# HG changeset patch
# User devteam
# Date 1396363718 14400
# Node ID e768f485164676f2f00f8bb1a4788c8e6481d1d3
Imported from capsule None
diff -r 000000000000 -r e768f4851646 gatk_macros.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/gatk_macros.xml Tue Apr 01 10:48:38 2014 -0400
@@ -0,0 +1,305 @@
+
+
+ ##start standard gatk options
+ #if $gatk_param_type.gatk_param_type_selector == "advanced":
+ #for $pedigree in $gatk_param_type.pedigree:
+ -p '--pedigree "${pedigree.pedigree_file}"'
+ #end for
+ #for $pedigree_string in $gatk_param_type.pedigree_string_repeat:
+ -p '--pedigreeString "${pedigree_string.pedigree_string}"'
+ #end for
+ -p '--pedigreeValidationType "${gatk_param_type.pedigree_validation_type}"'
+ #for $read_filter in $gatk_param_type.read_filter:
+ -p '--read_filter "${read_filter.read_filter_type.read_filter_type_selector}"
+ ###raise Exception( str( dir( $read_filter ) ) )
+ #for $name, $param in $read_filter.read_filter_type.iteritems():
+ #if $name not in [ "__current_case__", "read_filter_type_selector" ]:
+ #if hasattr( $param.input, 'truevalue' ):
+ ${param}
+ #else:
+ --${name} "${param}"
+ #end if
+ #end if
+ #end for
+ '
+ #end for
+ #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_interval_repeat ):
+ -d "--intervals" "${input_intervals.input_intervals}" "${input_intervals.input_intervals.ext}" "input_intervals_${interval_count}"
+ #end for
+
+ #for $interval_count, $input_intervals in enumerate( $gatk_param_type.input_exclude_interval_repeat ):
+ -d "--excludeIntervals" "${input_intervals.input_exclude_intervals}" "${input_intervals.input_exclude_intervals.ext}" "input_exlude_intervals_${interval_count}"
+ #end for
+
+ -p '--interval_set_rule "${gatk_param_type.interval_set_rule}"'
+
+ -p '--downsampling_type "${gatk_param_type.downsampling_type.downsampling_type_selector}"'
+ #if str( $gatk_param_type.downsampling_type.downsampling_type_selector ) != "NONE":
+ -p '--${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_type_selector} "${gatk_param_type.downsampling_type.downsample_to_type.downsample_to_value}"'
+ #end if
+ -p '
+ --baq "${gatk_param_type.baq}"
+ --baqGapOpenPenalty "${gatk_param_type.baq_gap_open_penalty}"
+ ${gatk_param_type.use_original_qualities}
+ --defaultBaseQualities "${gatk_param_type.default_base_qualities}"
+ --validation_strictness "${gatk_param_type.validation_strictness}"
+ --interval_merging "${gatk_param_type.interval_merging}"
+ ${gatk_param_type.disable_experimental_low_memory_sharding}
+ ${gatk_param_type.non_deterministic_random_seed}
+ '
+ #for $rg_black_list_count, $rg_black_list in enumerate( $gatk_param_type.read_group_black_list_repeat ):
+ #if $rg_black_list.read_group_black_list_type.read_group_black_list_type_selector == "file":
+ -d "--read_group_black_list" "${rg_black_list.read_group_black_list_type.read_group_black_list}" "txt" "input_read_group_black_list_${rg_black_list_count}"
+ #else
+ -p '--read_group_black_list "${rg_black_list.read_group_black_list_type.read_group_black_list}"'
+ #end if
+ #end for
+ #end if
+
+ #if str( $reference_source.reference_source_selector ) == "history":
+ -d "-R" "${reference_source.ref_file}" "${reference_source.ref_file.ext}" "gatk_input"
+ #end if
+ ##end standard gatk options
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+ ------
+
+**Citation**
+
+For the underlying tool, please cite `DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, McKenna A, Fennell TJ, Kernytsky AM, Sivachenko AY, Cibulskis K, Gabriel SB, Altshuler D, Daly MJ. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 2011 May;43(5):491-8. <http://www.ncbi.nlm.nih.gov/pubmed/21478889>`_
+
+If you use this tool in Galaxy, please cite Blankenberg D, et al. *In preparation.*
+
+
+
\ No newline at end of file
diff -r 000000000000 -r e768f4851646 gatk_wrapper.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/gatk_wrapper.py Tue Apr 01 10:48:38 2014 -0400
@@ -0,0 +1,126 @@
+#!/usr/bin/env python
+#Dan Blankenberg
+
+"""
+A wrapper script for running the GenomeAnalysisTK.jar commands.
+"""
+
+import sys, optparse, os, tempfile, subprocess, shutil
+from binascii import unhexlify
+from string import Template
+
+GALAXY_EXT_TO_GATK_EXT = { 'gatk_interval':'intervals', 'bam_index':'bam.bai', 'gatk_dbsnp':'dbSNP', 'picard_interval_list':'interval_list' } #items not listed here will use the galaxy extension as-is
+GALAXY_EXT_TO_GATK_FILE_TYPE = GALAXY_EXT_TO_GATK_EXT #for now, these are the same, but could be different if needed
+DEFAULT_GATK_PREFIX = "gatk_file"
+CHUNK_SIZE = 2**20 #1mb
+
+
+def cleanup_before_exit( tmp_dir ):
+ if tmp_dir and os.path.exists( tmp_dir ):
+ shutil.rmtree( tmp_dir )
+
+def gatk_filename_from_galaxy( galaxy_filename, galaxy_ext, target_dir = None, prefix = None ):
+ suffix = GALAXY_EXT_TO_GATK_EXT.get( galaxy_ext, galaxy_ext )
+ if prefix is None:
+ prefix = DEFAULT_GATK_PREFIX
+ if target_dir is None:
+ target_dir = os.getcwd()
+ gatk_filename = os.path.join( target_dir, "%s.%s" % ( prefix, suffix ) )
+ os.symlink( galaxy_filename, gatk_filename )
+ return gatk_filename
+
+def gatk_filetype_argument_substitution( argument, galaxy_ext ):
+ return argument % dict( file_type = GALAXY_EXT_TO_GATK_FILE_TYPE.get( galaxy_ext, galaxy_ext ) )
+
+def open_file_from_option( filename, mode = 'rb' ):
+ if filename:
+ return open( filename, mode = mode )
+ return None
+
+def html_report_from_directory( html_out, dir ):
+ html_out.write( '\n\nGalaxy - GATK Output\n\n\n\n\n' )
+ for fname in sorted( os.listdir( dir ) ):
+ html_out.write( '- %s
\n' % ( fname, fname ) )
+ html_out.write( '
\n\n\n' )
+
+def index_bam_files( bam_filenames, tmp_dir ):
+ for bam_filename in bam_filenames:
+ bam_index_filename = "%s.bai" % bam_filename
+ if not os.path.exists( bam_index_filename ):
+ #need to index this bam file
+ stderr_name = tempfile.NamedTemporaryFile( prefix = "bam_index_stderr" ).name
+ command = 'samtools index %s %s' % ( bam_filename, bam_index_filename )
+ proc = subprocess.Popen( args=command, shell=True, stderr=open( stderr_name, 'wb' ) )
+ return_code = proc.wait()
+ if return_code:
+ for line in open( stderr_name ):
+ print >> sys.stderr, line
+ os.unlink( stderr_name ) #clean up
+ cleanup_before_exit( tmp_dir )
+ raise Exception( "Error indexing BAM file" )
+ os.unlink( stderr_name ) #clean up
+
+def __main__():
+ #Parse Command Line
+ parser = optparse.OptionParser()
+ parser.add_option( '-p', '--pass_through', dest='pass_through_options', action='append', type="string", help='These options are passed through directly to GATK, without any modification.' )
+ parser.add_option( '-o', '--pass_through_options', dest='pass_through_options_encoded', action='append', type="string", help='These options are passed through directly to GATK, with decoding from binascii.unhexlify.' )
+ parser.add_option( '-d', '--dataset', dest='datasets', action='append', type="string", nargs=4, help='"-argument" "original_filename" "galaxy_filetype" "name_prefix"' )
+ parser.add_option( '', '--max_jvm_heap', dest='max_jvm_heap', action='store', type="string", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value.' )
+ parser.add_option( '', '--max_jvm_heap_fraction', dest='max_jvm_heap_fraction', action='store', type="int", default=None, help='If specified, the maximum java virtual machine heap size will be set to the provide value as a fraction of total physical memory.' )
+ parser.add_option( '', '--stdout', dest='stdout', action='store', type="string", default=None, help='If specified, the output of stdout will be written to this file.' )
+ parser.add_option( '', '--stderr', dest='stderr', action='store', type="string", default=None, help='If specified, the output of stderr will be written to this file.' )
+ parser.add_option( '', '--html_report_from_directory', dest='html_report_from_directory', action='append', type="string", nargs=2, help='"Target HTML File" "Directory"')
+ (options, args) = parser.parse_args()
+
+ tmp_dir = tempfile.mkdtemp( prefix='tmp-gatk-' )
+ if options.pass_through_options:
+ cmd = ' '.join( options.pass_through_options )
+ else:
+ cmd = ''
+ if options.pass_through_options_encoded:
+ cmd = '%s %s' % ( cmd, ' '.join( map( unhexlify, options.pass_through_options_encoded ) ) )
+ if options.max_jvm_heap is not None:
+ cmd = cmd.replace( 'java ', 'java -Xmx%s ' % ( options.max_jvm_heap ), 1 )
+ elif options.max_jvm_heap_fraction is not None:
+ cmd = cmd.replace( 'java ', 'java -XX:DefaultMaxRAMFraction=%s -XX:+UseParallelGC ' % ( options.max_jvm_heap_fraction ), 1 )
+ bam_filenames = []
+ if options.datasets:
+ for ( dataset_arg, filename, galaxy_ext, prefix ) in options.datasets:
+ gatk_filename = gatk_filename_from_galaxy( filename, galaxy_ext, target_dir = tmp_dir, prefix = prefix )
+ if dataset_arg:
+ cmd = '%s %s "%s"' % ( cmd, gatk_filetype_argument_substitution( dataset_arg, galaxy_ext ), gatk_filename )
+ if galaxy_ext == "bam":
+ bam_filenames.append( gatk_filename )
+ index_bam_files( bam_filenames, tmp_dir )
+ #set up stdout and stderr output options
+ stdout = open_file_from_option( options.stdout, mode = 'wb' )
+ stderr = open_file_from_option( options.stderr, mode = 'wb' )
+ #if no stderr file is specified, we'll use our own
+ if stderr is None:
+ stderr = tempfile.NamedTemporaryFile( prefix="gatk-stderr-", dir=tmp_dir )
+
+ proc = subprocess.Popen( args=cmd, stdout=stdout, stderr=stderr, shell=True, cwd=tmp_dir )
+ return_code = proc.wait()
+
+ if return_code:
+ stderr_target = sys.stderr
+ else:
+ stderr_target = sys.stdout
+ stderr.flush()
+ stderr.seek(0)
+ while True:
+ chunk = stderr.read( CHUNK_SIZE )
+ if chunk:
+ stderr_target.write( chunk )
+ else:
+ break
+ stderr.close()
+ #generate html reports
+ if options.html_report_from_directory:
+ for ( html_filename, html_dir ) in options.html_report_from_directory:
+ html_report_from_directory( open( html_filename, 'wb' ), html_dir )
+
+ cleanup_before_exit( tmp_dir )
+
+if __name__=="__main__": __main__()
diff -r 000000000000 -r e768f4851646 print_reads.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/print_reads.xml Tue Apr 01 10:48:38 2014 -0400
@@ -0,0 +1,150 @@
+
+ from BAM files
+
+ gatk
+ samtools
+
+
+ gatk_macros.xml
+
+ gatk_wrapper.py
+ --max_jvm_heap_fraction "1"
+ --stdout "${output_log}"
+ #for $i, $input_bam in enumerate( $reference_source.input_bams ):
+ -d "-I" "${input_bam.input_bam}" "${input_bam.input_bam.ext}" "gatk_input_${i}"
+ #if str( $input_bam.input_bam.metadata.bam_index ) != "None":
+ -d "" "${input_bam.input_bam.metadata.bam_index}" "bam_index" "gatk_input_${i}" ##hardcode galaxy ext type as bam_index
+ #end if
+ #end for
+ -p 'java
+ -jar "\$JAVA_JAR_PATH/GenomeAnalysisTK.jar"
+ -T "PrintReads"
+ ##--num_threads 4 ##hard coded, for now
+ --out "${output_bam}"
+ -et "NO_ET" ##ET no phone home
+ #if $reference_source.reference_source_selector != "history":
+ -R "${reference_source.ref_file.fields.path}"
+ #end if
+ --number "${number}"
+ #if $platform:
+ --platform "${platform}"
+ #end if
+ #if $read_group:
+ --readGroup "${read_group}"
+ #end if
+ #for $sample_file in $sample_file_repeat:
+ --sample_file "${sample_file.input_sample_file}"
+ #end for
+ #for $sample_name in $sample_name_repeat:
+ --sample_name "${sample_name.sample_name}"
+ #end for
+ '
+
+ #include source=$standard_gatk_options#
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+PrintReads can dynamically merge the contents of multiple input BAM files, resulting in merged output sorted in coordinate order.
+
+For more information on the GATK Print Reads Walker, see this `tool specific page <http://www.broadinstitute.org/gsa/gatkdocs/release/org_broadinstitute_sting_gatk_walkers_PrintReadsWalker.html>`_.
+
+To learn about best practices for variant detection using GATK, see this `overview <http://www.broadinstitute.org/gsa/wiki/index.php/Best_Practice_Variant_Detection_with_the_GATK_v3>`_.
+
+If you encounter errors, please view the `GATK FAQ <http://www.broadinstitute.org/gsa/wiki/index.php/Frequently_Asked_Questions>`_.
+
+------
+
+**Inputs**
+
+GenomeAnalysisTK: PrintReads accepts one or more BAM or SAM input files.
+
+
+**Outputs**
+
+The output is in BAM format.
+
+
+Go `here <http://www.broadinstitute.org/gsa/wiki/index.php/Input_files_for_the_GATK>`_ for details on GATK file formats.
+
+-------
+
+**Settings**::
+
+ number int -1 Print the first n reads from the file, discarding the rest
+ platform String NA Exclude all reads with this platform from the output
+ readGroup String NA Exclude all reads with this read group from the output
+ sample_file Set[File] [] File containing a list of samples (one per line). Can be specified multiple times
+ sample_name Set[String] [] Sample name to be included in the analysis. Can be specified multiple times.
+
+@CITATION_SECTION@
+
+
diff -r 000000000000 -r e768f4851646 test-data/1.bam
Binary file test-data/1.bam has changed
diff -r 000000000000 -r e768f4851646 test-data/a.tab
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/a.tab Tue Apr 01 10:48:38 2014 -0400
@@ -0,0 +1,15 @@
+CHR SNP BP A1 TEST NMISS BETA STAT P
+1 rs1181876 3671541 T DOMDEV 958 -1.415 -3.326 0.0009161
+1 rs10492923 5092886 C ADD 1007 5.105 4.368 1.382e-05
+1 rs10492923 5092886 C DOMDEV 1007 -5.612 -4.249 2.35e-05
+1 rs10492923 5092886 C GENO_2DF 1007 NA 19.9 4.775e-05
+1 rs1801133 11778965 T ADD 1022 1.23 3.97 7.682e-05
+1 rs1801133 11778965 T GENO_2DF 1022 NA 16.07 0.0003233
+1 rs1361912 12663121 A ADD 1021 12.69 4.093 4.596e-05
+1 rs1361912 12663121 A DOMDEV 1021 -12.37 -3.945 8.533e-05
+1 rs1361912 12663121 A GENO_2DF 1021 NA 17.05 0.0001982
+1 rs1009806 19373138 G ADD 1021 -1.334 -3.756 0.0001826
+1 rs1009806 19373138 G GENO_2DF 1021 NA 19.36 6.244e-05
+1 rs873654 29550948 A DOMDEV 1012 1.526 3.6 0.0003339
+1 rs10489527 36800027 C ADD 1016 12.67 4.114 4.211e-05
+1 rs10489527 36800027 C DOMDEV 1016 -13.05 -4.02 6.249e-05
diff -r 000000000000 -r e768f4851646 test-data/gatk/gatk_print_reads/gatk_print_reads_out_1.log.contains
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gatk/gatk_print_reads/gatk_print_reads_out_1.log.contains Tue Apr 01 10:48:38 2014 -0400
@@ -0,0 +1,5 @@
+SAMDataSource$SAMReaders - Initializing SAMRecords in serial
+TraversalEngine - [INITIALIZATION COMPLETE; TRAVERSAL STARTING]
+TraversalEngine - Location processed.reads runtime per.1M.reads completed total.runtime remaining
+Walker - [REDUCE RESULT] Traversal result is: org.broadinstitute.sting.gatk.io.stubs.SAMFileWriterStub
+TraversalEngine - 0 reads were filtered out during traversal out of 10 total (0.00%)
diff -r 000000000000 -r e768f4851646 test-data/gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam
Binary file test-data/gatk/gatk_table_recalibration/gatk_table_recalibration_out_1.bam has changed
diff -r 000000000000 -r e768f4851646 test-data/phiX.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/phiX.fasta Tue Apr 01 10:48:38 2014 -0400
@@ -0,0 +1,79 @@
+>phiX174
+GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT
+GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA
+ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG
+TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA
+GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC
+TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT
+TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT
+CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT
+TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG
+TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC
+GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA
+CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG
+TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT
+AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC
+CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA
+TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC
+TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA
+CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA
+GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT
+GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA
+ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC
+TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT
+TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC
+ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC
+CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT
+GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC
+CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC
+TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG
+TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT
+TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA
+AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT
+TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT
+ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC
+GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC
+TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT
+TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA
+TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG
+TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC
+CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG
+AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC
+CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT
+TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG
+CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA
+AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT
+GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG
+GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA
+TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT
+CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG
+TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA
+GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC
+CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA
+TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA
+AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC
+TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT
+CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA
+TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG
+TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT
+CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT
+TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC
+ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG
+TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA
+ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG
+GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC
+CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT
+GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG
+GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT
+ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG
+CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC
+CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC
+GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT
+CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG
+CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA
+TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT
+TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG
+TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC
+AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC
+TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA
+
diff -r 000000000000 -r e768f4851646 tool-data/gatk_sorted_picard_index.loc.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/gatk_sorted_picard_index.loc.sample Tue Apr 01 10:48:38 2014 -0400
@@ -0,0 +1,26 @@
+#This is a sample file distributed with Galaxy that enables tools
+#to use a directory of Picard dict and associated files. You will need
+#to create these data files and then create a picard_index.loc file
+#similar to this one (store it in this directory) that points to
+#the directories in which those files are stored. The picard_index.loc
+#file has this format (longer white space is the TAB character):
+#
+#
+#
+#So, for example, if you had hg18 indexed and stored in
+#/depot/data2/galaxy/srma/hg18/,
+#then the srma_index.loc entry would look like this:
+#
+#hg18 hg18 hg18 Pretty /depot/data2/galaxy/picard/hg18/hg18.fa
+#
+#and your /depot/data2/galaxy/srma/hg18/ directory
+#would contain the following three files:
+#hg18.fa
+#hg18.dict
+#hg18.fa.fai
+#
+#The dictionary file for each reference (ex. hg18.dict) must be
+#created via Picard (http://picard.sourceforge.net). Note that
+#the dict file does not have the .fa extension although the
+#path list in the loc file does include it.
+#
diff -r 000000000000 -r e768f4851646 tool_data_table_conf.xml.sample
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample Tue Apr 01 10:48:38 2014 -0400
@@ -0,0 +1,8 @@
+
+
+
+
+ value, dbkey, name, path
+
+
+
diff -r 000000000000 -r e768f4851646 tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Tue Apr 01 10:48:38 2014 -0400
@@ -0,0 +1,9 @@
+
+
+
+
+
+
+
+
+