diff megablast_xml_parser.xml @ 0:03ca082aeb2e draft

Imported from capsule None
author devteam
date Mon, 19 May 2014 12:33:19 -0400
parents
children fbff957a3655
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/megablast_xml_parser.xml	Mon May 19 12:33:19 2014 -0400
@@ -0,0 +1,60 @@
+<tool id="megablast_xml_parser" name="Parse blast XML output" version="1.0.0">
+<description></description>
+<command interpreter="python">megablast_xml_parser.py $input1 $output1</command>
+<inputs>
+  <param name="input1" type="data" format="blastxml" label="Megablast XML output" />
+</inputs>
+<outputs>
+  <data name="output1" format="tabular"/>
+</outputs>
+<tests>
+  <test>
+    <param name="input1" value="megablast_xml_parser_test1.gz" ftype="blastxml" />
+    <output name="output1" file="megablast_xml_parser_test1_out.tabular" ftype="tabular" />
+  </test>
+</tests>
+<help>
+
+**What it does**
+
+This tool processes the XML output of any NCBI blast tool (if you run your own blast jobs, the XML output can be generated with **-m 7** option).
+
+-----
+
+**Output fields**
+
+This tools returns tab-delimited output with the following fields::
+
+    Description                               Example
+    ----------------------------------------- ----------------- 
+
+    1. Name of the query sequence             Seq1
+    2. Length of the query sequence           30
+    3. Name of target sequence                gnl|BL_ORD_ID|0
+    4. Length of target sequence              5528445
+    5. Alignment bit score                    59.96
+    6. E-value                                8.38112e-11
+    7. Start of alignment within query        1
+    8. End of alignment within query          30
+    9. Start of alignment within target       5436010
+   10. End of alignment within target         5436039
+   11. Query frame                            1
+   12. Target frame                           1
+   13. Number of identical bases within       29 
+       the alignment
+   14. Alignment length                       30 
+   15. Aligned portion (sequence) of query    CGGACAGCGCCGCCACCAACAAAGCCACCA
+   16. Aligned portion (sequence) of target   CGGACAGCGCCGCCACCAACAAAGCCATCA
+   17. Midline indicating positions of        ||||||||||||||||||||||||||| || 
+       matches within the alignment
+
+------
+       
+.. class:: infomark
+
+Note that this form of output does not contain alignment identify value. However, it can be computed by dividing the number of identical bases within the alignment (Field 13) by the alignment length (Field 14) using *Text Manipulation->Compute* tool 
+
+
+
+</help>
+</tool>