annotate fastx_trimmer.xml @ 6:61b4cedc8934 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
author iuc
date Thu, 30 Jan 2020 13:31:32 -0500
parents 547e8d00f11c
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
6
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
1 <tool id="cshl_fastx_trimmer" version="1.0.2+galaxy0" name="Trim sequences">
2
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
2 <description></description>
3
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
3 <macros>
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
4 <import>macros.xml</import>
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
5 </macros>
6
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
6 <expand macro="requirements">
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
7 <requirement type="package" version="1.0.8">bzip2</requirement>
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
8 </expand>
3
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
9 <command detect_errors="exit_code"><![CDATA[
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
10 @CATS@ fastx_trimmer -v
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
11 -f $first
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
12 -l $last
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
13 @FQQUAL@
5
547e8d00f11c planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 3953b65f6b1c0336e9cadbe0792a5d3b14b5643a
iuc
parents: 4
diff changeset
14 @GZIP@
6
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
15 > '$output'
3
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
16 ]]></command>
2
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
17 <inputs>
3
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
18 <expand macro="fastx_input" />
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
19 <param name="first" type="integer" value="1" label="First base to keep" />
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
20 <param name="last" type="integer" value="21" label="Last base to keep" />
2
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
21 </inputs>
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
22 <outputs>
3
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
23 <data name="output" format_source="input" metadata_source="input" />
2
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
24 </outputs>
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
25 <tests>
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
26 <test>
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
27 <!-- Trim a FASTA file - remove first four bases (e.g. a barcode) -->
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
28 <param name="input" value="fastx_trimmer1.fasta" />
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
29 <param name="first" value="5"/>
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
30 <param name="last" value="36"/>
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
31 <output name="output" ftype="fasta" file="fastx_trimmer1.out" />
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
32 </test>
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
33 <test>
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
34 <!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) -->
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
35 <param name="input" value="fastx_trimmer2.fastq" ftype="fastqsolexa"/>
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
36 <param name="first" value="1"/>
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
37 <param name="last" value="27"/>
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
38 <output name="output" ftype="fastqsolexa" file="fastx_trimmer2.out" />
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
39 </test>
4
b98f3fa516a3 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit f3f313cb59922b945ac9587ff718b231d0f8db5c
iuc
parents: 3
diff changeset
40 <test>
6
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
41 <!-- Trim a FASTQ.gz file and output FASTQ.gz -->
4
b98f3fa516a3 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit f3f313cb59922b945ac9587ff718b231d0f8db5c
iuc
parents: 3
diff changeset
42 <param name="input" value="fastx_trimmer2.fastq.gz" ftype="fastqsanger.gz"/>
b98f3fa516a3 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit f3f313cb59922b945ac9587ff718b231d0f8db5c
iuc
parents: 3
diff changeset
43 <param name="first" value="1"/>
b98f3fa516a3 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit f3f313cb59922b945ac9587ff718b231d0f8db5c
iuc
parents: 3
diff changeset
44 <param name="last" value="27"/>
b98f3fa516a3 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit f3f313cb59922b945ac9587ff718b231d0f8db5c
iuc
parents: 3
diff changeset
45 <output name="output" ftype="fastqsanger.gz" decompress="true" file="fastx_trimmer2.out.gz" />
b98f3fa516a3 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit f3f313cb59922b945ac9587ff718b231d0f8db5c
iuc
parents: 3
diff changeset
46 </test>
6
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
47 <test>
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
48 <!-- Trim a FASTQ.bz2 file and output FASTQ.bz2 -->
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
49 <param name="input" value="fastx_trimmer2.fastq.bz2" ftype="fastqsanger.bz2"/>
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
50 <param name="first" value="1"/>
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
51 <param name="last" value="27"/>
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
52 <output name="output" ftype="fastqsanger.bz2" decompress="true" file="fastx_trimmer2.out.bz2" />
61b4cedc8934 "planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit 4c002e52261da2e7609735883d91fa1610ce6ce7"
iuc
parents: 5
diff changeset
53 </test>
2
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
54 </tests>
3
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
55 <help><![CDATA[
0
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
56 **What it does**
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
57
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
58 This tool trims (cut bases from) sequences in a FASTA/Q file.
2
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
59
0
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
60 --------
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
61
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
62 **Example**
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
63
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
64 Input Fasta file (with 36 bases in each sequences)::
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
65
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
66 >1-1
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
67 TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
68 >2-1
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
69 CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA
2
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
70
0
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
71 Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base)::
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
72
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
73 >1-1
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
74 TATGGTCAGAAACCATATGCA
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
75 >2-1
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
76 CAGCGAGGCTTTAATGCCATT
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
77
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
78 Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences::
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
79
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
80 >1-1
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
81 TCAGA
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
82 >2-1
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
83 AGGCT
2
377ac2829eac planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7
devteam
parents: 1
diff changeset
84
0
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
85 ------
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
86
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
87 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
88
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
89 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
3
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
90 ]]></help>
bbb007a39ac2 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1
iuc
parents: 2
diff changeset
91 <expand macro="citations" />
0
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
92 <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) -->
9cb372481a71 Uploaded tool tarball.
devteam
parents:
diff changeset
93 </tool>