# HG changeset patch # User devteam # Date 1390832863 18000 # Node ID b334cd1095ea8b4367ac0e3378e50cd546d47cca Imported from capsule None diff -r 000000000000 -r b334cd1095ea tabular_to_fastq.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tabular_to_fastq.py Mon Jan 27 09:27:43 2014 -0500 @@ -0,0 +1,29 @@ +#Dan Blankenberg +import sys + +def main(): + input_filename = sys.argv[1] + output_filename = sys.argv[2] + identifier_col = int( sys.argv[3] ) - 1 + sequence_col = int( sys.argv[4] ) - 1 + quality_col = int( sys.argv[5] ) - 1 + + max_col = max( identifier_col, sequence_col, quality_col ) + num_reads = None + fastq_read = None + skipped_lines = 0 + out = open( output_filename, 'wb' ) + for num_reads, line in enumerate( open( input_filename ) ): + fields = line.rstrip( '\n\r' ).split( '\t' ) + if len( fields ) > max_col: + out.write( "@%s\n%s\n+\n%s\n" % ( fields[identifier_col], fields[sequence_col], fields[quality_col] ) ) + else: + skipped_lines += 1 + + out.close() + if num_reads is None: + print "Input was empty." + else: + print "%i tabular lines were written as FASTQ reads. Be sure to use the FASTQ Groomer tool on this output before further analysis." % ( num_reads + 1 - skipped_lines ) + +if __name__ == "__main__": main() diff -r 000000000000 -r b334cd1095ea tabular_to_fastq.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tabular_to_fastq.xml Mon Jan 27 09:27:43 2014 -0500 @@ -0,0 +1,47 @@ + + converter + + galaxy_sequence_utils + + tabular_to_fastq.py '$input_file' '$output_file' '$identifier' '$sequence' '$quality' + + + + + + + + + + + + + + + + + + + + + + + + + + + + +**What it does** + +This tool attempts to convert a tabular file containing sequencing read data to a FASTQ formatted file. The FASTQ Groomer tool should always be used on the output of this tool. + +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_ + + + + diff -r 000000000000 -r b334cd1095ea test-data/fastq_to_tabular_out_1.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastq_to_tabular_out_1.tabular Mon Jan 27 09:27:43 2014 -0500 @@ -0,0 +1,2 @@ +FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ +FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA ~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! diff -r 000000000000 -r b334cd1095ea test-data/fastq_to_tabular_out_2.tabular --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastq_to_tabular_out_2.tabular Mon Jan 27 09:27:43 2014 -0500 @@ -0,0 +1,2 @@ +FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) G2131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131 !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ +FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) G3131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131 ~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! diff -r 000000000000 -r b334cd1095ea test-data/sanger_full_range_as_cssanger.fastqcssanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sanger_full_range_as_cssanger.fastqcssanger Mon Jan 27 09:27:43 2014 -0500 @@ -0,0 +1,8 @@ +@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) +G2131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131 ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ +@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) +G3131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131 ++ +~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! diff -r 000000000000 -r b334cd1095ea test-data/sanger_full_range_original_sanger.fastqsanger --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sanger_full_range_original_sanger.fastqsanger Mon Jan 27 09:27:43 2014 -0500 @@ -0,0 +1,8 @@ +@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) +ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC ++ +!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~ +@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) +CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA ++ +~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"! diff -r 000000000000 -r b334cd1095ea tool_dependencies.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_dependencies.xml Mon Jan 27 09:27:43 2014 -0500 @@ -0,0 +1,6 @@ + + + + + +