Mercurial > repos > devteam > fastq_paired_end_splitter

comparison fastq_paired_end_splitter.xml @ 2:9bbe5b7ffa12 draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/galaxy_sequence_utils/fastq_paired_end_splitter commit f2582539542b33240234e8ea6093e25d0aee9b6a
author devteam
date Sat, 30 Sep 2017 13:55:17 -0400
parents c80bce242eec
children 35e38452bb3f
comparison
equal deleted inserted replaced
1:c80bce242eec 2:9bbe5b7ffa12
1 <tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="1.0.0"> 1 <tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="1.1.1">
2 <description>on joined paired end reads</description> 2 <description>on joined paired end reads</description>
3 <requirements> 3 <requirements>
4 <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement> 4 <requirement type="package" version="1.1.1">galaxy_sequence_utils</requirement>
5 </requirements> 5 </requirements>
6 <command interpreter="python">fastq_paired_end_splitter.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$output1_file' '$output2_file'</command> 6 <command><![CDATA[
7 <inputs> 7 gx-fastq-paired-end-splitter '$input1_file' '${input1_file.extension[len('fastq'):]}' '$output1_file' '$output2_file'
8 <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="FASTQ reads" /> 8 ]]></command>
9 </inputs> 9 <inputs>
10 <outputs> 10 <param name="input1_file" type="data" format="fastqsanger,fastqcssanger,fastqsanger.gz,fastqcssanger.gz,fastqsanger.bz2,fastqcssanger.bz2" label="FASTQ reads" />
11 <data name="output1_file" format="input" /> 11 </inputs>
12 <data name="output2_file" format="input" /> 12 <outputs>
13 </outputs> 13 <data name="output1_file" format_source="input1_file" />
14 <tests> 14 <data name="output2_file" format_source="input1_file" />
15 <test> 15 </outputs>
16 <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" /> 16 <tests>
17 <output name="output1_file" file="split_pair_reads_1.fastqsanger" /> 17 <test>
18 <output name="output2_file" file="split_pair_reads_2.fastqsanger" /> 18 <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" />
19 </test> 19 <output name="output1_file" file="split_pair_reads_1.fastqsanger" ftype="fastqsanger" />
20 </tests> 20 <output name="output2_file" file="split_pair_reads_2.fastqsanger" ftype="fastqsanger" />
21 <help> 21 </test>
22 </tests>
23 <help><![CDATA[
22 **What it does** 24 **What it does**
23 25
24 Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length. 26 Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length.
25 27
26 Sequence identifiers will have /1 or /2 appended for the split left-hand and right-hand reads, respectively. 28 Sequence identifiers will have /1 or /2 appended for the split left-hand and right-hand reads, respectively.
27 29
28 ----- 30 -----
29 31
33 35
34 @HWI-EAS91_1_30788AAXX:7:21:1542:1758 36 @HWI-EAS91_1_30788AAXX:7:21:1542:1758
35 GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA 37 GTCAATTGTACTGGTCAATACTAAAAGAATAGGATCGCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
36 +HWI-EAS91_1_30788AAXX:7:21:1542:1758 38 +HWI-EAS91_1_30788AAXX:7:21:1542:1758
37 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR 39 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
38
39 40
40 ----- 41 -----
41 42
42 **Outputs** 43 **Outputs**
43 44
52 53
53 @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 54 @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
54 GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA 55 GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
55 +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 56 +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
56 hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR 57 hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
57 58 ]]></help>
58 ------ 59 <citations>
59 60 <citation type="doi">10.1093/bioinformatics/btq281</citation>
60 61 </citations>
61 </help>
62
63 <citations>
64 <citation type="doi">10.1093/bioinformatics/btq281</citation>
65 </citations>
66
67 </tool> 62 </tool>