Mercurial > repos > drosofff > metavisitor_workflows
comparison Galaxy-Workflow-Metavisitor__Workflow_for_remapping_in_Use_Cases_1-1,2,3.ga @ 2:48b020a0d2f7 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit d5feabb3309f2da09ba15b5fe818d0a7b30f3266
author | drosofff |
---|---|
date | Fri, 13 May 2016 05:46:40 -0400 |
parents | 4a47903bb4df |
children | ba15c770fd40 |
comparison
equal
deleted
inserted
replaced
1:3d8eb2c065c7 | 2:48b020a0d2f7 |
---|---|
25 "tool_errors": null, | 25 "tool_errors": null, |
26 "tool_id": null, | 26 "tool_id": null, |
27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Read fastq files\"}", | 27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Read fastq files\"}", |
28 "tool_version": null, | 28 "tool_version": null, |
29 "type": "data_collection_input", | 29 "type": "data_collection_input", |
30 "uuid": "None", | 30 "uuid": "ca202c6a-46b7-4f3a-a2ab-dbc781f331b7", |
31 "workflow_outputs": [ | 31 "workflow_outputs": [ |
32 { | 32 { |
33 "label": null, | 33 "label": null, |
34 "output_name": "output", | 34 "output_name": "output", |
35 "uuid": "19eaa717-5b9a-4b27-a1c4-a895fc673970" | 35 "uuid": "19eaa717-5b9a-4b27-a1c4-a895fc673970" |
57 "tool_errors": null, | 57 "tool_errors": null, |
58 "tool_id": null, | 58 "tool_id": null, |
59 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Nora Virus Genomes\"}", | 59 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Nora Virus Genomes\"}", |
60 "tool_version": null, | 60 "tool_version": null, |
61 "type": "data_collection_input", | 61 "type": "data_collection_input", |
62 "uuid": "None", | 62 "uuid": "e8e196c7-c854-4bd9-ace2-345a0d797090", |
63 "workflow_outputs": [ | 63 "workflow_outputs": [ |
64 { | 64 { |
65 "label": null, | 65 "label": null, |
66 "output_name": "output", | 66 "output_name": "output", |
67 "uuid": "46b1caea-3a7c-4663-b2e1-6536a346567a" | 67 "uuid": "46b1caea-3a7c-4663-b2e1-6536a346567a" |
98 "output_name": "output" | 98 "output_name": "output" |
99 } | 99 } |
100 }, | 100 }, |
101 "tool_errors": null, | 101 "tool_errors": null, |
102 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", | 102 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", |
103 "tool_shed_repository": { | |
104 "changeset_revision": "91cce7c1436d", | |
105 "name": "yac_clipper", | |
106 "owner": "drosofff", | |
107 "tool_shed": "toolshed.g2.bx.psu.edu" | |
108 }, | |
103 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"reject\\\"\"}", | 109 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"reject\\\"\"}", |
104 "tool_version": "1.3.6", | 110 "tool_version": "1.3.6", |
105 "type": "tool", | 111 "type": "tool", |
106 "uuid": "None", | 112 "uuid": "afa187ce-544c-4287-8699-a9efe8ce45ab", |
107 "workflow_outputs": [] | 113 "workflow_outputs": [] |
108 }, | 114 }, |
109 "3": { | 115 "3": { |
110 "annotation": "", | 116 "annotation": "", |
111 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", | 117 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", |
143 "output_name": "out_file1" | 149 "output_name": "out_file1" |
144 } | 150 } |
145 }, | 151 }, |
146 "tool_errors": null, | 152 "tool_errors": null, |
147 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", | 153 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", |
154 "tool_shed_repository": { | |
155 "changeset_revision": "201c568972c3", | |
156 "name": "concatenate_multiple_datasets", | |
157 "owner": "mvdbeek", | |
158 "tool_shed": "toolshed.g2.bx.psu.edu" | |
159 }, | |
148 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", | 160 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", |
149 "tool_version": "0.2", | 161 "tool_version": "0.2", |
150 "type": "tool", | 162 "type": "tool", |
151 "uuid": "None", | 163 "uuid": "73d5e37a-8a61-4bab-8bf5-12b12fc45988", |
152 "workflow_outputs": [] | 164 "workflow_outputs": [] |
153 }, | 165 }, |
154 "4": { | 166 "4": { |
155 "annotation": "", | 167 "annotation": "", |
156 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", | 168 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", |
195 "output_name": "out_file1" | 207 "output_name": "out_file1" |
196 } | 208 } |
197 }, | 209 }, |
198 "tool_errors": null, | 210 "tool_errors": null, |
199 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", | 211 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", |
212 "tool_shed_repository": { | |
213 "changeset_revision": "201c568972c3", | |
214 "name": "concatenate_multiple_datasets", | |
215 "owner": "mvdbeek", | |
216 "tool_shed": "toolshed.g2.bx.psu.edu" | |
217 }, | |
200 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", | 218 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", |
201 "tool_version": "0.2", | 219 "tool_version": "0.2", |
202 "type": "tool", | 220 "type": "tool", |
203 "uuid": "None", | 221 "uuid": "f15e8add-3a18-4607-b5e2-51448dcdeb77", |
204 "workflow_outputs": [] | 222 "workflow_outputs": [] |
205 }, | 223 }, |
206 "5": { | 224 "5": { |
207 "annotation": "", | 225 "annotation": "", |
208 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", | 226 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", |
255 "output_name": "unaligned" | 273 "output_name": "unaligned" |
256 } | 274 } |
257 }, | 275 }, |
258 "tool_errors": null, | 276 "tool_errors": null, |
259 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", | 277 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2", |
278 "tool_shed_repository": { | |
279 "changeset_revision": "c1bfa227bbb6", | |
280 "name": "msp_sr_bowtie", | |
281 "owner": "drosofff", | |
282 "tool_shed": "toolshed.g2.bx.psu.edu" | |
283 }, | |
260 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"multiple\\\"\"}", | 284 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"multiple\\\"\"}", |
261 "tool_version": "1.1.2", | 285 "tool_version": "1.1.2", |
262 "type": "tool", | 286 "type": "tool", |
263 "uuid": "None", | 287 "uuid": "a9880e4e-f47f-4a21-ad20-5aefb83b57ad", |
264 "workflow_outputs": [] | 288 "workflow_outputs": [] |
265 }, | 289 }, |
266 "6": { | 290 "6": { |
267 "annotation": "", | 291 "annotation": "", |
268 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", | 292 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", |
307 "output_name": "out_file1" | 331 "output_name": "out_file1" |
308 } | 332 } |
309 }, | 333 }, |
310 "tool_errors": null, | 334 "tool_errors": null, |
311 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", | 335 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", |
336 "tool_shed_repository": { | |
337 "changeset_revision": "201c568972c3", | |
338 "name": "concatenate_multiple_datasets", | |
339 "owner": "mvdbeek", | |
340 "tool_shed": "toolshed.g2.bx.psu.edu" | |
341 }, | |
312 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", | 342 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", |
313 "tool_version": "0.2", | 343 "tool_version": "0.2", |
314 "type": "tool", | 344 "type": "tool", |
315 "uuid": "None", | 345 "uuid": "afeb8258-2959-4b81-bec4-aaa342dd930d", |
316 "workflow_outputs": [] | 346 "workflow_outputs": [] |
317 }, | 347 }, |
318 "7": { | 348 "7": { |
319 "annotation": "", | 349 "annotation": "", |
320 "content_id": "wc_gnu", | 350 "content_id": "wc_gnu", |
347 "output_name": "out_file1" | 377 "output_name": "out_file1" |
348 } | 378 } |
349 }, | 379 }, |
350 "tool_errors": null, | 380 "tool_errors": null, |
351 "tool_id": "wc_gnu", | 381 "tool_id": "wc_gnu", |
352 "tool_state": "{\"__page__\": 0, \"include_header\": \"\\\"True\\\"\", \"input1\": \"null\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}", | 382 "tool_state": "{\"__page__\": 0, \"include_header\": \"\\\"true\\\"\", \"input1\": \"null\", \"options\": \"[\\\"lines\\\"]\", \"__rerun_remap_job_id__\": null}", |
353 "tool_version": "1.0.0", | 383 "tool_version": "1.0.0", |
354 "type": "tool", | 384 "type": "tool", |
355 "uuid": "None", | 385 "uuid": "98092466-d430-48bd-b285-770aeee41153", |
356 "workflow_outputs": [ | 386 "workflow_outputs": [ |
357 { | 387 { |
358 "label": null, | 388 "label": null, |
359 "output_name": "out_file1", | 389 "output_name": "out_file1", |
360 "uuid": "cdd91e78-45f2-4ec2-b426-93e20d238c4b" | 390 "uuid": "cdd91e78-45f2-4ec2-b426-93e20d238c4b" |
416 "output_name": "size_distribution_dataframe" | 446 "output_name": "size_distribution_dataframe" |
417 } | 447 } |
418 }, | 448 }, |
419 "tool_errors": null, | 449 "tool_errors": null, |
420 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", | 450 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.1.5", |
451 "tool_shed_repository": { | |
452 "changeset_revision": "68f58363f1c6", | |
453 "name": "msp_sr_readmap_and_size_histograms", | |
454 "owner": "drosofff", | |
455 "tool_shed": "toolshed.g2.bx.psu.edu" | |
456 }, | |
421 "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": null}], \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"null\"}", | 457 "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": null}], \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"null\"}", |
422 "tool_version": "1.1.5", | 458 "tool_version": "1.1.5", |
423 "type": "tool", | 459 "type": "tool", |
424 "uuid": "ebaf90ab-b8ea-428f-876c-8f9fabd1fbf9", | 460 "uuid": "ebaf90ab-b8ea-428f-876c-8f9fabd1fbf9", |
425 "workflow_outputs": [ | 461 "workflow_outputs": [ |