# HG changeset patch
# User devteam
# Date 1506794117 14400
# Node ID 9bbe5b7ffa12387af0ecac9b21d7361c430b81cd
# Parent  c80bce242eecea17fa3e8a2e7f3b89cd1e13cefa
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/galaxy_sequence_utils/fastq_paired_end_splitter commit f2582539542b33240234e8ea6093e25d0aee9b6a

diff -r c80bce242eec -r 9bbe5b7ffa12 fastq_paired_end_splitter.py
--- a/fastq_paired_end_splitter.py	Wed Nov 11 12:42:17 2015 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,33 +0,0 @@
-#Dan Blankenberg
-import sys, os, shutil
-from galaxy_utils.sequence.fastq import fastqReader, fastqWriter, fastqSplitter
-
-def main():
-    #Read command line arguments
-    input_filename = sys.argv[1]
-    input_type = sys.argv[2] or 'sanger'
-    output1_filename = sys.argv[3]
-    output2_filename = sys.argv[4]
-    
-    splitter = fastqSplitter()
-    out1 = fastqWriter( open( output1_filename, 'wb' ), format = input_type )
-    out2 = fastqWriter( open( output2_filename, 'wb' ), format = input_type )
-    
-    i = None
-    skip_count = 0
-    for i, fastq_read in enumerate( fastqReader( open( input_filename, 'rb' ), format = input_type ) ):
-        read1, read2 = splitter.split( fastq_read )
-        if read1 and read2:
-            out1.write( read1 )
-            out2.write( read2 )
-        else:
-            skip_count += 1
-    out1.close()
-    out2.close()
-    if i is None:
-        print "Your file contains no valid FASTQ reads."
-    else:
-        print 'Split %s of %s reads (%.2f%%).' % ( i - skip_count + 1, i + 1, float( i - skip_count + 1 ) / float( i + 1 ) * 100.0 )
-
-if __name__ == "__main__":
-    main()
diff -r c80bce242eec -r 9bbe5b7ffa12 fastq_paired_end_splitter.xml
--- a/fastq_paired_end_splitter.xml	Wed Nov 11 12:42:17 2015 -0500
+++ b/fastq_paired_end_splitter.xml	Sat Sep 30 13:55:17 2017 -0400
@@ -1,27 +1,29 @@
-<tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="1.0.0">
-  <description>on joined paired end reads</description>
-  <requirements>
-    <requirement type="package" version="1.0.0">galaxy_sequence_utils</requirement>
-  </requirements>
-  <command interpreter="python">fastq_paired_end_splitter.py '$input1_file' '${input1_file.extension[len( 'fastq' ):]}' '$output1_file' '$output2_file'</command>
-  <inputs>
-    <param name="input1_file" type="data" format="fastqsanger,fastqcssanger" label="FASTQ reads" />
-  </inputs>
-  <outputs>
-    <data name="output1_file" format="input" />
-    <data name="output2_file" format="input" />
-  </outputs>
-  <tests>
-    <test>
-      <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" />
-      <output name="output1_file" file="split_pair_reads_1.fastqsanger" />
-      <output name="output2_file" file="split_pair_reads_2.fastqsanger" />
-    </test>
-  </tests>
-  <help>
+<tool id="fastq_paired_end_splitter" name="FASTQ splitter" version="1.1.1">
+    <description>on joined paired end reads</description>
+    <requirements>
+        <requirement type="package" version="1.1.1">galaxy_sequence_utils</requirement>
+    </requirements>
+    <command><![CDATA[
+gx-fastq-paired-end-splitter '$input1_file' '${input1_file.extension[len('fastq'):]}' '$output1_file' '$output2_file'
+    ]]></command>
+    <inputs>
+        <param name="input1_file" type="data" format="fastqsanger,fastqcssanger,fastqsanger.gz,fastqcssanger.gz,fastqsanger.bz2,fastqcssanger.bz2" label="FASTQ reads" />
+    </inputs>
+    <outputs>
+        <data name="output1_file" format_source="input1_file" />
+        <data name="output2_file" format_source="input1_file" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input1_file" value="3.fastqsanger" ftype="fastqsanger" />
+            <output name="output1_file" file="split_pair_reads_1.fastqsanger" ftype="fastqsanger" />
+            <output name="output2_file" file="split_pair_reads_2.fastqsanger" ftype="fastqsanger" />
+        </test>
+    </tests>
+    <help><![CDATA[
 **What it does**
 
-Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length.  
+Splits a single fastq dataset representing paired-end run into two datasets (one for each end). This tool works only for datasets where both ends have **the same** length.
 
 Sequence identifiers will have /1 or /2 appended for the split left-hand and right-hand reads, respectively.
 
@@ -36,7 +38,6 @@
     +HWI-EAS91_1_30788AAXX:7:21:1542:1758
     hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
 
-
 -----
 
 **Outputs**
@@ -54,14 +55,8 @@
     GCTCCTAGCATCTGGAGTCTCTATCACCTGAGCCCA
     +HWI-EAS91_1_30788AAXX:7:21:1542:1758/2
     hhhhhhhhhhhhhhhhhhhhhhhh`hfhhVZSWehR
-
-------
-
-
-  </help>
-  
-  <citations>
-    <citation type="doi">10.1093/bioinformatics/btq281</citation>
-  </citations>
-  
+    ]]></help>
+    <citations>
+        <citation type="doi">10.1093/bioinformatics/btq281</citation>
+    </citations>
 </tool>
diff -r c80bce242eec -r 9bbe5b7ffa12 tool_dependencies.xml
--- a/tool_dependencies.xml	Wed Nov 11 12:42:17 2015 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-  <package name="galaxy_sequence_utils" version="1.0.0">
-      <repository changeset_revision="0643676ad5f7" name="package_galaxy_utils_1_0" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" />
-    </package>
-</tool_dependency>