# HG changeset patch
# User devteam
# Date 1390832863 18000
# Node ID b334cd1095ea8b4367ac0e3378e50cd546d47cca
Imported from capsule None
diff -r 000000000000 -r b334cd1095ea tabular_to_fastq.py
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tabular_to_fastq.py Mon Jan 27 09:27:43 2014 -0500
@@ -0,0 +1,29 @@
+#Dan Blankenberg
+import sys
+
+def main():
+ input_filename = sys.argv[1]
+ output_filename = sys.argv[2]
+ identifier_col = int( sys.argv[3] ) - 1
+ sequence_col = int( sys.argv[4] ) - 1
+ quality_col = int( sys.argv[5] ) - 1
+
+ max_col = max( identifier_col, sequence_col, quality_col )
+ num_reads = None
+ fastq_read = None
+ skipped_lines = 0
+ out = open( output_filename, 'wb' )
+ for num_reads, line in enumerate( open( input_filename ) ):
+ fields = line.rstrip( '\n\r' ).split( '\t' )
+ if len( fields ) > max_col:
+ out.write( "@%s\n%s\n+\n%s\n" % ( fields[identifier_col], fields[sequence_col], fields[quality_col] ) )
+ else:
+ skipped_lines += 1
+
+ out.close()
+ if num_reads is None:
+ print "Input was empty."
+ else:
+ print "%i tabular lines were written as FASTQ reads. Be sure to use the FASTQ Groomer tool on this output before further analysis." % ( num_reads + 1 - skipped_lines )
+
+if __name__ == "__main__": main()
diff -r 000000000000 -r b334cd1095ea tabular_to_fastq.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tabular_to_fastq.xml Mon Jan 27 09:27:43 2014 -0500
@@ -0,0 +1,47 @@
+
+ converter
+
+ galaxy_sequence_utils
+
+ tabular_to_fastq.py '$input_file' '$output_file' '$identifier' '$sequence' '$quality'
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+**What it does**
+
+This tool attempts to convert a tabular file containing sequencing read data to a FASTQ formatted file. The FASTQ Groomer tool should always be used on the output of this tool.
+
+------
+
+**Citation**
+
+If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. <http://www.ncbi.nlm.nih.gov/pubmed/20562416>`_
+
+
+
+
diff -r 000000000000 -r b334cd1095ea test-data/fastq_to_tabular_out_1.tabular
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_to_tabular_out_1.tabular Mon Jan 27 09:27:43 2014 -0500
@@ -0,0 +1,2 @@
+FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA ~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
diff -r 000000000000 -r b334cd1095ea test-data/fastq_to_tabular_out_2.tabular
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fastq_to_tabular_out_2.tabular Mon Jan 27 09:27:43 2014 -0500
@@ -0,0 +1,2 @@
+FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order) G2131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131 !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order) G3131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131 ~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
diff -r 000000000000 -r b334cd1095ea test-data/sanger_full_range_as_cssanger.fastqcssanger
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sanger_full_range_as_cssanger.fastqcssanger Mon Jan 27 09:27:43 2014 -0500
@@ -0,0 +1,8 @@
+@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order)
+G2131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131
++
+!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order)
+G3131313131313131313131313131313131313131313131313131313131313131313131313131313131313131313131
++
+~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
diff -r 000000000000 -r b334cd1095ea test-data/sanger_full_range_original_sanger.fastqsanger
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sanger_full_range_original_sanger.fastqsanger Mon Jan 27 09:27:43 2014 -0500
@@ -0,0 +1,8 @@
+@FAKE0001 Original version has PHRED scores from 0 to 93 inclusive (in that order)
+ACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTACGTAC
++
+!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
+@FAKE0002 Original version has PHRED scores from 93 to 0 inclusive (in that order)
+CATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCA
++
+~}|{zyxwvutsrqponmlkjihgfedcba`_^]\[ZYXWVUTSRQPONMLKJIHGFEDCBA@?>=<;:9876543210/.-,+*)('&%$#"!
diff -r 000000000000 -r b334cd1095ea tool_dependencies.xml
--- /dev/null Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml Mon Jan 27 09:27:43 2014 -0500
@@ -0,0 +1,6 @@
+
+
+
+
+
+