view test-data/454.fasta @ 1:7e801ab2b70e draft

planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/fasta_to_tabular commit a1517c9d22029095120643bbe2c8fa53754dd2b7
author devteam
date Wed, 11 Nov 2015 12:14:09 -0500
parents 9d189d08f2ad
children
line wrap: on
line source

>EYKX4VC01B65GS length=54 xy=0784_1754 region=1 run=R_2007_11_07_16_15_57_
CCGGTATCCGGGTGCCGTGATGAGCGCCACCGGAACGAATTCGACTATGCCGAA
>EYKX4VC01BNCSP length=187 xy=0558_3831 region=1 run=R_2007_11_07_16_15_57_
CTTACCGGTCACCACCGTGCCTTCAGGATTGATCGCCAGATCGGTCGGTGCGTCAGGCGG
GGTGACATCGCCCACCACGGTACTCACTGGCTGGCTCTGGTTCCCGGCGGCATCGGAGGC
CACCACGTTGAGGGTATTCCCCTCGGTTTGTGGCTCGGTGAGAACCACGTTGTAGTCGCC
ATTGGTC
>EYKX4VC01CD9FT length=115 xy=0865_1719 region=1 run=R_2007_11_07_16_15_57_
GGGGGCTTTGGCCTGTCGTCCGGCACCTCGCAAGAGCTACAGCAGGCGCGGCTGGCGATC
ATCGGCGGCACGCCGGCCTATATGTCGCCGGAACACACCACCCGCACCCAACGCG
>EYKX4VC01B8FW0 length=95 xy=0799_0514 region=1 run=R_2007_11_07_16_15_57_
TAAATTTCAAGGAATGCAAATCAGGGTCGTGTGTTTAGACTTCGGCTTTAGAGACCTGAA
TACGTCAAAAACATAACTTCATGATATCTTGCAGT
>EYKX4VC01BCGYW length=115 xy=0434_3926 region=1 run=R_2007_11_07_16_15_57_
GGCCAGCCGGGACAGCGTTGTTGGGCTGCATGGCGACGAGCTAAAAGTCGCCATCACCGC
CCCGCCGGTTGATGGGCAGGCTAATGCCCATCTGGTAAAAACTTTCTCGCCAAAC
>EYKX4VC01AZXC6 length=116 xy=0292_0280 region=1 run=R_2007_11_07_16_15_57_
GGGGGCGTTTGGCCTGTCGTCCGGCACCTCGCAAGAGCTACAGCAGGCGCGGCTGGCGAT
CATCGGCGGCACGCCGGCCTATATGTCGCCGGAACACACCACCCGCACCCAACGCG
>EYKX4VC01CATH5 length=82 xy=0826_0843 region=1 run=R_2007_11_07_16_15_57_
CGAAATTGCACATTCTCGGCCATATCTCTGGACCTACATGACCGATTTGATCATCTTCGA
ACTTAGCCTTCCTTTNTTAACG
>EYKX4VC01BCEIV length=47 xy=0434_0757 region=1 run=R_2007_11_07_16_15_57_
TGACGTCGTGCCGAGCTACGACAATGCCGACATGGTGATCGTTAACA
>EYKX4VC01BWERM length=83 xy=0662_0304 region=1 run=R_2007_11_07_16_15_57_
CGGTCGGCCTCACCATGGAGAAGATCCCGCCCCGGCCGAGGTCATGGTGGATCTCGGCCA
GGGCGTGCTGATGAAGTTCAAAT
>EYKX4VC01BT2O7 length=69 xy=0635_1945 region=1 run=R_2007_11_07_16_15_57_
AGCGTTTCTCCAGCCGGTCGGCTACGCCGTTTGCCCCTGAAAGACGCTGTTCAGACCGAA
CGCGGTAAA
>EYKX4VC01BO0UO length=222 xy=0577_3838 region=1 run=R_2007_11_07_16_15_57_
AGACCTGGGACAGCGGCGGGCTGCTGAAGCCGCAGGCGATAGAGGACAAACTGCAGTACC
GCTTCTGGCTGCACTATGCCGAAGGCTCGCTGATGCCGCTGCTGTTAATGAAGCTGGTGT
TCGCCAGCCTGGGTAAACCCCCTGTGCCCTTTGGCGTCCGCTCGCTGGGCGCCCTGCTGG
GCAAGGGCATTCAGAAAGCGTGGCTGGATCCCCAGCTGGCCA
>EYKX4VC01CBCPK length=83 xy=0832_1158 region=1 run=R_2007_11_07_16_15_57_
CGGTCGGCCTCACCATGGAGAAGATCCCGCCCCGGCCGAGGTCATGGTGGATCTCGGCCA
GGGCGTGCTGATGAAGTTCAAAT
>EYKX4VC01B474S length=54 xy=0762_2010 region=1 run=R_2007_11_07_16_15_57_
AGCAGTTTTCCAGCGCTTTCGAAGAGCGCTGGCGCGCGCGGGCTTCCAGCATAT
>EYKX4VC01BB4QL length=57 xy=0431_0363 region=1 run=R_2007_11_07_16_15_57_
GGGGAGGAGCTAATAATATGCTCTTGGGGAGGAGCTAATTATATGCTCTTGGGGAGG
>EYKX4VC01BJ37M length=64 xy=0522_0192 region=1 run=R_2007_11_07_16_15_57_
TCGAGTATGTATCAAGGACTACATACAAATTTGCCAAAAGAGATTATGCACTATCCCGAC
TTCC
>EYKX4VC01BV9R8 length=54 xy=0660_2038 region=1 run=R_2007_11_07_16_15_57_
AAAACTCGGAGAAACTATTCAGCAGCACTGCGTTTCGCTGAATTTTAGACCGTT
>EYKX4VC01CEPP8 length=60 xy=0870_2350 region=1 run=R_2007_11_07_16_15_57_
CTGGGTGGGTGCACTACAGGAACGTCATTTGTTCAATCCTCACGTTGTTGTTAGTGTCAG
>EYKX4VC01BTLME length=78 xy=0630_0292 region=1 run=R_2007_11_07_16_15_57_
TTATCCACACGCTGTCCGGATCCAGCGCCAGGCGCCGACGCTGGACTTCCGCCGCCTGCG
CCCAGTTGCCCTGACTTC