# HG changeset patch
# User devteam
# Date 1447263586 18000
# Node ID 02f8a17a4ebd4257a6513c9cd8c22b7d3ebc5b95
# Parent  d7bce63e6e090b0bbd131643a9f2fa897502fd92
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7

diff -r d7bce63e6e09 -r 02f8a17a4ebd fastx_renamer.xml
--- a/fastx_renamer.xml	Wed Sep 25 11:19:14 2013 -0400
+++ b/fastx_renamer.xml	Wed Nov 11 12:39:46 2015 -0500
@@ -1,29 +1,32 @@
 <tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" >
-	<description></description>
+    <description></description>
     <requirements>
         <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
     </requirements>
-	<command>zcat -f $input | fastx_renamer -n $TYPE -o $output -v 
+    <command>
+<![CDATA[
+zcat -f < '$input' | fastx_renamer -n $TYPE -o '$output' -v
 #if $input.ext == "fastqsanger":
--Q 33
+    -Q 33
 #end if
-	</command>
+]]>
+    </command>
 
-	<inputs>
-		<param format="fastqsolexa,fasta,fastqsanger" name="input" type="data" label="FASTQ/A Library to rename" />
+    <inputs>
+        <param format="fastqsolexa,fasta,fastqsanger" name="input" type="data" label="FASTQ/A Library to rename" />
 
-		<param name="TYPE" type="select" label="Rename sequence identifiers to">
-			<option value="SEQ">Nucleotides sequence</option>
-			<option value="COUNT">Numeric Counter</option>
-		</param>
-	</inputs>
+        <param name="TYPE" type="select" label="Rename sequence identifiers to">
+            <option value="SEQ">Nucleotides sequence</option>
+            <option value="COUNT">Numeric Counter</option>
+        </param>
+    </inputs>
 
-	<outputs>
-		<data format="input" name="output" metadata_source="input" />
-	</outputs>
-
-<help>
-
+    <outputs>
+        <data format_source="input" name="output" metadata_source="input" />
+    </outputs>
+    <tests>
+    </tests>
+    <help>
 **What it does**
 
 This tool renames the sequence identifiers in a FASTQ/A file.
@@ -42,7 +45,7 @@
     GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
     +CSHL_4_FC042GAMMII_2_1_517_596
     40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
-  
+
 Renamed to **nucleotides sequence**::
 
     @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
@@ -61,7 +64,7 @@
 
 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
 
- .. __: http://hannonlab.cshl.edu/fastx_toolkit/   
-</help>
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+    </help>
 <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
 </tool>
diff -r d7bce63e6e09 -r 02f8a17a4ebd tool_dependencies.xml
--- a/tool_dependencies.xml	Wed Sep 25 11:19:14 2013 -0400
+++ b/tool_dependencies.xml	Wed Nov 11 12:39:46 2015 -0500
@@ -1,6 +1,6 @@
 <?xml version="1.0"?>
 <tool_dependency>
     <package name="fastx_toolkit" version="0.0.13">
-        <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" />
+        <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" />
     </package>
 </tool_dependency>