Mercurial > repos > devteam > fastq_paired_end_splitter

comparison fastq_paired_end_splitter.xml @ 5:e39cc71d3ed6 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/galaxy_sequence_utils/fastq_paired_end_splitter commit a1525904286610e94e833a648d9b20aebb0967e7"
author iuc
date Wed, 09 Mar 2022 08:11:31 +0000
parents 249c8393f2d4
children
comparison
equal deleted inserted replaced
4:249c8393f2d4 5:e39cc71d3ed6
1 <tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="@TOOL_VERSION@"> 1 <tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="@TOOL_VERSION@+galaxy1">
2 <description>on joined paired end reads</description> 2 <description>on joined paired end reads</description>
3 <macros> 3 <macros>
4 <import>macros.xml</import> 4 <import>macros.xml</import>
5 </macros> 5 </macros>
6 <expand macro="requirements"/> 6 <expand macro="requirements"/>
15 ]]></command> 15 ]]></command>
16 <inputs> 16 <inputs>
17 <param name="input1_file" type="data" format="fastqsanger,fastqcssanger,fastqsanger.gz,fastqcssanger.gz,fastqsanger.bz2,fastqcssanger.bz2" label="FASTQ reads" /> 17 <param name="input1_file" type="data" format="fastqsanger,fastqcssanger,fastqsanger.gz,fastqcssanger.gz,fastqsanger.bz2,fastqcssanger.bz2" label="FASTQ reads" />
18 </inputs> 18 </inputs>
19 <outputs> 19 <outputs>
20 <data name="output1_file" format_source="input1_file" /> 20 <data name="output1_file" format_source="input1_file" label="${tool.name} on ${on_string}: Forward"/>
21 <data name="output2_file" format_source="input1_file" /> 21 <data name="output2_file" format_source="input1_file" label="${tool.name} on ${on_string}: Reverse"/>
22 </outputs> 22 </outputs>
23 <tests> 23 <tests>
24 <test> 24 <test>
25 <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" /> 25 <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" />
26 <output name="output1_file" file="split_pair_reads_1.fastqsanger" ftype="fastqsanger" /> 26 <output name="output1_file" file="split_pair_reads_1.fastqsanger" ftype="fastqsanger" />
30 <help><![CDATA[ 30 <help><![CDATA[
31 **What it does** 31 **What it does**
32 32
33 Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length. 33 Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length.
34 34
35 Sequence identifiers will have /1 or /2 appended for the split left-hand and right-hand reads, respectively. 35 Sequence identifiers will have /1 or /2 appended for the split forward and reverse reads, respectively.
36 36
37 ----- 37 -----
38 38
39 **Input format** 39 **Input format**
40 40
47 47
48 ----- 48 -----
49 49
50 **Outputs** 50 **Outputs**
51 51
52 Left-hand Read:: 52 Forward Read::
53 53
54 @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 54 @HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
55 GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC 55 GTCAATTGTACTGGTCAATACTAAAAGAATAGGATC
56 +HWI-EAS91_1_30788AAXX:7:21:1542:1758/1 56 +HWI-EAS91_1_30788AAXX:7:21:1542:1758/1
57 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh 57 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh
58 58
59 Right-hand Read:: 59 Reverse Read::
60 60
61 @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 61 @HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
62 GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA 62 GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
63 +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2 63 +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
64 hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR 64 hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR