# HG changeset patch
# User devteam
# Date 1447263531 18000
# Node ID bdf1ce174e39275a4295d3010c8e899195e9b39e
# Parent  8192b401497728cc3fbdaaca59d523deb1d983e5
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_clipper commit a1517c9d22029095120643bbe2c8fa53754dd2b7

diff -r 8192b4014977 -r bdf1ce174e39 fastx_clipper.xml
--- a/fastx_clipper.xml	Tue Jun 03 14:54:53 2014 -0400
+++ b/fastx_clipper.xml	Wed Nov 11 12:38:51 2015 -0500
@@ -1,80 +1,77 @@
-<tool id="cshl_fastx_clipper" name="Clip" version="1.0.1" >
-  <description>adapter sequences</description>
-  <requirements>
-      <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-  </requirements>
-  <command>
-    zcat -f $input | fastx_clipper -l $minlength -a $clip_source.clip_sequence -d $keepdelta -o $output -v $KEEP_N $DISCARD_OPTIONS
+<tool id="cshl_fastx_clipper" name="Clip" version="1.0.1">
+    <description>adapter sequences</description>
+    <requirements>
+        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
+    </requirements>
+    <command>
+<![CDATA[
+zcat -f < '$input' | fastx_clipper -l $minlength -a '$clip_source.clip_sequence' -d $keepdelta -o '$output' -v $KEEP_N $DISCARD_OPTIONS
 #if $input.ext == "fastqsanger":
- -Q 33
+   -Q 33
 #end if
-  </command>
-  
-  <inputs>
-    <param format="fasta,fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="Library to clip" />
-  
-    <param name="minlength" size="4" type="integer" value="15">
-      <label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label>
-    </param>
+]]>
+    </command>
 
-	<conditional name="clip_source">
-		<param name="clip_source_list" type="select" label="Source">
-			<option value="prebuilt" selected="true">Standard (select from the list below)</option>
-			<option value="user">Enter custom sequence</option>
-		</param>
+    <inputs>
+        <param format="fasta,fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="Library to clip" />
 
-		<when value="user">
-			<param name="clip_sequence" size="30" label="Enter custom clipping sequence" type="text" value="AATTGGCC" />
-		</when>
+        <param name="minlength" type="integer" value="15">
+            <label>Minimum sequence length (after clipping, sequences shorter than this length will be discarded)</label>
+        </param>
 
-		<when value="prebuilt">
-			<param name="clip_sequence" type="select" label="Choose Adapter">
-				<options from_file="fastx_clipper_sequences.txt">
-					<column name="name" index="1"/>
-					<column name="value" index="0"/>
-				</options>
-			</param> 
-		</when>
-	</conditional>
+        <conditional name="clip_source">
+            <param name="clip_source_list" type="select" label="Source">
+                <option value="prebuilt" selected="true">Standard (select from the list below)</option>
+                <option value="user">Enter custom sequence</option>
+            </param>
+
+            <when value="user">
+                <param name="clip_sequence" label="Enter custom clipping sequence" type="text" value="AATTGGCC" />
+            </when>
 
-	<param name="keepdelta" size="2" type="integer" value="0">
-		<label>enter non-zero value to keep the adapter sequence and x bases that follow it</label>
-		<help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help>
-	</param>
+            <when value="prebuilt">
+                <param name="clip_sequence" type="select" label="Choose Adapter">
+                    <options from_file="fastx_clipper_sequences.txt">
+                        <column name="name" index="1"/>
+                        <column name="value" index="0"/>
+                    </options>
+                </param>
+            </when>
+        </conditional>
 
-	<param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases">
-		<option value="">Yes</option>
-		<option value="-n">No</option>
-	</param>
+        <param name="keepdelta" type="integer" value="0">
+            <label>enter non-zero value to keep the adapter sequence and x bases that follow it</label>
+            <help>use this for hairpin barcoding. keep at 0 unless you know what you're doing.</help>
+        </param>
 
-	<param name="DISCARD_OPTIONS" type="select" label="Output options">
-		<option value="-c">Output only clipped sequences (i.e. sequences which contained the adapter)</option>
-		<option value="-C">Output only non-clipped sequences (i.e. sequences which did not contained the adapter)</option>
-		<option value="">Output both clipped and non-clipped sequences</option>
-	</param>
+        <param name="KEEP_N" type="select" label="Discard sequences with unknown (N) bases">
+            <option value="">Yes</option>
+            <option value="-n">No</option>
+        </param>
 
-  </inputs>
-	<!--
-	#functional test with param value starting with - fails.	
-	-->
-	<tests>
-		<test>
-			<param name="input" value="fastx_clipper1.fastq" ftype="fastqsolexa"/>
-			<param name="maxmismatches" value="2" />
-			<param name="minlength" value="15" />
-			<param name="clip_source_list" value="user" />
-			<param name="clip_sequence" value="CAATTGGTTAATCCCCCTATATA" />
-			<param name="keepdelta" value="0" />
-			<param name="KEEP_N" value="+-n" />
-			<param name="DISCARD_OPTIONS" value="+-c" />
-			<output name="output" file="fastx_clipper1a.out" />
-		</test>
-	</tests>
-  <outputs>
-    <data format="input" name="output" metadata_source="input" />
-  </outputs>
-  
-<help>
+        <param name="DISCARD_OPTIONS" type="select" label="Output options">
+            <option value="-c">Output only clipped sequences (i.e. sequences which contained the adapter)</option>
+            <option value="-C">Output only non-clipped sequences (i.e. sequences which did not contained the adapter)</option>
+            <option value="">Output both clipped and non-clipped sequences</option>
+        </param>
+    </inputs>
+    <outputs>
+        <data format_source="input" name="output" metadata_source="input" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="fastx_clipper1.fastq" ftype="fastqsolexa"/>
+            <param name="maxmismatches" value="2" />
+            <param name="minlength" value="15" />
+            <param name="clip_source_list" value="user" />
+            <param name="clip_sequence" value="CAATTGGTTAATCCCCCTATATA" />
+            <param name="keepdelta" value="0" />
+            <param name="KEEP_N" value="-n" />
+            <param name="DISCARD_OPTIONS" value="-c" />
+            <output name="output" ftype="fastqsolexa" file="fastx_clipper1a.out" />
+        </test>
+    </tests>
+    <help>
 **What it does**
 
 This tool clips adapters from the 3'-end of the sequences in a FASTA/FASTQ file.
@@ -84,34 +81,21 @@
 
 **Clipping Illustration:**
 
-.. image:: fastx_clipper_illustration.png 
- 
- 
- 
- 
- 
- 
- 
+.. image:: fastx_clipper_illustration.png
 
 **Clipping Example:**
 
-.. image:: fastx_clipper_example.png 
+.. image:: fastx_clipper_example.png
 
-
-    
 **In the above example:**
 
 * Sequence no. 1 was discarded since it wasn't clipped (i.e. didn't contain the adapter sequence). (**Output** parameter).
 * Sequence no. 5 was discarded --- it's length (after clipping) was shorter than 15 nt (**Minimum Sequence Length** parameter).
 
-
-
-
 ------
 
 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
 
  .. __: http://hannonlab.cshl.edu/fastx_toolkit/
- 
-</help>
+    </help>
 </tool>
diff -r 8192b4014977 -r bdf1ce174e39 test-data/fastx_clipper1a.out
--- a/test-data/fastx_clipper1a.out	Tue Jun 03 14:54:53 2014 -0400
+++ b/test-data/fastx_clipper1a.out	Wed Nov 11 12:38:51 2015 -0500
@@ -2,18 +2,6 @@
 GTACGCATGACCGAACCCCCCNCCCCC
 +CSHL_3_FC042AGLLWW:1:2:7:203
 aab^V^aU]`aa^aZaaabbXEZabaa
-@CSHL_3_FC042AGLLWW:1:2:7:169
-GCAGCAGGCGCGTCAGAGAGCCCCCCCCCCCCCCC
-+CSHL_3_FC042AGLLWW:1:2:7:169
-a_M^a\Uaaa_M_aaaaaaaaaaaaaaaV\ZUGUU
-@CSHL_3_FC042AGLLWW:1:2:7:1819
-AATTCAAACCACCCCAACCCACACACAGAGATA
-+CSHL_3_FC042AGLLWW:1:2:7:1819
-a\\QVVVLaaLOEXUWUUEKUULEMUEUUKULI
-@CSHL_3_FC042AGLLWW:1:2:7:1875
-GCAAAAGAGTAGTGTACCCCCCCCCCCCCCCCCCC
-+CSHL_3_FC042AGLLWW:1:2:7:1875
-aaaaaaaaaXUXXEXaaaaa`_ZaaaaaaaaaXEX
 @CSHL_3_FC042AGLLWW:1:2:8:250
 TGCCGCGCACACTGATG
 +CSHL_3_FC042AGLLWW:1:2:8:250
diff -r 8192b4014977 -r bdf1ce174e39 tool_dependencies.xml
--- a/tool_dependencies.xml	Tue Jun 03 14:54:53 2014 -0400
+++ b/tool_dependencies.xml	Wed Nov 11 12:38:51 2015 -0500
@@ -1,6 +1,6 @@
 <?xml version="1.0"?>
 <tool_dependency>
     <package name="fastx_toolkit" version="0.0.13">
-        <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" />
+        <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" />
     </package>
 </tool_dependency>