Mercurial > repos > devteam > fastq_manipulation
view test-data/misc_dna_as_sanger_rev_comp_1.fastqsanger @ 3:7861f3b10c68 draft
"planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/galaxy_sequence_utils/fastq_manipulation commit 31edb920789fbd080260f853bc856be72fa7cfa8"
| author | devteam |
|---|---|
| date | Fri, 01 Nov 2019 13:24:05 -0400 |
| parents | 5d1e9e13e8db |
| children |
line wrap: on
line source
@FAKE0007 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) TACGTACGTACGTACGTACGTACGTACGTACGTACGTACGT + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0008 Original version has mixed case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) cgCTatgAcgCTatgAcgCTatgAcgCTatgAcgCTatgAc + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0009 Original version has lower case unambiguous DNA with PHRED scores from 0 to 40 inclusive (in that order) actgactgactgactgactgactgactgactgactgactga + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0010 Original version has mixed case ambiguous DNA and PHRED scores of 40, 30, 20, 10 (cycled) NHBVDMKSWRYGATCnhbvdmkswrygatc + ?I+5?I+5?I+5?I+5?I+5?I+5?I+5?I
