comparison fastq_paired_end_interlacer.xml @ 0:b89bdf6acb6c draft

Imported from capsule None

0:b89bdf6acb6c

<tool id="fastq_paired_end_interlacer" name="FASTQ interlacer" version="1.1">
  <description>on paired end reads</description>
  <requirements>
    <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement>
  </requirements>
  <command interpreter="python">fastq_paired_end_interlacer.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$input2_file' '${input2_file.extension[len( 'fastq' ):]}' '$outfile_pairs' '$outfile_singles'</command>
  <inputs>
    <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="Left-hand mates" />
    <param name="input2_file" type="data" format="fastqsanger,fastqcssanger" label="Right-hand mates" />
  </inputs>
  <outputs>
    <!-- $input1_file.name = filename  , e.g. paired_end_2_errors.fastqsanger -->
    <!-- $input1_file.id   = ID        , e.g. 10 -->
    <!-- $input1_file.hid  = history ID, e.g. 5  -->
    <data name="outfile_pairs"   format="input" label="FASTQ interlacer pairs from data ${input1_file.hid} and data ${input2_file.hid}"/>
    <data name="outfile_singles" format="input" label="FASTQ interlacer singles from data ${input1_file.hid} and data ${input2_file.hid}"/>
  </outputs>
  <tests>
    <test>
      <param name="input1_file" value="paired_end_1.fastqsanger" ftype="fastqsanger" />
      <param name="input2_file" value="paired_end_2.fastqsanger" ftype="fastqsanger" />
      <output name="outfile_pairs" file="paired_end_merged.fastqsanger" />
      <output name="outfile_singles" file="paired_end_merged_singles.fastqsanger" />
    </test>
    <test>
      <param name="input1_file" value="paired_end_1_errors.fastqsanger" ftype="fastqsanger" />
      <param name="input2_file" value="paired_end_2_errors.fastqsanger" ftype="fastqsanger" />
      <output name="outfile_pairs" file="paired_end_merged_cleaned.fastqsanger" />
      <output name="outfile_singles" file="paired_end_merged_cleaned_singles.fastqsanger" />
    </test>
  </tests>
  <help>
**What it does**

This tool joins paired end FASTQ reads from two separate files, one with the left mates and one with the right mates, into a single files where left mates alternate with their right mates. The join is performed using sequence identifiers, allowing the two files to contain differing ordering. If a sequence identifier does not appear in both files, it is included in a separate file.

Sequence identifiers with /1 and /2 appended override the left-hand and right-hand designation; i.e. if the reads end with /1 and /2, the read containing /1 will be used as the left-hand read and the read containing /2 will be used as the right-hand read. Sequences without this designation will follow the left-hand and right-hand settings set by the user.

-----

**Input**

Left-hand mates, for example::

    @1539:931/1
    ACTTCCCGCGCGTGAAGGCGCCGGCAAACGAGGCTCGGGAAGGGGCTCCCG
    +1539:931/1
    BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

Right-hand mates, for example::

    @1539:931/2
    CGCCATTCCGAATCGTAGTTGTCGGCGTCTTCCAGTGCGGCAAGGCATCGT
    +1539:931/2
    WNUUZ\P^`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

-----

**Output**

A multiple-fastq file containing interlaced left and right paired reads::

    @1539:931/1
    ACTTCCCGCGCGTGAAGGCGCCGGCAAACGAGGCTCGGGAAGGGGCTCCCG
    +1539:931/1
    BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
    @1539:931/2
    CGCCATTCCGAATCGTAGTTGTCGGCGTCTTCCAGTGCGGCAAGGCATCGT
    +1539:931/2
    WNUUZ\P^`BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB

A multiple-fastq file containing reads that have no mate is also produced.

  </help>
</tool>