view fastx_trimmer.xml @ 2:377ac2829eac draft

planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit a1517c9d22029095120643bbe2c8fa53754dd2b7

<tool id="cshl_fastx_trimmer" version="1.0.0" name="Trim sequences">
    <description></description>
    <requirements>
        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
    </requirements>
    <command>
<![CDATA[
zcat -f < '$input' | fastx_trimmer -v -f $first -l $last -o '$output'
#if $input.ext == "fastqsanger":
    -Q 33
#end if
]]>
    </command>

    <inputs>
        <param format="fasta,fastqsolexa,fastqsanger" name="input" type="data" label="Library to clip" />

        <param name="first" type="integer" value="1">
            <label>First base to keep</label>
        </param>

        <param name="last" type="integer" value="21">
            <label>Last base to keep</label>
        </param>
    </inputs>
    <outputs>
        <data format_source="input" name="output" metadata_source="input" />
    </outputs>
    <tests>
        <test>
            <!-- Trim a FASTA file - remove first four bases (e.g. a barcode) -->
            <param name="input" value="fastx_trimmer1.fasta" />
            <param name="first" value="5"/>
            <param name="last" value="36"/>
            <output name="output" ftype="fasta" file="fastx_trimmer1.out" />
        </test>
        <test>
            <!-- Trim a FASTQ file - remove last 9 bases (e.g. keep only miRNA length sequences) -->
            <param name="input" value="fastx_trimmer2.fastq" ftype="fastqsolexa"/>
            <param name="first" value="1"/>
            <param name="last" value="27"/>
            <output name="output" ftype="fastqsolexa" file="fastx_trimmer2.out" />
        </test>
    </tests>
    <help>
**What it does**

This tool trims (cut bases from) sequences in a FASTA/Q file.

--------

**Example**

Input Fasta file (with 36 bases in each sequences)::

    >1-1
    TATGGTCAGAAACCATATGCAGAGCCTGTAGGCACC
    >2-1
    CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA


Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base)::

    >1-1
    TATGGTCAGAAACCATATGCA
    >2-1
    CAGCGAGGCTTTAATGCCATT

Trimming with First=6 and Last=10, will generate a FASTA file with 5 bases (bases 6,7,8,9,10) in each sequences::

    >1-1
    TCAGA
    >2-1
    AGGCT

    ------

This tool is based on `FASTX-toolkit`__ by Assaf Gordon.

 .. __: http://hannonlab.cshl.edu/fastx_toolkit/
    </help>
<!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon ([e-mail]) -->
</tool>