# HG changeset patch
# User devteam
# Date 1380122354 14400
# Node ID d7bce63e6e090b0bbd131643a9f2fa897502fd92
Uploaded tool tarball.
diff -r 000000000000 -r d7bce63e6e09 fastx_renamer.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/fastx_renamer.xml Wed Sep 25 11:19:14 2013 -0400
@@ -0,0 +1,67 @@
+
+
+
+ fastx_toolkit
+
+ zcat -f $input | fastx_renamer -n $TYPE -o $output -v
+#if $input.ext == "fastqsanger":
+-Q 33
+#end if
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+This tool renames the sequence identifiers in a FASTQ/A file.
+
+.. class:: infomark
+
+Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc).
+
+--------
+
+**Example**
+
+The following Solexa-FASTQ file::
+
+ @CSHL_4_FC042GAMMII_2_1_517_596
+ GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+ +CSHL_4_FC042GAMMII_2_1_517_596
+ 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
+
+Renamed to **nucleotides sequence**::
+
+ @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+ GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+ +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+ 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
+
+Renamed to **numeric counter**::
+
+ @1
+ GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+ +1
+ 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
+
+------
+
+This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
+
+ .. __: http://hannonlab.cshl.edu/fastx_toolkit/
+
+
+
diff -r 000000000000 -r d7bce63e6e09 tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Wed Sep 25 11:19:14 2013 -0400
@@ -0,0 +1,6 @@
+
+
+
+
+
+