diff fastq_to_fasta.xml @ 0:04614cf6ed39 draft

Uploaded tool tarball.

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/fastq_to_fasta.xml	Wed Sep 25 11:04:26 2013 -0400
@@ -0,0 +1,82 @@
+<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA">
+	<description>converter</description>
+    <requirements>
+        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
+    </requirements>
+	<command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v 
+#if $input.ext == "fastqsanger":
+-Q 33
+#end if
+	</command>
+
+	<inputs>
+		<param format="fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="FASTQ Library to convert" />
+
+		<param name="SKIPN" type="select" label="Discard sequences with unknown (N) bases ">
+			<option value="">yes</option>
+			<option value="-n">no</option>
+		</param>
+
+		<param name="RENAMESEQ" type="select" label="Rename sequence names in output file (reduces file size)">
+			<option value="-r">yes</option>
+			<option value="">no</option>
+		</param>
+
+	</inputs>
+
+	<tests>
+		<test>
+			<!-- FASTQ-To-FASTA, keep N, don't rename -->
+			<param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
+			<param name="SKIPN" value=""/>
+			<param name="RENAMESEQ" value=""/>
+			<output name="output" file="fastq_to_fasta1a.out" />
+		</test>
+		<test>
+			<!-- FASTQ-To-FASTA, discard N, rename -->
+			<param name="input" value="fastq_to_fasta1.fastq" ftype="fastqsolexa" />
+			<param name="SKIPN" value="no"/>
+			<param name="RENAMESEQ" value="yes"/>
+			<output name="output" file="fastq_to_fasta1b.out" />
+		</test>
+	</tests>
+
+	<outputs>
+		<data format="fasta" name="output" metadata_source="input" />
+	</outputs>
+
+<help>
+
+**What it does**
+
+This tool converts data from Solexa format to FASTA format (scroll down for format description).
+
+--------
+
+**Example**
+
+The following data in Solexa-FASTQ format::
+
+    @CSHL_4_FC042GAMMII_2_1_517_596
+    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+    +CSHL_4_FC042GAMMII_2_1_517_596
+    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
+  
+Will be converted to FASTA (with 'rename sequence names' = NO)::
+
+    >CSHL_4_FC042GAMMII_2_1_517_596
+    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+    
+Will be converted to FASTA (with 'rename sequence names' = YES)::
+
+    >1
+    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+    
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/    
+</help>
+<!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon ([e-mail]) -->
+</tool>