# HG changeset patch
# User devteam
# Date 1390832805 18000
# Node ID 1cdcaf5fc1da3760aaebc01beabe0ee6de60d6fc
Imported from capsule None
diff -r 000000000000 -r 1cdcaf5fc1da fastq_trimmer_by_quality.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastq_trimmer_by_quality.py Mon Jan 27 09:26:45 2014 -0500
@@ -0,0 +1,126 @@
+#Dan Blankenberg
+from optparse import OptionParser
+from galaxy_utils.sequence.fastq import fastqReader, fastqWriter
+
+def mean( score_list ):
+ return float( sum( score_list ) ) / float( len( score_list ) )
+
+ACTION_METHODS = { 'min':min, 'max':max, 'sum':sum, 'mean':mean }
+
+def compare( aggregated_value, operator, threshold_value ):
+ if operator == '>':
+ return aggregated_value > threshold_value
+ elif operator == '>=':
+ return aggregated_value >= threshold_value
+ elif operator == '==':
+ return aggregated_value == threshold_value
+ elif operator == '<':
+ return aggregated_value < threshold_value
+ elif operator == '<=':
+ return aggregated_value <= threshold_value
+ elif operator == '!=':
+ return aggregated_value != threshold_value
+
+def exclude( value_list, exclude_indexes ):
+ rval = []
+ for i, val in enumerate( value_list ):
+ if i not in exclude_indexes:
+ rval.append( val )
+ return rval
+
+def exclude_and_compare( aggregate_action, aggregate_list, operator, threshold_value, exclude_indexes = None ):
+ if not aggregate_list or compare( aggregate_action( aggregate_list ), operator, threshold_value ):
+ return True
+ if exclude_indexes:
+ for exclude_index in exclude_indexes:
+ excluded_list = exclude( aggregate_list, exclude_index )
+ if not excluded_list or compare( aggregate_action( excluded_list ), operator, threshold_value ):
+ return True
+ return False
+
+def main():
+ usage = "usage: %prog [options] input_file output_file"
+ parser = OptionParser( usage=usage )
+ parser.add_option( '-f', '--format', dest='format', type='choice', default='sanger', choices=( 'sanger', 'cssanger', 'solexa', 'illumina' ), help='FASTQ variant type' )
+ parser.add_option( '-s', '--window_size', type="int", dest='window_size', default='1', help='Window size' )
+ parser.add_option( '-t', '--window_step', type="int", dest='window_step', default='1', help='Window step' )
+ parser.add_option( '-e', '--trim_ends', type="choice", dest='trim_ends', default='53', choices=('5','3','53','35' ), help='Ends to Trim' )
+ parser.add_option( '-a', '--aggregation_action', type="choice", dest='aggregation_action', default='min', choices=('min','max','sum','mean' ), help='Aggregate action for window' )
+ parser.add_option( '-x', '--exclude_count', type="int", dest='exclude_count', default='0', help='Maximum number of bases to exclude from the window during aggregation' )
+ parser.add_option( '-c', '--score_comparison', type="choice", dest='score_comparison', default='>=', choices=('>','>=','==','<', '<=', '!=' ), help='Keep read when aggregate score is' )
+ parser.add_option( '-q', '--quality_score', type="float", dest='quality_score', default='0', help='Quality Score' )
+ parser.add_option( "-k", "--keep_zero_length", action="store_true", dest="keep_zero_length", default=False, help="Keep reads with zero length")
+ ( options, args ) = parser.parse_args()
+
+ if len ( args ) != 2:
+ parser.error( "Need to specify an input file and an output file" )
+
+ if options.window_size < 1:
+ parser.error( 'You must specify a strictly positive window size' )
+
+ if options.window_step < 1:
+ parser.error( 'You must specify a strictly positive step size' )
+
+ #determine an exhaustive list of window indexes that can be excluded from aggregation
+ exclude_window_indexes = []
+ last_exclude_indexes = []
+ for exclude_count in range( min( options.exclude_count, options.window_size ) ):
+ if last_exclude_indexes:
+ new_exclude_indexes = []
+ for exclude_list in last_exclude_indexes:
+ for window_index in range( options.window_size ):
+ if window_index not in exclude_list:
+ new_exclude = sorted( exclude_list + [ window_index ] )
+ if new_exclude not in exclude_window_indexes + new_exclude_indexes:
+ new_exclude_indexes.append( new_exclude )
+ exclude_window_indexes += new_exclude_indexes
+ last_exclude_indexes = new_exclude_indexes
+ else:
+ for window_index in range( options.window_size ):
+ last_exclude_indexes.append( [ window_index ] )
+ exclude_window_indexes = list( last_exclude_indexes )
+
+ out = fastqWriter( open( args[1], 'wb' ), format = options.format )
+ action = ACTION_METHODS[ options.aggregation_action ]
+
+ num_reads = None
+ num_reads_excluded = 0
+ for num_reads, fastq_read in enumerate( fastqReader( open( args[0] ), format = options.format ) ):
+ for trim_end in options.trim_ends:
+ quality_list = fastq_read.get_decimal_quality_scores()
+ if trim_end == '5':
+ lwindow_position = 0 #left position of window
+ while True:
+ if lwindow_position >= len( quality_list ):
+ fastq_read.sequence = ''
+ fastq_read.quality = ''
+ break
+ if exclude_and_compare( action, quality_list[ lwindow_position:lwindow_position + options.window_size ], options.score_comparison, options.quality_score, exclude_window_indexes ):
+ fastq_read = fastq_read.slice( lwindow_position, None )
+ break
+ lwindow_position += options.window_step
+ else:
+ rwindow_position = len( quality_list ) #right position of window
+ while True:
+ lwindow_position = rwindow_position - options.window_size #left position of window
+ if rwindow_position <= 0 or lwindow_position < 0:
+ fastq_read.sequence = ''
+ fastq_read.quality = ''
+ break
+ if exclude_and_compare( action, quality_list[ lwindow_position:rwindow_position ], options.score_comparison, options.quality_score, exclude_window_indexes ):
+ fastq_read = fastq_read.slice( None, rwindow_position )
+ break
+ rwindow_position -= options.window_step
+ if options.keep_zero_length or len( fastq_read ):
+ out.write( fastq_read )
+ else:
+ num_reads_excluded += 1
+ out.close()
+ if num_reads is None:
+ print "No valid FASTQ reads could be processed."
+ else:
+ print "%i FASTQ reads were processed." % ( num_reads + 1 )
+ if num_reads_excluded:
+ print "%i reads of zero length were excluded from the output." % num_reads_excluded
+
+if __name__ == "__main__": main()
diff -r 000000000000 -r 1cdcaf5fc1da fastq_trimmer_by_quality.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastq_trimmer_by_quality.xml Mon Jan 27 09:26:45 2014 -0500
@@ -0,0 +1,148 @@
+
+ by sliding window
+
+ galaxy_sequence_utils
+
+ fastq_trimmer_by_quality.py '$input_file' '$output_file' -f '${input_file.extension[len( 'fastq' ):]}' -s '$window_size'
+ -t '$step_size' -e '$trim_ends' -a '$aggregation_action' -x '$exclude_count' -c '$score_comparison' -q '$quality_score'
+ #if $keep_zero_length.value:
+ -k
+ #end if
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+This tool allows you to trim the ends of reads based upon the aggregate value of quality scores found within a sliding window; a sliding window of size 1 is equivalent to 'simple' trimming of the ends.
+
+The user specifies the aggregating action (min, max, sum, mean) to perform on the quality score values found within the sliding window to be used with the user defined comparison operation and comparison value.
+
+The user can provide a maximum count of bases that can be excluded from the aggregation within the window. When set, this tool will first check the aggregation of the entire window, then after removing 1 value, then after removing 2 values, up to the number declared. Setting this value to be equal to or greater than the window size will cause no trimming to occur.
+
+-----
+
+.. class:: warningmark
+
+Trimming a color space read will cause any adapter base to be lost.
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
+
+
diff -r 000000000000 -r 1cdcaf5fc1da test-data/empty_file.dat
diff -r 000000000000 -r 1cdcaf5fc1da test-data/sanger_full_range_empty_reads.fastqsanger
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sanger_full_range_empty_reads.fastqsanger Mon Jan 27 09:26:45 2014 -0500
@@ -0,0 +1,8 @@
+@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order)
+
++
+
+@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order)
+
++
+
diff -r 000000000000 -r 1cdcaf5fc1da test-data/sanger_full_range_original_sanger.fastqsanger
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sanger_full_range_original_sanger.fastqsanger Mon Jan 27 09:26:45 2014 -0500
@@ -0,0 +1,8 @@
+@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order)
+ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
++
+!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order)
+CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA
++
+~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
diff -r 000000000000 -r 1cdcaf5fc1da test-data/sanger_full_range_quality_trimmed_out_1.fastqsanger
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sanger_full_range_quality_trimmed_out_1.fastqsanger Mon Jan 27 09:26:45 2014 -0500
@@ -0,0 +1,8 @@
+@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order)
+ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
++
+56789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order)
+CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA
++
+~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:98765
diff -r 000000000000 -r 1cdcaf5fc1da test-data/sanger_full_range_quality_trimmed_out_2.fastqsanger
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sanger_full_range_quality_trimmed_out_2.fastqsanger Mon Jan 27 09:26:45 2014 -0500
@@ -0,0 +1,8 @@
+@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order)
+ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
++
+56789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order)
+CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA
++
+~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
diff -r 000000000000 -r 1cdcaf5fc1da test-data/sanger_full_range_quality_trimmed_out_3.fastqsanger
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sanger_full_range_quality_trimmed_out_3.fastqsanger Mon Jan 27 09:26:45 2014 -0500
@@ -0,0 +1,8 @@
+@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order)
+ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
++
+!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order)
+CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA
++
+~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:98765
diff -r 000000000000 -r 1cdcaf5fc1da tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Mon Jan 27 09:26:45 2014 -0500
@@ -0,0 +1,6 @@
+
+
+
+
+
+