comparison rgFastQC.xml @ 22:3d0c7bdf12f5 draft

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit b3892d09a9d4d72f3eade0fb2f0b61ab0d9f22e3"

21:e7b2202befea

<tool id="fastqc" name="FastQC" version="0.72+galaxy1">
    <description>Read Quality reports</description>
    <requirements>
        <requirement type="package" version="0.11.8">fastqc</requirement>
    </requirements>
    <stdio>
        <exit_code range="1:" level="fatal" description="FastQC returned non zero exit code" />
        <exit_code range=":-1" level="fatal" description="FastQC returned non zero exit code" />
    <regex match="There is insufficient memory for the Java Runtime Environment"

            #end if

            #if $limits.dataset and str($limits) > ''
                --limits '${limits}'
            #end if

            --quiet
            --extract
            #if $min_length:
                --min_length $min_length
            #end if

        && cp '${html_file.files_path}'/*\.html output.html

    ]]></command>
    <inputs>
        <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data"
               label="Short read data from your current history" />
        <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
               help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" />
        <param argument="--adapters" type="data" format="tabular" optional="true" label="Adapter list"
               help="list of adapters adapter sequences which will be explicity searched against the library. tab delimited file with 2 columns: name and sequence." />
        <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
               help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
        <param argument="--nogroup" type="boolean" truevalue="--nogroup" falsevalue="" checked="False"
               label="Disable grouping of bases for reads >50bp" help="Using this option will cause fastqc to crash and burn if you use it on really long reads, and your plots may end up a ridiculous size. You have been warned!"/>
        <param argument="--min_length" type="integer" value="" optional="true"
               label="Lower limit on the length of the sequence to be shown in the report"
               help=" As long as you set this to a value greater or equal to your longest read length then this will be the sequence length used to create your read groups.  This can be useful for making directly comaparable statistics from datasets with somewhat variable read lengths."/>
        <param argument="--kmers" type="integer" value="7" min="2" max="10"
               label="length of Kmer to look for" help="note: the Kmer test is disabled and needs to be enabled using a custom Submodule and limits file"/>
    </inputs>
    <outputs>
        <data format="html" name="html_file" from_work_dir="output.html" label="${tool.name} on ${on_string}: Webpage" />
        <data format="txt" name="text_file"  from_work_dir="output.txt" label="${tool.name} on ${on_string}: RawData" />
    </outputs>

22:3d0c7bdf12f5

<tool id="fastqc" name="FastQC" version="0.73+galaxy0">
    <description>Read Quality reports</description>
    <xrefs>
        <xref type="bio.tools">fastqc</xref>
    </xrefs>
    <requirements>
        <requirement type="package" version="0.11.9">fastqc</requirement>
    </requirements>
    <stdio>
        <exit_code range="1:" level="fatal" description="FastQC returned non zero exit code" />
        <exit_code range=":-1" level="fatal" description="FastQC returned non zero exit code" />
    <regex match="There is insufficient memory for the Java Runtime Environment"

            #end if

            #if $limits.dataset and str($limits) > ''
                --limits '${limits}'
            #end if
            --threads \${GALAXY_SLOTS:-2}
            --quiet
            --extract
            #if $min_length:
                --min_length $min_length
            #end if

        && cp '${html_file.files_path}'/*\.html output.html

    ]]></command>
    <inputs>
        <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data"
               label="Raw read data from your current history" />
        <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
               help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" />
        <param argument="--adapters" type="data" format="tabular" optional="true" label="Adapter list"
               help="List of adapters adapter sequences which will be explicity searched against the library. It should be a tab-delimited file with 2 columns: name and sequence." />
        <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
               help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
        <param argument="--nogroup" type="boolean" truevalue="--nogroup" falsevalue="" checked="False"
               label="Disable grouping of bases for reads >50bp" help="Using this option will cause fastqc to crash and burn if you use it on really long reads, and your plots may end up a ridiculous size. You have been warned!"/>
        <param argument="--min_length" type="integer" value="" optional="true"
               label="Lower limit on the length of the sequence to be shown in the report"
               help=" As long as you set this to a value greater or equal to your longest read length then this will be the sequence length used to create your read groups.  This can be useful for making directly comaparable statistics from datasets with somewhat variable read lengths."/>
        <param argument="--kmers" type="integer" value="7" min="2" max="10"
               label="Length of Kmer to look for" help="Note: the Kmer test is disabled and needs to be enabled using a custom Submodule and limits file"/>
    </inputs>
    <outputs>
        <data format="html" name="html_file" from_work_dir="output.html" label="${tool.name} on ${on_string}: Webpage" />
        <data format="txt" name="text_file"  from_work_dir="output.txt" label="${tool.name} on ${on_string}: RawData" />
    </outputs>