changeset 3:bbb007a39ac2 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_trimmer commit bbb2e6b6769b03602a8ab97001f88fbec52080a1

--- a/fastx_trimmer.xml	Wed Nov 11 12:40:14 2015 -0500
+++ b/fastx_trimmer.xml	Tue May 08 13:28:34 2018 -0400
@@ -1,30 +1,23 @@
-<tool id="cshl_fastx_trimmer" version="1.0.0" name="Trim sequences">
+<tool id="cshl_fastx_trimmer" version="1.0.1" name="Trim sequences">
     <description></description>
-    <requirements>
-        <requirement type="package" version="0.0.13">fastx_toolkit</requirement>
-    </requirements>
-    <command>
-<![CDATA[
-zcat -f < '$input' | fastx_trimmer -v -f $first -l $last -o '$output'
-#if $input.ext == "fastqsanger":
-    -Q 33
-#end if
-]]>
-    </command>
-
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <command detect_errors="exit_code"><![CDATA[
+@CATS@ fastx_trimmer -v
+-f $first
+-l $last
+-o '$output'
+@FQQUAL@
+    ]]></command>
     <inputs>
-        <param format="fasta,fastqsolexa,fastqsanger" name="input" type="data" label="Library to clip" />
-
-        <param name="first" type="integer" value="1">
-            <label>First base to keep</label>
-        </param>
-
-        <param name="last" type="integer" value="21">
-            <label>Last base to keep</label>
-        </param>
+        <expand macro="fastx_input" />
+        <param name="first" type="integer" value="1" label="First base to keep" />
+        <param name="last" type="integer" value="21" label="Last base to keep" />
     </inputs>
     <outputs>
-        <data format_source="input" name="output" metadata_source="input" />
+        <data name="output" format_source="input" metadata_source="input" />
     </outputs>
     <tests>
         <test>
@@ -42,7 +35,7 @@
             <output name="output" ftype="fastqsolexa" file="fastx_trimmer2.out" />
         </test>
     </tests>
-    <help>
+    <help><![CDATA[
 **What it does**
 
 This tool trims (cut bases from) sequences in a FASTA/Q file.
@@ -58,7 +51,6 @@
     >2-1
     CAGCGAGGCTTTAATGCCATTTGGCTGTAGGCACCA
 
-
 Trimming with First=1 and Last=21, we get a FASTA file with 21 bases in each sequences (starting from the first base)::
 
     >1-1
@@ -78,6 +70,7 @@
 This tool is based on `FASTX-toolkit`__ by Assaf Gordon.
 
  .. __: http://hannonlab.cshl.edu/fastx_toolkit/
-    </help>
+    ]]></help>
+    <expand macro="citations" />
 <!-- FASTX-Trimmer is part of the FASTX-toolkit, by A.Gordon ([e-mail]) -->
 </tool>

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Tue May 08 13:28:34 2018 -0400
@@ -0,0 +1,54 @@
+<?xml version="1.0"?>
+<macros>
+    <token name="@CATS@">
+        #if $input.is_of_type('fasta.gz', 'fastqsanger.gz', 'fastqsolexa.gz', 'fastqillumina.gz'):
+            zcat -f '$input' |
+        #elif $input.is_of_type('fastqsanger.bz2', 'fastqsolexa.bz2', 'fastqillumina.bz2'):
+            bzcat -f '$input' |
+        #else:
+            cat '$input' |
+        #end if
+    </token>
+    <token name="@FQQUAL@">
+        <![CDATA[
+            #if $input.is_of_type('fastqsanger', 'fastqsanger.gz', 'fastqsanger.bz2'):
+                -Q 33
+            #elif $input.is_of_type('fastqsolexa', 'fastqsolexa.gz', 'fastqsolexa.bz2', 'fastqillumina', 'fastqillumina.gz', 'fastqillumina.bz2'):
+                -Q 64
+            #end if
+        ]]>
+    </token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@VERSION@">fastx_toolkit</requirement>
+            <yield />
+        </requirements>
+    </xml>
+    <token name="@VERSION@">0.0.14</token>
+    <token name="@SANGER@">fastqsanger,fastqsanger.gz,fastqsanger.bz2</token>
+    <token name="@SOLEXA@">fastqsolexa,fastqsolexa.gz,fastqsolexa.bz2</token>
+    <token name="@ILLUMINA@">fastqillumina,fastqillumina.gz,fastqillumina.bz2</token>
+    <token name="@FASTQS@">@SANGER@,@SOLEXA@,@ILLUMINA@</token>
+    <token name="@FASTAS@">fasta,fasta.gz</token>
+    <xml name="citations">
+        <citations>
+            <citation type="bibtex">
+                @UNPUBLISHED{agordon,
+                    author = "Assaf Gordon",
+                    title = "FASTQ/A short-reads pre-processing tools",
+                    year = "2010",
+                    note = "http://hannonlab.cshl.edu/fastx_toolkit/",
+                    url = "http://hannonlab.cshl.edu/fastx_toolkit/"}
+            </citation>
+        </citations>
+    </xml>
+    <xml name="fasta_input">
+        <param name="input" type="data" format="@FASTAS@" label="Input FASTA file" />
+    </xml>
+    <xml name="fastq_input">
+        <param name="input" type="data" format="@FASTQS@" label="Input FASTQ file" />
+    </xml>
+    <xml name="fastx_input">
+        <param name="input" type="data" format="@FASTAS@,@FASTQS@" label="Input file in FASTA or FASTQ format" />
+    </xml>
+</macros>

--- a/tool_dependencies.xml	Wed Nov 11 12:40:14 2015 -0500
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,6 +0,0 @@
-<?xml version="1.0"?>
-<tool_dependency>
-    <package name="fastx_toolkit" version="0.0.13">
-        <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" />
-    </package>
-</tool_dependency>