diff test-data/fastqc_data_customlimits.txt @ 23:5ec9f6bceaee draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit 9aa395df821f0d3607867c83536ac97f9ffe8b29
author iuc
date Thu, 08 Jun 2023 20:02:11 +0000
parents 3d0c7bdf12f5
children
line wrap: on
line diff
--- a/test-data/fastqc_data_customlimits.txt	Sun Sep 12 11:20:27 2021 +0000
+++ b/test-data/fastqc_data_customlimits.txt	Thu Jun 08 20:02:11 2023 +0000
@@ -1,10 +1,11 @@
-##FastQC	0.11.9
+##FastQC	0.12.1
 >>Basic Statistics	pass
 #Measure	Value
 Filename	1000trimmed_fastq
 File type	Conventional base calls
 Encoding	Sanger / Illumina 1.9
 Total Sequences	4905
+Total Bases	254.2 kbp
 Sequences flagged as poor quality	0
 Sequence length	1-108
 %GC	40
@@ -344,83 +345,83 @@
 >>END_MODULE
 >>Sequence Duplication Levels	pass
 #Total Deduplicated Percentage	98.73598369011212
-#Duplication Level	Percentage of deduplicated	Percentage of total
-1	99.44249432170142	98.1855249745158
-2	0.47491224447656405	0.9378185524974516
-3	0.041296716911005574	0.12232415902140673
-4	0.020648358455502787	0.08154943934760449
-5	0.0	0.0
-6	0.0	0.0
-7	0.0	0.0
-8	0.0	0.0
-9	0.0	0.0
->10	0.020648358455502787	0.672782874617737
->50	0.0	0.0
->100	0.0	0.0
->500	0.0	0.0
->1k	0.0	0.0
->5k	0.0	0.0
->10k+	0.0	0.0
+#Duplication Level	Percentage of total
+1	98.1855249745158
+2	0.9378185524974516
+3	0.12232415902140673
+4	0.08154943934760449
+5	0.0
+6	0.0
+7	0.0
+8	0.0
+9	0.0
+>10	0.672782874617737
+>50	0.0
+>100	0.0
+>500	0.0
+>1k	0.0
+>5k	0.0
+>10k+	0.0
 >>END_MODULE
 >>Overrepresented sequences	warn
 #Sequence	Count	Percentage	Possible Source
 ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCAT	33	0.672782874617737	No Hit
 >>END_MODULE
 >>Adapter Content	pass
-#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
-1	0.0	0.0	0.0	0.0	0.0
-2	0.0	0.0	0.0	0.0	0.0
-3	0.0	0.0	0.0	0.0	0.0
-4	0.0	0.0	0.0	0.0	0.0
-5	0.0	0.0	0.0	0.0	0.0
-6	0.0	0.0	0.0	0.0	0.0
-7	0.0	0.0	0.0	0.0	0.0
-8	0.0	0.0	0.0	0.0	0.0
-9	0.0	0.0	0.0	0.0	0.0
-10-11	0.0	0.0	0.0	0.0	0.0
-12-13	0.0	0.0	0.0	0.0	0.0
-14-15	0.0	0.0	0.0	0.0	0.0
-16-17	0.0	0.0	0.0	0.0	0.0
-18-19	0.0	0.0	0.0	0.0	0.0
-20-21	0.12232415902140673	0.0	0.0	0.0	0.0
-22-23	0.12232415902140673	0.0	0.0	0.0	0.0
-24-25	0.12232415902140673	0.0	0.0	0.0	0.0
-26-27	0.1325178389398573	0.0	0.0	0.0	0.0
-28-29	0.2038735983690112	0.0	0.0	0.0	0.0
-30-31	0.22426095820591233	0.0	0.0	0.0	0.0
-32-33	0.22426095820591233	0.0	0.0	0.0	0.0
-34-35	0.24464831804281345	0.0	0.0	0.0	0.0
-36-37	0.3058103975535168	0.0	0.0	0.0	0.0
-38-39	0.4383282364933741	0.0	0.0	0.0	0.0
-40-41	0.4689092762487258	0.0	0.0	0.0	0.0
-42-43	0.4689092762487258	0.0	0.0	0.0	0.0
-44-45	0.4689092762487258	0.0	0.0	0.0	0.0
-46-47	0.4689092762487258	0.0	0.0	0.0	0.0
-48-49	0.4689092762487258	0.0	0.0	0.0	0.0
-50-51	0.4689092762487258	0.0	0.0	0.0	0.0
-52-53	0.4689092762487258	0.0	0.0	0.0	0.0
-54-55	0.4689092762487258	0.0	0.0	0.0	0.0
-56-57	0.4689092762487258	0.0	0.0	0.0	0.0
-58-59	0.4689092762487258	0.0	0.0	0.0	0.0
-60-61	0.4689092762487258	0.0	0.0	0.0	0.0
-62-63	0.4689092762487258	0.0	0.0	0.0	0.0
-64-65	0.4689092762487258	0.0	0.0	0.0	0.0
-66-67	0.4689092762487258	0.0	0.0	0.0	0.0
-68-69	0.4689092762487258	0.0	0.0	0.0	0.0
-70-71	0.4689092762487258	0.0	0.0	0.0	0.0
-72-73	0.4689092762487258	0.0	0.0	0.0	0.0
-74-75	0.4689092762487258	0.0	0.0	0.0	0.0
-76-77	0.4689092762487258	0.0	0.0	0.0	0.0
-78-79	0.4689092762487258	0.0	0.0	0.0	0.0
-80-81	0.4689092762487258	0.0	0.0	0.0	0.0
-82-83	0.4689092762487258	0.0	0.0	0.0	0.0
-84-85	0.4689092762487258	0.0	0.0	0.0	0.0
-86-87	0.4689092762487258	0.0	0.0	0.0	0.0
-88-89	0.4689092762487258	0.0	0.0	0.0	0.0
-90-91	0.4689092762487258	0.0	0.0	0.0	0.0
-92-93	0.4689092762487258	0.0	0.0	0.0	0.0
-94-95	0.4689092762487258	0.0	0.0	0.0	0.0
-96-97	0.4689092762487258	0.0	0.0	0.0	0.0
+#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	PolyA	PolyG
+1	0.0	0.0	0.0	0.0	0.020387359836901122	0.0
+2	0.0	0.0	0.0	0.0	0.06116207951070336	0.0
+3	0.0	0.0	0.0	0.0	0.06116207951070336	0.0
+4	0.0	0.0	0.0	0.0	0.06116207951070336	0.0
+5	0.0	0.0	0.0	0.0	0.12232415902140673	0.0
+6	0.0	0.0	0.0	0.0	0.12232415902140673	0.0
+7	0.0	0.0	0.0	0.0	0.12232415902140673	0.0
+8	0.0	0.0	0.0	0.0	0.14271151885830785	0.0
+9	0.0	0.0	0.0	0.0	0.14271151885830785	0.0
+10-11	0.0	0.0	0.0	0.0	0.14271151885830785	0.0
+12-13	0.0	0.0	0.0	0.0	0.1529051987767584	0.0
+14-15	0.0	0.0	0.0	0.0	0.17329255861365955	0.0
+16-17	0.0	0.0	0.0	0.0	0.21406727828746175	0.0
+18-19	0.0	0.0	0.0	0.0	0.22426095820591233	0.0
+20-21	0.12232415902140673	0.0	0.0	0.0	0.24464831804281345	0.0
+22-23	0.12232415902140673	0.0	0.0	0.0	0.24464831804281345	0.0
+24-25	0.12232415902140673	0.0	0.0	0.0	0.24464831804281345	0.0
+26-27	0.1325178389398573	0.0	0.0	0.0	0.24464831804281345	0.0
+28-29	0.2038735983690112	0.0	0.0	0.0	0.24464831804281345	0.0
+30-31	0.22426095820591233	0.0	0.0	0.0	0.24464831804281345	0.0
+32-33	0.22426095820591233	0.0	0.0	0.0	0.2650356778797146	0.0
+34-35	0.24464831804281345	0.0	0.0	0.0	0.29561671763506625	0.0
+36-37	0.3058103975535168	0.0	0.0	0.0	0.31600407747196735	0.0
+38-39	0.4383282364933741	0.0	0.0	0.0	0.32619775739041795	0.0
+40-41	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+42-43	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+44-45	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+46-47	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+48-49	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+50-51	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+52-53	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+54-55	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+56-57	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+58-59	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+60-61	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+62-63	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+64-65	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+66-67	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+68-69	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+70-71	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+72-73	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+74-75	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+76-77	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+78-79	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+80-81	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+82-83	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+84-85	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+86-87	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+88-89	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+90-91	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+92-93	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+94-95	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
+96-97	0.4689092762487258	0.0	0.0	0.0	0.32619775739041795	0.0
 >>END_MODULE
 >>Kmer Content	pass
 >>END_MODULE