce this (2 column output):
+
+============== =======================================
+EYKX4VC02EQLO5 TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG
+EYKX4VC02D4GS2 AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA
+============== =======================================
+
+If however your FASTA file has identifiers of variable length, it is better to split the text into at least two columns.
+Running this tool with **How many columns to divide title string into?** to **2** will produce this (3 column output):
+
+============== =========================================================== =======================================
+EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG
+EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_  AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA
+============== =========================================================== =======================================
+
+Running this tool with **How many columns to divide title string into?** to **5** will produce this (5 column output):
+
+============== ========== ============ ======== ========================== =======================================
+EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG
+EYKX4VC02D4GS2 length=60  xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA
+============== ========== ============ ======== ========================== =======================================
+
+Running this tool with **How many columns to divide title string into?** to **5** and **How many characters to keep?** to **10** will produce this (5 column output).
+Notice that only the first column is truncated to 10 characters -- and be careful not to trim your sequence names too much (generally they should be unique):
+
+========== ========== ============ ======== ========================== =======================================
+EYKX4VC02E length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG
+EYKX4VC02D length=60  xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA
+========== ========== ============ ======== ========================== =======================================
+
+Note the sequences have been truncated for display purposes in the above tables.
+
+	</help>
+</tool>