Mercurial > repos > devteam > vcfprimers
view vcfprimers.xml @ 0:67a4da1a4df3 draft
Uploaded
author | devteam |
---|---|
date | Thu, 19 Mar 2015 14:43:10 -0400 |
parents | |
children | bc5949d36b34 |
line wrap: on
line source
<tool id="vcfprimers" name="VCFprimers:" version="0.0.3"> <description>Extract flanking sequences for each VCF record</description> <macros> <import>macros.xml</import> </macros> <expand macro="requirements"></expand> <expand macro="stdio"></expand> <command> #set $reference_fasta_filename = "localref.fa" #if str( $reference_source.reference_source_selector ) == "history": ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && #else: #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) #end if vcfprimers -f "${reference_fasta_filename}" -l "${primer_length}" "${input_vcf}" > "${out_file1}"</command> <inputs> <param name="input_vcf" type="data" format="vcf" label="VCF dataset to extract flanks" /> <conditional name="reference_source"> <param name="reference_source_selector" type="select" label="Choose the source for the reference genome"> <option value="cached">Locally cached</option> <option value="history">History</option> </param> <when value="cached"> <param name="ref_file" type="select" label="Select reference genome"> <options from_data_table="fasta_indexes"> </options> <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file"/> </param> </when> <when value="history"> <!-- FIX ME!!!! --> <param name="ref_file" type="data" format="fasta" label="Using reference file" /> </when> </conditional> <param name="primer_length" type="integer" value="20" label="The length of the primer sequences on each side of the variant" help="default = 20 bp" /> </inputs> <outputs> <data format="fasta" name="out_file1" /> </outputs> <tests> <test> <param name="reference_source_selector" value="history" /> <param name="input_vcf" value="vcflib-phix.vcf"/> <param name="ref_file" value="vcflib-test-genome-phix.fa" /> <param name="primer_length" value="5" /> <output name="out_file1" file="vcfprimers-test1.fasta"/> </test> </tests> <help> For each VCF record, extract the flanking sequences, and write them as FASTA records suitable for alignment. This tool is intended for use in designing validation experiments. Primers extracted which would flank all of the alleles at multi-allelic sites. The name of the FASTA "reads" indicates the VCF record which they apply to. The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer, for example:: >20_233255_LEFT CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA >20_233255_RIGHT ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA ---- Vcfprimers @IS_PART_OF_VCFLIB@ </help> <expand macro="citations" /> </tool>