annotate fastq_paired_end_splitter.xml @ 0:c549e99026db draft

Imported from capsule None

<tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="1.0.0">
  <description>on joined paired end reads</description>
  <requirements>
    <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement>
  </requirements>
  <command interpreter="python">fastq_paired_end_splitter.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$output1_file' '$output2_file'</command>
  <inputs>
    <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="FASTQ reads" />
  </inputs>
  <outputs>
    <data name="output1_file" format="input" />
    <data name="output2_file" format="input" />
  </outputs>
  <tests>
    <test>
      <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" />
      <output name="output1_file" file="split_pair_reads_1.fastqsanger" />
      <output name="output2_file" file="split_pair_reads_2.fastqsanger" />
    </test>
  </tests>
  <help>
**What it does**

Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length.  

Sequence identifiers will have /1 or /2 appended for the split left-hand and right-hand reads, respectively.

-----

**Input format**

A multiple-fastq file, for example::

    @HWI-EAS91_1_30788AAXX:7:21:1542:1758
    GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
    +HWI-EAS91_1_30788AAXX:7:21:1542:1758
    hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR


-----

**Outputs**

Left-hand Read::

    @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
    GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC
    +HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
    hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh

Right-hand Read::

    @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
    GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
    +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
    hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR

------

**Citation**

If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. &lt;http://www.ncbi.nlm.nih.gov/pubmed/20562416&gt;`_


  </help>
</tool>