Mercurial > repos > devteam > fastq_manipulation
view test-data/misc_rna_as_sanger_rev_comp_1.fastqsanger @ 6:e06d41f3ed3e draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/main/tool_collections/galaxy_sequence_utils/fastq_manipulation commit a5766d27dcddd1891766476a913d0eae1ec7a3c9
| author | iuc |
|---|---|
| date | Sun, 23 Nov 2025 17:50:28 +0000 |
| parents | 5d1e9e13e8db |
| children |
line wrap: on
line source
@FAKE0011 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) UACGUACGUACGUACGUACGUACGUACGUACGUACGUACGU + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0012 Original version has mixed case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) cgCUaugAcgCUaugAcgCUaugAcgCUaugAcgCUaugAc + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0013 Original version has lower case unambiguous RNA with PHRED scores from 0 to 40 inclusive (in that order) acugacugacugacugacugacugacugacugacugacuga + IHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! @FAKE0014 Original version has mixed case ambiguous RNA with PHRED scores from 35 to 40 inclusive (cycled) NHBVDMKSWRYGAUCnhbvdmkswrygauc + IHGFEDIHGFEDIHGFEDIHGFEDIHGFED
