Mercurial > repos > drosofff > metavisitor_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_1-2.ga @ 0:4a47903bb4df draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author drosofff
date Tue, 05 Apr 2016 06:42:47 -0400
parents
children 48b020a0d2f7
comparison
equal deleted inserted replaced
-1:000000000000 0:4a47903bb4df
1 {
2 "a_galaxy_workflow": "true",
3 "annotation": "",
4 "format-version": "0.1",
5 "name": "Metavisitor: Workflow for Use Case 1-2",
6 "steps": {
7 "0": {
8 "annotation": "",
9 "content_id": null,
10 "id": 0,
11 "input_connections": {},
12 "inputs": [
13 {
14 "description": "",
15 "name": "Input Dataset Collection"
16 }
17 ],
18 "label": null,
19 "name": "Input dataset collection",
20 "outputs": [],
21 "position": {
22 "left": 211.9375,
23 "top": 200
24 },
25 "tool_errors": null,
26 "tool_id": null,
27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}",
28 "tool_version": null,
29 "type": "data_collection_input",
30 "uuid": "e60ca12e-15cc-4a01-a912-945af21a5e8e",
31 "workflow_outputs": [
32 {
33 "label": null,
34 "output_name": "output",
35 "uuid": "940fadea-7557-4c56-a6df-c58db232b6f0"
36 }
37 ]
38 },
39 "1": {
40 "annotation": "",
41 "content_id": null,
42 "id": 1,
43 "input_connections": {},
44 "inputs": [
45 {
46 "description": "",
47 "name": "viral nucleotide BLAST database (NCBI 19-10-2015)"
48 }
49 ],
50 "label": null,
51 "name": "Input dataset",
52 "outputs": [],
53 "position": {
54 "left": 1024.9375,
55 "top": 963.984375
56 },
57 "tool_errors": null,
58 "tool_id": null,
59 "tool_state": "{\"name\": \"viral nucleotide BLAST database (NCBI 19-10-2015)\"}",
60 "tool_version": null,
61 "type": "data_input",
62 "uuid": "462eb78f-9844-42d6-8087-19f2e1e801ca",
63 "workflow_outputs": [
64 {
65 "label": null,
66 "output_name": "output",
67 "uuid": "9a03415f-fd4b-43ea-ae2d-c9004b97d703"
68 }
69 ]
70 },
71 "2": {
72 "annotation": "",
73 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4",
74 "id": 2,
75 "input_connections": {},
76 "inputs": [],
77 "label": null,
78 "name": "Retrieve FASTA from NCBI",
79 "outputs": [
80 {
81 "name": "outfilename",
82 "type": "fasta"
83 },
84 {
85 "name": "logfile",
86 "type": "txt"
87 }
88 ],
89 "position": {
90 "left": 1587.5,
91 "top": 994.484375
92 },
93 "post_job_actions": {
94 "HideDatasetActionlogfile": {
95 "action_arguments": {},
96 "action_type": "HideDatasetAction",
97 "output_name": "logfile"
98 },
99 "RenameDatasetActionoutfilename": {
100 "action_arguments": {
101 "newname": "${ncbi_guide_ID}"
102 },
103 "action_type": "RenameDatasetAction",
104 "output_name": "outfilename"
105 }
106 },
107 "tool_errors": null,
108 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.4",
109 "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"${ncbi_guide_ID}\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}",
110 "tool_version": "0.9.4",
111 "type": "tool",
112 "uuid": "7858036a-2e5d-4dc3-8ce4-819c746c742c",
113 "workflow_outputs": [
114 {
115 "label": null,
116 "output_name": "outfilename",
117 "uuid": "4a4625bf-6029-4f4d-b110-3bec39c97ef3"
118 }
119 ]
120 },
121 "3": {
122 "annotation": "",
123 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
124 "id": 3,
125 "input_connections": {
126 "input": {
127 "id": 0,
128 "output_name": "output"
129 }
130 },
131 "inputs": [],
132 "label": null,
133 "name": "Clip adapter",
134 "outputs": [
135 {
136 "name": "output",
137 "type": "fasta"
138 }
139 ],
140 "position": {
141 "left": 420.46875,
142 "top": 292.5
143 },
144 "post_job_actions": {},
145 "tool_errors": null,
146 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
147 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"459d9188801e11e5ae6af01fafdfc061\\\"\", \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"CTGTAGGCACCATCAATCGT\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"Nmode\": \"\\\"reject\\\"\"}",
148 "tool_version": "1.3.6",
149 "type": "tool",
150 "uuid": "69611c78-3f25-4471-abf7-426ec35fd2db",
151 "workflow_outputs": [
152 {
153 "label": null,
154 "output_name": "output",
155 "uuid": "54f9c80d-225e-4239-b813-bdebca04d857"
156 }
157 ]
158 },
159 "4": {
160 "annotation": "",
161 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06",
162 "id": 4,
163 "input_connections": {
164 "input_file": {
165 "id": 2,
166 "output_name": "outfilename"
167 }
168 },
169 "inputs": [],
170 "label": null,
171 "name": "NCBI BLAST+ makeblastdb",
172 "outputs": [
173 {
174 "name": "outfile",
175 "type": "data"
176 }
177 ],
178 "position": {
179 "left": 1866.484375,
180 "top": 1084.484375
181 },
182 "post_job_actions": {
183 "HideDatasetActionoutfile": {
184 "action_arguments": {},
185 "action_type": "HideDatasetAction",
186 "output_name": "outfile"
187 }
188 },
189 "tool_errors": null,
190 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06",
191 "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"input_file\": \"null\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"True\\\"\", \"tax\": \"{\\\"taxselect\\\": \\\"\\\", \\\"__current_case__\\\": 0}\", \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"title\": \"\\\"Blastn candidate database\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\", \"parse_seqids\": \"\\\"False\\\"\"}",
192 "tool_version": "0.1.06",
193 "type": "tool",
194 "uuid": "ce29cdbe-653a-4d0e-b225-0d0762c28d4d",
195 "workflow_outputs": []
196 },
197 "5": {
198 "annotation": "",
199 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
200 "id": 5,
201 "input_connections": {
202 "input": {
203 "id": 3,
204 "output_name": "output"
205 }
206 },
207 "inputs": [],
208 "label": null,
209 "name": "Concatenate multiple datasets",
210 "outputs": [
211 {
212 "name": "out_file1",
213 "type": "input"
214 }
215 ],
216 "position": {
217 "left": 576.5,
218 "top": 418.484375
219 },
220 "post_job_actions": {
221 "ChangeDatatypeActionout_file1": {
222 "action_arguments": {
223 "newtype": "fasta"
224 },
225 "action_type": "ChangeDatatypeAction",
226 "output_name": "out_file1"
227 },
228 "HideDatasetActionout_file1": {
229 "action_arguments": {},
230 "action_type": "HideDatasetAction",
231 "output_name": "out_file1"
232 }
233 },
234 "tool_errors": null,
235 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
236 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}",
237 "tool_version": "0.2",
238 "type": "tool",
239 "uuid": "6be696ec-ca89-4e64-ad39-7d0e7fb4401a",
240 "workflow_outputs": []
241 },
242 "6": {
243 "annotation": "",
244 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
245 "id": 6,
246 "input_connections": {
247 "input": {
248 "id": 5,
249 "output_name": "out_file1"
250 }
251 },
252 "inputs": [],
253 "label": null,
254 "name": "sRbowtie",
255 "outputs": [
256 {
257 "name": "output",
258 "type": "tabular"
259 },
260 {
261 "name": "aligned",
262 "type": "fasta"
263 },
264 {
265 "name": "unaligned",
266 "type": "fasta"
267 }
268 ],
269 "position": {
270 "left": 830.46875,
271 "top": 288.484375
272 },
273 "post_job_actions": {
274 "HideDatasetActionaligned": {
275 "action_arguments": {},
276 "action_type": "HideDatasetAction",
277 "output_name": "aligned"
278 },
279 "HideDatasetActionoutput": {
280 "action_arguments": {},
281 "action_type": "HideDatasetAction",
282 "output_name": "output"
283 },
284 "RenameDatasetActionunaligned": {
285 "action_arguments": {
286 "newname": "Non D. melanogaster sequences"
287 },
288 "action_type": "RenameDatasetAction",
289 "output_name": "unaligned"
290 }
291 },
292 "tool_errors": null,
293 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
294 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"dm6\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}",
295 "tool_version": "1.1.2",
296 "type": "tool",
297 "uuid": "e22c6843-8125-49d6-9dcd-546155536f78",
298 "workflow_outputs": [
299 {
300 "label": null,
301 "output_name": "unaligned",
302 "uuid": "48d4c763-e2ec-40d5-8eec-a19107d5c41c"
303 }
304 ]
305 },
306 "7": {
307 "annotation": "",
308 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4",
309 "id": 7,
310 "input_connections": {
311 "inputs_0|input": {
312 "id": 6,
313 "output_name": "unaligned"
314 }
315 },
316 "inputs": [],
317 "label": null,
318 "name": "Oases_optimiser",
319 "outputs": [
320 {
321 "name": "transcripts",
322 "type": "fasta"
323 }
324 ],
325 "position": {
326 "left": 1099.46875,
327 "top": 509.484375
328 },
329 "post_job_actions": {
330 "RenameDatasetActiontranscripts": {
331 "action_arguments": {
332 "newname": "Oases Contigs"
333 },
334 "action_type": "RenameDatasetAction",
335 "output_name": "transcripts"
336 }
337 },
338 "tool_errors": null,
339 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4",
340 "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}",
341 "tool_version": "1.1.4",
342 "type": "tool",
343 "uuid": "4290f9b9-2ea7-4634-a639-bc008f1eb90c",
344 "workflow_outputs": [
345 {
346 "label": null,
347 "output_name": "transcripts",
348 "uuid": "0e1ec8f7-c026-4982-b854-6d406ffb5d10"
349 }
350 ]
351 },
352 "8": {
353 "annotation": "",
354 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
355 "id": 8,
356 "input_connections": {
357 "db_opts|histdb": {
358 "id": 1,
359 "output_name": "output"
360 },
361 "query": {
362 "id": 7,
363 "output_name": "transcripts"
364 }
365 },
366 "inputs": [],
367 "label": null,
368 "name": "NCBI BLAST+ blastn",
369 "outputs": [
370 {
371 "name": "output1",
372 "type": "tabular"
373 }
374 ],
375 "position": {
376 "left": 1273.484375,
377 "top": 800.484375
378 },
379 "post_job_actions": {
380 "HideDatasetActionoutput1": {
381 "action_arguments": {},
382 "action_type": "HideDatasetAction",
383 "output_name": "output1"
384 }
385 },
386 "tool_errors": null,
387 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
388 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_optional_id_files_opts\\\": {\\\"adv_optional_id_files_opts_selector\\\": \\\"none\\\", \\\"__current_case__\\\": 0}, \\\"identity_cutoff\\\": \\\"0.0\\\", \\\"adv_opts_selector\\\": \\\"advanced\\\", \\\"ungapped\\\": \\\"False\\\", \\\"filter_query\\\": \\\"True\\\", \\\"word_size\\\": \\\"0\\\", \\\"__current_case__\\\": 1, \\\"parse_deflines\\\": \\\"False\\\", \\\"qcov_hsp_perc\\\": \\\"0.0\\\", \\\"strand\\\": \\\"-strand both\\\", \\\"max_hits\\\": \\\"5\\\"}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"4dd2fde8802311e5bcddf01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
389 "tool_version": "0.1.06",
390 "type": "tool",
391 "uuid": "bf30a0ad-4ef9-49f0-b4c7-4aae52017748",
392 "workflow_outputs": []
393 },
394 "9": {
395 "annotation": "",
396 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3",
397 "id": 9,
398 "input_connections": {
399 "blast": {
400 "id": 8,
401 "output_name": "output1"
402 },
403 "sequences": {
404 "id": 7,
405 "output_name": "transcripts"
406 }
407 },
408 "inputs": [],
409 "label": null,
410 "name": "Parse blast output and compile hits",
411 "outputs": [
412 {
413 "name": "tabularOutput",
414 "type": "tabular"
415 },
416 {
417 "name": "fastaOutput",
418 "type": "fasta"
419 },
420 {
421 "name": "al_sequences",
422 "type": "fasta"
423 },
424 {
425 "name": "un_sequences",
426 "type": "fasta"
427 }
428 ],
429 "position": {
430 "left": 1563.984375,
431 "top": 513.484375
432 },
433 "post_job_actions": {
434 "HideDatasetActional_sequences": {
435 "action_arguments": {},
436 "action_type": "HideDatasetAction",
437 "output_name": "al_sequences"
438 },
439 "HideDatasetActionun_sequences": {
440 "action_arguments": {},
441 "action_type": "HideDatasetAction",
442 "output_name": "un_sequences"
443 }
444 },
445 "tool_errors": null,
446 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3",
447 "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"filter_term_out\\\": \\\"JX220408.1\\\", \\\"filter_relativeCov\\\": \\\"0.0\\\", \\\"filter_meanScore\\\": \\\"0.0\\\", \\\"use_filters\\\": \\\"yes\\\", \\\"__current_case__\\\": 1, \\\"filter_term_in\\\": \\\"Nora_virus\\\", \\\"filter_maxScore\\\": \\\"0.0\\\"}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"short\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}",
448 "tool_version": "2.4.3",
449 "type": "tool",
450 "uuid": "84989771-81db-4d86-bff6-cfda892b1959",
451 "workflow_outputs": [
452 {
453 "label": null,
454 "output_name": "tabularOutput",
455 "uuid": "d53d4680-1c8c-4397-8369-936ca8f283c1"
456 },
457 {
458 "label": null,
459 "output_name": "fastaOutput",
460 "uuid": "082373bd-ddaf-472f-b669-0eca37d75d80"
461 }
462 ]
463 },
464 "10": {
465 "annotation": "",
466 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0",
467 "id": 10,
468 "input_connections": {
469 "inputSequences": {
470 "id": 9,
471 "output_name": "fastaOutput"
472 }
473 },
474 "inputs": [],
475 "label": null,
476 "name": "cap3",
477 "outputs": [
478 {
479 "name": "contigsandsinglets",
480 "type": "fasta"
481 },
482 {
483 "name": "cap3stdout",
484 "type": "txt"
485 },
486 {
487 "name": "contigs",
488 "type": "fasta"
489 },
490 {
491 "name": "contigsqual",
492 "type": "txt"
493 },
494 {
495 "name": "contigslink",
496 "type": "txt"
497 },
498 {
499 "name": "ace",
500 "type": "txt"
501 },
502 {
503 "name": "info",
504 "type": "txt"
505 },
506 {
507 "name": "singlets",
508 "type": "txt"
509 }
510 ],
511 "position": {
512 "left": 1924.484375,
513 "top": 666.484375
514 },
515 "post_job_actions": {
516 "HideDatasetActionace": {
517 "action_arguments": {},
518 "action_type": "HideDatasetAction",
519 "output_name": "ace"
520 },
521 "HideDatasetActioncap3stdout": {
522 "action_arguments": {},
523 "action_type": "HideDatasetAction",
524 "output_name": "cap3stdout"
525 },
526 "HideDatasetActioncontigs": {
527 "action_arguments": {},
528 "action_type": "HideDatasetAction",
529 "output_name": "contigs"
530 },
531 "HideDatasetActioncontigslink": {
532 "action_arguments": {},
533 "action_type": "HideDatasetAction",
534 "output_name": "contigslink"
535 },
536 "HideDatasetActioncontigsqual": {
537 "action_arguments": {},
538 "action_type": "HideDatasetAction",
539 "output_name": "contigsqual"
540 },
541 "HideDatasetActioninfo": {
542 "action_arguments": {},
543 "action_type": "HideDatasetAction",
544 "output_name": "info"
545 },
546 "HideDatasetActionsinglets": {
547 "action_arguments": {},
548 "action_type": "HideDatasetAction",
549 "output_name": "singlets"
550 }
551 },
552 "tool_errors": null,
553 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0",
554 "tool_state": "{\"__page__\": 0, \"inputSequences\": \"null\", \"overlaplength\": \"\\\"40\\\"\", \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"overlapidentity\": \"\\\"90\\\"\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
555 "tool_version": "1.2.0",
556 "type": "tool",
557 "uuid": "1d6dcdba-8f89-453b-ae30-6bb8aee06360",
558 "workflow_outputs": [
559 {
560 "label": null,
561 "output_name": "contigsandsinglets",
562 "uuid": "029bd9db-59a4-4683-8136-86c80fb5e8d6"
563 }
564 ]
565 },
566 "11": {
567 "annotation": "",
568 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
569 "id": 11,
570 "input_connections": {
571 "db_opts|histdb": {
572 "id": 4,
573 "output_name": "outfile"
574 },
575 "query": {
576 "id": 10,
577 "output_name": "contigsandsinglets"
578 }
579 },
580 "inputs": [],
581 "label": null,
582 "name": "NCBI BLAST+ blastn",
583 "outputs": [
584 {
585 "name": "output1",
586 "type": "tabular"
587 }
588 ],
589 "position": {
590 "left": 2234.484375,
591 "top": 956.484375
592 },
593 "post_job_actions": {
594 "HideDatasetActionoutput1": {
595 "action_arguments": {},
596 "action_type": "HideDatasetAction",
597 "output_name": "output1"
598 }
599 },
600 "tool_errors": null,
601 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastn_wrapper/0.1.06",
602 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__page__\": 0, \"__rerun_remap_job_id__\": null, \"__workflow_invocation_uuid__\": \"\\\"ae5b2b58802911e5808df01fafdfc061\\\"\", \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"blast_type\": \"\\\"blastn\\\"\", \"query\": \"null\", \"chromInfo\": \"\\\"/home/galaxy/galaxy-dist/tool-data/shared/ucsc/chrom/?.len\\\"\"}",
603 "tool_version": "0.1.06",
604 "type": "tool",
605 "uuid": "c9f9c58a-f21d-46d2-a952-9e7b7d5bf939",
606 "workflow_outputs": []
607 },
608 "12": {
609 "annotation": "",
610 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0",
611 "id": 12,
612 "input_connections": {
613 "blast_tab": {
614 "id": 11,
615 "output_name": "output1"
616 },
617 "guideSequence": {
618 "id": 2,
619 "output_name": "outfilename"
620 },
621 "sequences": {
622 "id": 10,
623 "output_name": "contigsandsinglets"
624 }
625 },
626 "inputs": [],
627 "label": null,
628 "name": "blast_to_scaffold",
629 "outputs": [
630 {
631 "name": "output",
632 "type": "fasta"
633 }
634 ],
635 "position": {
636 "left": 2535,
637 "top": 774.5
638 },
639 "post_job_actions": {
640 "HideDatasetActionoutput": {
641 "action_arguments": {},
642 "action_type": "HideDatasetAction",
643 "output_name": "output"
644 }
645 },
646 "tool_errors": null,
647 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0",
648 "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}",
649 "tool_version": "0.9.0",
650 "type": "tool",
651 "uuid": "ca2b5401-fc07-4d46-8d5e-3a77a3e3b174",
652 "workflow_outputs": []
653 },
654 "13": {
655 "annotation": "",
656 "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0",
657 "id": 13,
658 "input_connections": {
659 "input": {
660 "id": 12,
661 "output_name": "output"
662 }
663 },
664 "inputs": [],
665 "label": null,
666 "name": "Regex Find And Replace",
667 "outputs": [
668 {
669 "name": "out_file1",
670 "type": "input"
671 }
672 ],
673 "position": {
674 "left": 2726.984375,
675 "top": 1140
676 },
677 "post_job_actions": {
678 "ChangeDatatypeActionout_file1": {
679 "action_arguments": {
680 "newtype": "fasta"
681 },
682 "action_type": "ChangeDatatypeAction",
683 "output_name": "out_file1"
684 },
685 "RenameDatasetActionout_file1": {
686 "action_arguments": {
687 "newname": "Nora_raw_reads_${ncbi_guide_ID}_guided"
688 },
689 "action_type": "RenameDatasetAction",
690 "output_name": "out_file1"
691 }
692 },
693 "tool_errors": null,
694 "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0",
695 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\">Nora_raw_reads\\\", \\\"pattern\\\": \\\">.+\\\"}]\", \"__page__\": 0}",
696 "tool_version": "0.1.0",
697 "type": "tool",
698 "uuid": "d804abd4-ad4e-4382-a81d-b592bec797cf",
699 "workflow_outputs": [
700 {
701 "label": null,
702 "output_name": "out_file1",
703 "uuid": "b5cf0dd9-bfe3-4021-99fe-12faf47d29e0"
704 }
705 ]
706 }
707 },
708 "uuid": "52976d74-fcd5-4e3c-a474-cd7aaf6e1047"
709 }