Mercurial > repos > drosofff > metavisitor_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-1.ga @ 0:4a47903bb4df draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author drosofff
date Tue, 05 Apr 2016 06:42:47 -0400
parents
children 48b020a0d2f7
comparison
equal deleted inserted replaced
-1:000000000000 0:4a47903bb4df
1 {
2 "a_galaxy_workflow": "true",
3 "annotation": "",
4 "format-version": "0.1",
5 "name": "Metavisitor: Workflow for Use Case 1-1",
6 "steps": {
7 "0": {
8 "annotation": "",
9 "content_id": null,
10 "id": 0,
11 "input_connections": {},
12 "inputs": [
13 {
14 "description": "",
15 "name": "Input Dataset Collection"
16 }
17 ],
18 "label": null,
19 "name": "Input dataset collection",
20 "outputs": [],
21 "position": {
22 "left": 211.9375,
23 "top": 200
24 },
25 "tool_errors": null,
26 "tool_id": null,
27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}",
28 "tool_version": null,
29 "type": "data_collection_input",
30 "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e",
31 "workflow_outputs": [
32 {
33 "label": null,
34 "output_name": "output",
35 "uuid": "a0c5d574-7761-452f-b8ac-5e789bfdced8"
36 }
37 ]
38 },
39 "1": {
40 "annotation": "",
41 "content_id": null,
42 "id": 1,
43 "input_connections": {},
44 "inputs": [
45 {
46 "description": "",
47 "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"
48 }
49 ],
50 "label": null,
51 "name": "Input dataset",
52 "outputs": [],
53 "position": {
54 "left": 1024.96875,
55 "top": 963.984375
56 },
57 "tool_errors": null,
58 "tool_id": null,
59 "tool_state": "{\"name\": \"viral nucleotide BLAST database (NCBI 19-10-2015)\"}",
60 "tool_version": null,
61 "type": "data_input",
62 "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca",
63 "workflow_outputs": [
64 {
65 "label": null,
66 "output_name": "output",
67 "uuid": "6bd2d24e-e12f-41fe-9308-631cc6718143"
68 }
69 ]
70 },
71 "2": {
72 "annotation": "",
73 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4",
74 "id": 2,
75 "input_connections": {},
76 "inputs": [],
77 "label": null,
78 "name": "Retrieve FASTA from NCBI",
79 "outputs": [
80 {
81 "name": "outfilename",
82 "type": "fasta"
83 },
84 {
85 "name": "logfile",
86 "type": "txt"
87 }
88 ],
89 "position": {
90 "left": 1643.5,
91 "top": 945.484375
92 },
93 "post_job_actions": {
94 "HideDatasetActionlogfile": {
95 "action_arguments": {},
96 "action_type": "HideDatasetAction",
97 "output_name": "logfile"
98 },
99 "RenameDatasetActionoutfilename": {
100 "action_arguments": {
101 "newname": "${ncbi_guide_ID}"
102 },
103 "action_type": "RenameDatasetAction",
104 "output_name": "outfilename"
105 }
106 },
107 "tool_errors": null,
108 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4",
109 "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}",
110 "tool_version": "0.9.4",
111 "type": "tool",
112 "uuid": "7858036a-2e5d-4dc3-8ce4-819c746c742c",
113 "workflow_outputs": [
114 {
115 "label": null,
116 "output_name": "outfilename",
117 "uuid": "c465ab57-4258-47c4-b7f6-5cbd4fb5db7a"
118 }
119 ]
120 },
121 "3": {
122 "annotation": "",
123 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
124 "id": 3,
125 "input_connections": {
126 "input": {
127 "id": 0,
128 "output_name": "output"
129 }
130 },
131 "inputs": [],
132 "label": null,
133 "name": "Clip adapter",
134 "outputs": [
135 {
136 "name": "output",
137 "type": "fasta"
138 }
139 ],
140 "position": {
141 "left": 420.484375,
142 "top": 292.5
143 },
144 "post_job_actions": {},
145 "tool_errors": null,
146 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
147 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}",
148 "tool_version": "1.3.6",
149 "type": "tool",
150 "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db",
151 "workflow_outputs": [
152 {
153 "label": null,
154 "output_name": "output",
155 "uuid": "4d0de010-c3af-4f43-96e8-13d30f2d9e1b"
156 }
157 ]
158 },
159 "4": {
160 "annotation": "",
161 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06",
162 "id": 4,
163 "input_connections": {
164 "input_file": {
165 "id": 2,
166 "output_name": "outfilename"
167 }
168 },
169 "inputs": [],
170 "label": null,
171 "name": "NCBI BLAST+ makeblastdb",
172 "outputs": [
173 {
174 "name": "outfile",
175 "type": "data"
176 }
177 ],
178 "position": {
179 "left": 1914.484375,
180 "top": 1065.484375
181 },
182 "post_job_actions": {
183 "HideDatasetActionoutfile": {
184 "action_arguments": {},
185 "action_type": "HideDatasetAction",
186 "output_name": "outfile"
187 }
188 },
189 "tool_errors": null,
190 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06",
191 "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"input_file\": \"null\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"True\\\"\", \"tax\": \"{\\\"taxselect\\\": \\\"\\\", \\\"__current_case__\\\": 0}\", \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"title\": \"\\\"Blastn candidate database\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"parse_seqids\": \"\\\"False\\\"\"}",
192 "tool_version": "0.1.06",
193 "type": "tool",
194 "uuid": "ce29cdbe-653a-4d0e-b225-0d0762c28d4d",
195 "workflow_outputs": []
196 },
197 "5": {
198 "annotation": "",
199 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
200 "id": 5,
201 "input_connections": {
202 "input": {
203 "id": 3,
204 "output_name": "output"
205 }
206 },
207 "inputs": [],
208 "label": null,
209 "name": "Concatenate multiple datasets",
210 "outputs": [
211 {
212 "name": "out_file1",
213 "type": "input"
214 }
215 ],
216 "position": {
217 "left": 452.5,
218 "top": 463.484375
219 },
220 "post_job_actions": {
221 "ChangeDatatypeActionout_file1": {
222 "action_arguments": {
223 "newtype": "fasta"
224 },
225 "action_type": "ChangeDatatypeAction",
226 "output_name": "out_file1"
227 },
228 "HideDatasetActionout_file1": {
229 "action_arguments": {},
230 "action_type": "HideDatasetAction",
231 "output_name": "out_file1"
232 }
233 },
234 "tool_errors": null,
235 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
236 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}",
237 "tool_version": "0.2",
238 "type": "tool",
239 "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a",
240 "workflow_outputs": []
241 },
242 "6": {
243 "annotation": "",
244 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
245 "id": 6,
246 "input_connections": {
247 "switch|input": {
248 "id": 5,
249 "output_name": "out_file1"
250 }
251 },
252 "inputs": [],
253 "label": null,
254 "name": "fasta - tabular",
255 "outputs": [
256 {
257 "name": "output",
258 "type": "fasta"
259 }
260 ],
261 "position": {
262 "left": 602,
263 "top": 607.5
264 },
265 "post_job_actions": {
266 "HideDatasetActionoutput": {
267 "action_arguments": {},
268 "action_type": "HideDatasetAction",
269 "output_name": "output"
270 }
271 },
272 "tool_errors": null,
273 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
274 "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"fasta2tabular\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null}",
275 "tool_version": "1.1.0",
276 "type": "tool",
277 "uuid": "32ec6fba-fb02-4edd-a3c3-3bd617e78ff2",
278 "workflow_outputs": []
279 },
280 "7": {
281 "annotation": "",
282 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
283 "id": 7,
284 "input_connections": {
285 "switch|input": {
286 "id": 6,
287 "output_name": "output"
288 }
289 },
290 "inputs": [],
291 "label": null,
292 "name": "fasta - tabular",
293 "outputs": [
294 {
295 "name": "output",
296 "type": "fasta"
297 }
298 ],
299 "position": {
300 "left": 764,
301 "top": 787.5
302 },
303 "post_job_actions": {
304 "RenameDatasetActionoutput": {
305 "action_arguments": {
306 "newname": "Initial Clipped sequences"
307 },
308 "action_type": "RenameDatasetAction",
309 "output_name": "output"
310 }
311 },
312 "tool_errors": null,
313 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
314 "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"tabular2fastaweight\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null}",
315 "tool_version": "1.1.0",
316 "type": "tool",
317 "uuid": "7cc53603-6876-4f15-919d-177218404620",
318 "workflow_outputs": [
319 {
320 "label": null,
321 "output_name": "output",
322 "uuid": "76dbe6c7-d553-4958-9e36-5e1c5ca41c09"
323 }
324 ]
325 },
326 "8": {
327 "annotation": "",
328 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
329 "id": 8,
330 "input_connections": {
331 "input": {
332 "id": 7,
333 "output_name": "output"
334 }
335 },
336 "inputs": [],
337 "label": null,
338 "name": "sRbowtie",
339 "outputs": [
340 {
341 "name": "output",
342 "type": "tabular"
343 },
344 {
345 "name": "aligned",
346 "type": "fasta"
347 },
348 {
349 "name": "unaligned",
350 "type": "fasta"
351 }
352 ],
353 "position": {
354 "left": 830.484375,
355 "top": 288.484375
356 },
357 "post_job_actions": {
358 "HideDatasetActionaligned": {
359 "action_arguments": {},
360 "action_type": "HideDatasetAction",
361 "output_name": "aligned"
362 },
363 "HideDatasetActionoutput": {
364 "action_arguments": {},
365 "action_type": "HideDatasetAction",
366 "output_name": "output"
367 },
368 "RenameDatasetActionunaligned": {
369 "action_arguments": {
370 "newname": "Non D. melanogaster sequences"
371 },
372 "action_type": "RenameDatasetAction",
373 "output_name": "unaligned"
374 }
375 },
376 "tool_errors": null,
377 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
378 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}",
379 "tool_version": "1.1.2",
380 "type": "tool",
381 "uuid": "e22c6843-8125-49d6-9dcd-546155536f78",
382 "workflow_outputs": [
383 {
384 "label": null,
385 "output_name": "unaligned",
386 "uuid": "e927b3ae-279d-46fe-b099-0e22a728bfe7"
387 }
388 ]
389 },
390 "9": {
391 "annotation": "",
392 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4",
393 "id": 9,
394 "input_connections": {
395 "inputs_0|input": {
396 "id": 8,
397 "output_name": "unaligned"
398 }
399 },
400 "inputs": [],
401 "label": null,
402 "name": "Oases_optimiser",
403 "outputs": [
404 {
405 "name": "transcripts",
406 "type": "fasta"
407 }
408 ],
409 "position": {
410 "left": 1099.484375,
411 "top": 509.484375
412 },
413 "post_job_actions": {
414 "RenameDatasetActiontranscripts": {
415 "action_arguments": {
416 "newname": "Oases Contigs"
417 },
418 "action_type": "RenameDatasetAction",
419 "output_name": "transcripts"
420 }
421 },
422 "tool_errors": null,
423 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4",
424 "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}",
425 "tool_version": "1.1.4",
426 "type": "tool",
427 "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c",
428 "workflow_outputs": [
429 {
430 "label": null,
431 "output_name": "transcripts",
432 "uuid": "31b0804f-a2bd-4d23-9a8a-d544777a92c8"
433 }
434 ]
435 },
436 "10": {
437 "annotation": "",
438 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
439 "id": 10,
440 "input_connections": {
441 "db_opts|histdb": {
442 "id": 1,
443 "output_name": "output"
444 },
445 "query": {
446 "id": 9,
447 "output_name": "transcripts"
448 }
449 },
450 "inputs": [],
451 "label": null,
452 "name": "NCBI BLAST+ blastn",
453 "outputs": [
454 {
455 "name": "output1",
456 "type": "tabular"
457 }
458 ],
459 "position": {
460 "left": 1273.484375,
461 "top": 800.484375
462 },
463 "post_job_actions": {
464 "HideDatasetActionoutput1": {
465 "action_arguments": {},
466 "action_type": "HideDatasetAction",
467 "output_name": "output1"
468 }
469 },
470 "tool_errors": null,
471 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
472 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\", \\\"__current_case__\\\": 0}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"False\\\", \\\"filter_query\\\": \\\"True\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"False\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
473 "tool_version": "0.1.06",
474 "type": "tool",
475 "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748",
476 "workflow_outputs": []
477 },
478 "11": {
479 "annotation": "",
480 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3",
481 "id": 11,
482 "input_connections": {
483 "blast": {
484 "id": 10,
485 "output_name": "output1"
486 },
487 "sequences": {
488 "id": 9,
489 "output_name": "transcripts"
490 }
491 },
492 "inputs": [],
493 "label": null,
494 "name": "Parse blast output and compile hits",
495 "outputs": [
496 {
497 "name": "tabularOutput",
498 "type": "tabular"
499 },
500 {
501 "name": "fastaOutput",
502 "type": "fasta"
503 },
504 {
505 "name": "al_sequences",
506 "type": "fasta"
507 },
508 {
509 "name": "un_sequences",
510 "type": "fasta"
511 }
512 ],
513 "position": {
514 "left": 1563.984375,
515 "top": 513.484375
516 },
517 "post_job_actions": {
518 "HideDatasetActional_sequences": {
519 "action_arguments": {},
520 "action_type": "HideDatasetAction",
521 "output_name": "al_sequences"
522 },
523 "HideDatasetActionun_sequences": {
524 "action_arguments": {},
525 "action_type": "HideDatasetAction",
526 "output_name": "un_sequences"
527 }
528 },
529 "tool_errors": null,
530 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3",
531 "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}",
532 "tool_version": "2.4.3",
533 "type": "tool",
534 "uuid": "84989771-81db-4d86-bff6-cfda892b1959",
535 "workflow_outputs": [
536 {
537 "label": null,
538 "output_name": "tabularOutput",
539 "uuid": "64263e2f-a180-42be-a440-26dea6a26ec3"
540 },
541 {
542 "label": null,
543 "output_name": "fastaOutput",
544 "uuid": "fa7a0f9d-679d-4040-af20-1112aad1f73c"
545 }
546 ]
547 },
548 "12": {
549 "annotation": "",
550 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0",
551 "id": 12,
552 "input_connections": {
553 "inputSequences": {
554 "id": 11,
555 "output_name": "fastaOutput"
556 }
557 },
558 "inputs": [],
559 "label": null,
560 "name": "cap3",
561 "outputs": [
562 {
563 "name": "contigsandsinglets",
564 "type": "fasta"
565 },
566 {
567 "name": "cap3stdout",
568 "type": "txt"
569 },
570 {
571 "name": "contigs",
572 "type": "fasta"
573 },
574 {
575 "name": "contigsqual",
576 "type": "txt"
577 },
578 {
579 "name": "contigslink",
580 "type": "txt"
581 },
582 {
583 "name": "ace",
584 "type": "txt"
585 },
586 {
587 "name": "info",
588 "type": "txt"
589 },
590 {
591 "name": "singlets",
592 "type": "txt"
593 }
594 ],
595 "position": {
596 "left": 1879.484375,
597 "top": 596.484375
598 },
599 "post_job_actions": {
600 "HideDatasetActionace": {
601 "action_arguments": {},
602 "action_type": "HideDatasetAction",
603 "output_name": "ace"
604 },
605 "HideDatasetActioncap3stdout": {
606 "action_arguments": {},
607 "action_type": "HideDatasetAction",
608 "output_name": "cap3stdout"
609 },
610 "HideDatasetActioncontigs": {
611 "action_arguments": {},
612 "action_type": "HideDatasetAction",
613 "output_name": "contigs"
614 },
615 "HideDatasetActioncontigslink": {
616 "action_arguments": {},
617 "action_type": "HideDatasetAction",
618 "output_name": "contigslink"
619 },
620 "HideDatasetActioncontigsqual": {
621 "action_arguments": {},
622 "action_type": "HideDatasetAction",
623 "output_name": "contigsqual"
624 },
625 "HideDatasetActioninfo": {
626 "action_arguments": {},
627 "action_type": "HideDatasetAction",
628 "output_name": "info"
629 },
630 "HideDatasetActionsinglets": {
631 "action_arguments": {},
632 "action_type": "HideDatasetAction",
633 "output_name": "singlets"
634 }
635 },
636 "tool_errors": null,
637 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0",
638 "tool_state": "{\"__page__\": 0, \"inputSequences\": \"null\", \"overlaplength\": \"\\\"40\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"overlapidentity\": \"\\\"90\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
639 "tool_version": "1.2.0",
640 "type": "tool",
641 "uuid": "1d6dcdba-8f89-453b-ae30-6bb8aee06360",
642 "workflow_outputs": [
643 {
644 "label": null,
645 "output_name": "contigsandsinglets",
646 "uuid": "d11435c3-354c-497e-8deb-b389b11a59c5"
647 }
648 ]
649 },
650 "13": {
651 "annotation": "",
652 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
653 "id": 13,
654 "input_connections": {
655 "db_opts|histdb": {
656 "id": 4,
657 "output_name": "outfile"
658 },
659 "query": {
660 "id": 12,
661 "output_name": "contigsandsinglets"
662 }
663 },
664 "inputs": [],
665 "label": null,
666 "name": "NCBI BLAST+ blastn",
667 "outputs": [
668 {
669 "name": "output1",
670 "type": "tabular"
671 }
672 ],
673 "position": {
674 "left": 2234.484375,
675 "top": 956.484375
676 },
677 "post_job_actions": {
678 "HideDatasetActionoutput1": {
679 "action_arguments": {},
680 "action_type": "HideDatasetAction",
681 "output_name": "output1"
682 }
683 },
684 "tool_errors": null,
685 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
686 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
687 "tool_version": "0.1.06",
688 "type": "tool",
689 "uuid": "c9f9c58a-f21d-46d2-a952-9e7b7d5bf939",
690 "workflow_outputs": []
691 },
692 "14": {
693 "annotation": "",
694 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0",
695 "id": 14,
696 "input_connections": {
697 "blast_tab": {
698 "id": 13,
699 "output_name": "output1"
700 },
701 "guideSequence": {
702 "id": 2,
703 "output_name": "outfilename"
704 },
705 "sequences": {
706 "id": 12,
707 "output_name": "contigsandsinglets"
708 }
709 },
710 "inputs": [],
711 "label": null,
712 "name": "blast_to_scaffold",
713 "outputs": [
714 {
715 "name": "output",
716 "type": "fasta"
717 }
718 ],
719 "position": {
720 "left": 2547,
721 "top": 838.5
722 },
723 "post_job_actions": {
724 "HideDatasetActionoutput": {
725 "action_arguments": {},
726 "action_type": "HideDatasetAction",
727 "output_name": "output"
728 }
729 },
730 "tool_errors": null,
731 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0",
732 "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}",
733 "tool_version": "0.9.0",
734 "type": "tool",
735 "uuid": "4e68c3e8-b825-40bd-ae22-a74ca7048737",
736 "workflow_outputs": []
737 },
738 "15": {
739 "annotation": "",
740 "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0",
741 "id": 15,
742 "input_connections": {
743 "input": {
744 "id": 14,
745 "output_name": "output"
746 }
747 },
748 "inputs": [],
749 "label": null,
750 "name": "Regex Find And Replace",
751 "outputs": [
752 {
753 "name": "out_file1",
754 "type": "input"
755 }
756 ],
757 "position": {
758 "left": 2726.984375,
759 "top": 1140
760 },
761 "post_job_actions": {
762 "RenameDatasetActionout_file1": {
763 "action_arguments": {
764 "newname": "Nora_MV_${ncbi_guide_ID}_guided"
765 },
766 "action_type": "RenameDatasetAction",
767 "output_name": "out_file1"
768 }
769 },
770 "tool_errors": null,
771 "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0",
772 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\">Nora_MV\\\", \\\"pattern\\\": \\\">.+\\\"}]\", \"__page__\": 0}",
773 "tool_version": "0.1.0",
774 "type": "tool",
775 "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf",
776 "workflow_outputs": [
777 {
778 "label": null,
779 "output_name": "out_file1",
780 "uuid": "d180a0a7-c5ff-4ab4-99ef-9bd8589dd378"
781 }
782 ]
783 }
784 },
785 "uuid": "6d905af0-243a-42b9-8951-a5477cfa6d88"
786 }