view fastx_renamer.xml @ 1:02f8a17a4ebd draft

planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7

<tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" >
    <description></description>
    <requirements>
        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
    </requirements>
    <command>
<![CDATA[
zcat -f < '$input' | fastx_renamer -n $TYPE -o '$output' -v
#if $input.ext == "fastqsanger":
    -Q 33
#end if
]]>
    </command>

    <inputs>
        <param format="fastqsolexa,fasta,fastqsanger" name="input" type="data" label="FASTQ/A Library to rename" />

        <param name="TYPE" type="select" label="Rename sequence identifiers to">
            <option value="SEQ">Nucleotides sequence</option>
            <option value="COUNT">Numeric Counter</option>
        </param>
    </inputs>

    <outputs>
        <data format_source="input" name="output" metadata_source="input" />
    </outputs>
    <tests>
    </tests>
    <help>
**What it does**

This tool renames the sequence identifiers in a FASTQ/A file.

.. class:: infomark

Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc).

--------

**Example**

The following Solexa-FASTQ file::

    @CSHL_4_FC042GAMMII_2_1_517_596
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    +CSHL_4_FC042GAMMII_2_1_517_596
    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40

Renamed to **nucleotides sequence**::

    @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40

Renamed to **numeric counter**::

    @1
    GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
    +1
    40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40

------

This tool is based on `FASTX-toolkit`__ by Assaf Gordon.

 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
    </help>
<!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon ([e-mail]) -->
</tool>