Mercurial > repos > drosofff > metavisitor_workflows

comparison Galaxy-Workflow-Metavisitor__Workflow_for_Use_Case_2-1.ga @ 0:4a47903bb4df draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit f6fa4bd2f176e3f4ae4b9c887113557d3c4ff209
author drosofff
date Tue, 05 Apr 2016 06:42:47 -0400
parents
children 48b020a0d2f7
comparison
equal deleted inserted replaced
-1:000000000000 0:4a47903bb4df
1 {
2 "a_galaxy_workflow": "true",
3 "annotation": "",
4 "format-version": "0.1",
5 "name": "Metavisitor: Workflow for Use Case 2-1",
6 "steps": {
7 "0": {
8 "annotation": "",
9 "content_id": null,
10 "id": 0,
11 "input_connections": {},
12 "inputs": [
13 {
14 "description": "",
15 "name": "Input Dataset Collection"
16 }
17 ],
18 "label": null,
19 "name": "Input dataset collection",
20 "outputs": [],
21 "position": {
22 "left": 110.9375,
23 "top": 269.37501525878906
24 },
25 "tool_errors": null,
26 "tool_id": null,
27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection\"}",
28 "tool_version": null,
29 "type": "data_collection_input",
30 "uuid": "None",
31 "workflow_outputs": [
32 {
33 "label": null,
34 "output_name": "output",
35 "uuid": "4e1d736b-a314-441c-95ef-c4e7fbde52e6"
36 }
37 ]
38 },
39 "1": {
40 "annotation": "",
41 "content_id": null,
42 "id": 1,
43 "input_connections": {},
44 "inputs": [
45 {
46 "description": "",
47 "name": "Blast Protein database"
48 }
49 ],
50 "label": null,
51 "name": "Input dataset",
52 "outputs": [],
53 "position": {
54 "left": 1088.5938110351562,
55 "top": 839.96533203125
56 },
57 "tool_errors": null,
58 "tool_id": null,
59 "tool_state": "{\"name\": \"Blast Protein database\"}",
60 "tool_version": null,
61 "type": "data_input",
62 "uuid": "ee9f8f76-6682-4688-88ad-8263109cf051",
63 "workflow_outputs": [
64 {
65 "label": null,
66 "output_name": "output",
67 "uuid": "18d27e4d-ada8-48e3-b69a-ce878a19d260"
68 }
69 ]
70 },
71 "2": {
72 "annotation": "",
73 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.3",
74 "id": 2,
75 "input_connections": {},
76 "inputs": [],
77 "label": null,
78 "name": "Retrieve FASTA from NCBI",
79 "outputs": [
80 {
81 "name": "outfilename",
82 "type": "fasta"
83 },
84 {
85 "name": "logfile",
86 "type": "txt"
87 }
88 ],
89 "position": {
90 "left": 1736.5973052978516,
91 "top": 1034.4966125488281
92 },
93 "post_job_actions": {
94 "HideDatasetActionlogfile": {
95 "action_arguments": {},
96 "action_type": "HideDatasetAction",
97 "output_name": "logfile"
98 },
99 "HideDatasetActionoutfilename": {
100 "action_arguments": {},
101 "action_type": "HideDatasetAction",
102 "output_name": "outfilename"
103 },
104 "RenameDatasetActionoutfilename": {
105 "action_arguments": {
106 "newname": "DCV NC_001834.1 Guide"
107 },
108 "action_type": "RenameDatasetAction",
109 "output_name": "outfilename"
110 }
111 },
112 "tool_errors": null,
113 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/fetch_fasta_from_ncbi/retrieve_fasta_from_NCBI/0.9.3",
114 "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"queryString\": \"\\\"NC_001834.1\\\"\", \"dbname\": \"\\\"nuccore\\\"\"}",
115 "tool_version": "0.9.3",
116 "type": "tool",
117 "uuid": "None",
118 "workflow_outputs": []
119 },
120 "3": {
121 "annotation": "",
122 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
123 "id": 3,
124 "input_connections": {
125 "input": {
126 "id": 0,
127 "output_name": "output"
128 }
129 },
130 "inputs": [],
131 "label": null,
132 "name": "Clip adapter",
133 "outputs": [
134 {
135 "name": "output",
136 "type": "fasta"
137 }
138 ],
139 "position": {
140 "left": 254.84375,
141 "top": 419.3750247955322
142 },
143 "post_job_actions": {
144 "HideDatasetActionoutput": {
145 "action_arguments": {},
146 "action_type": "HideDatasetAction",
147 "output_name": "output"
148 }
149 },
150 "tool_errors": null,
151 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6",
152 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"50\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"__current_case__\\\": 0}\", \"input\": \"null\", \"Nmode\": \"\\\"accept\\\"\"}",
153 "tool_version": "1.3.6",
154 "type": "tool",
155 "uuid": "None",
156 "workflow_outputs": []
157 },
158 "4": {
159 "annotation": "",
160 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06",
161 "id": 4,
162 "input_connections": {
163 "input_file": {
164 "id": 2,
165 "output_name": "outfilename"
166 }
167 },
168 "inputs": [],
169 "label": null,
170 "name": "NCBI BLAST+ makeblastdb",
171 "outputs": [
172 {
173 "name": "outfile",
174 "type": "data"
175 }
176 ],
177 "position": {
178 "left": 2035.6077270507812,
179 "top": 918.4896545410156
180 },
181 "post_job_actions": {
182 "HideDatasetActionoutfile": {
183 "action_arguments": {},
184 "action_type": "HideDatasetAction",
185 "output_name": "outfile"
186 }
187 },
188 "tool_errors": null,
189 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_makeblastdb/0.1.06",
190 "tool_state": "{\"__page__\": 0, \"mask_data_file\": \"null\", \"title\": \"\\\"DCV NC_001834.1\\\"\", \"dbtype\": \"\\\"nucl\\\"\", \"__rerun_remap_job_id__\": null, \"hash_index\": \"\\\"True\\\"\", \"tax\": \"{\\\"taxselect\\\": \\\"\\\", \\\"__current_case__\\\": 0}\", \"input_file\": \"null\", \"parse_seqids\": \"\\\"False\\\"\"}",
191 "tool_version": "0.1.06",
192 "type": "tool",
193 "uuid": "None",
194 "workflow_outputs": []
195 },
196 "5": {
197 "annotation": "",
198 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
199 "id": 5,
200 "input_connections": {
201 "input": {
202 "id": 3,
203 "output_name": "output"
204 }
205 },
206 "inputs": [],
207 "label": null,
208 "name": "Concatenate multiple datasets",
209 "outputs": [
210 {
211 "name": "out_file1",
212 "type": "input"
213 }
214 ],
215 "position": {
216 "left": 312.77783203125,
217 "top": 621.3715667724609
218 },
219 "post_job_actions": {
220 "ChangeDatatypeActionout_file1": {
221 "action_arguments": {
222 "newtype": "fasta"
223 },
224 "action_type": "ChangeDatatypeAction",
225 "output_name": "out_file1"
226 },
227 "HideDatasetActionout_file1": {
228 "action_arguments": {},
229 "action_type": "HideDatasetAction",
230 "output_name": "out_file1"
231 }
232 },
233 "tool_errors": null,
234 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2",
235 "tool_state": "{\"input\": \"null\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}",
236 "tool_version": "0.2",
237 "type": "tool",
238 "uuid": "None",
239 "workflow_outputs": []
240 },
241 "6": {
242 "annotation": "",
243 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
244 "id": 6,
245 "input_connections": {
246 "switch|input": {
247 "id": 5,
248 "output_name": "out_file1"
249 }
250 },
251 "inputs": [],
252 "label": null,
253 "name": "fasta - tabular",
254 "outputs": [
255 {
256 "name": "output",
257 "type": "fasta"
258 }
259 ],
260 "position": {
261 "left": 482.5694580078125,
262 "top": 420.9722480773926
263 },
264 "post_job_actions": {
265 "HideDatasetActionoutput": {
266 "action_arguments": {},
267 "action_type": "HideDatasetAction",
268 "output_name": "output"
269 }
270 },
271 "tool_errors": null,
272 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
273 "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"fasta2tabular\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null}",
274 "tool_version": "1.1.0",
275 "type": "tool",
276 "uuid": "890947a5-b6c3-4905-9659-9f4cb58ae3de",
277 "workflow_outputs": []
278 },
279 "7": {
280 "annotation": "",
281 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
282 "id": 7,
283 "input_connections": {
284 "switch|input": {
285 "id": 6,
286 "output_name": "output"
287 }
288 },
289 "inputs": [],
290 "label": null,
291 "name": "fasta - tabular",
292 "outputs": [
293 {
294 "name": "output",
295 "type": "fasta"
296 }
297 ],
298 "position": {
299 "left": 729.6007080078125,
300 "top": 374.9653015136719
301 },
302 "post_job_actions": {
303 "RenameDatasetActionoutput": {
304 "action_arguments": {
305 "newname": "Initial Clipped sequences"
306 },
307 "action_type": "RenameDatasetAction",
308 "output_name": "output"
309 }
310 },
311 "tool_errors": null,
312 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_fasta_tabular_converter/fasta_tabular_converter/1.1.0",
313 "tool_state": "{\"__page__\": 0, \"switch\": \"{\\\"input\\\": null, \\\"conversionType\\\": \\\"tabular2fastaweight\\\", \\\"__current_case__\\\": 2}\", \"__rerun_remap_job_id__\": null}",
314 "tool_version": "1.1.0",
315 "type": "tool",
316 "uuid": "5807c11d-856f-466a-80b3-2854a13ed901",
317 "workflow_outputs": [
318 {
319 "label": null,
320 "output_name": "output",
321 "uuid": "0104c422-daac-45f9-b56c-2b899f4f4c6f"
322 }
323 ]
324 },
325 "8": {
326 "annotation": "",
327 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
328 "id": 8,
329 "input_connections": {
330 "input": {
331 "id": 7,
332 "output_name": "output"
333 }
334 },
335 "inputs": [],
336 "label": null,
337 "name": "sRbowtie",
338 "outputs": [
339 {
340 "name": "output",
341 "type": "tabular"
342 },
343 {
344 "name": "aligned",
345 "type": "fasta"
346 },
347 {
348 "name": "unaligned",
349 "type": "fasta"
350 }
351 ],
352 "position": {
353 "left": 722.482666015625,
354 "top": 602.3785095214844
355 },
356 "post_job_actions": {
357 "HideDatasetActionaligned": {
358 "action_arguments": {},
359 "action_type": "HideDatasetAction",
360 "output_name": "aligned"
361 },
362 "HideDatasetActionoutput": {
363 "action_arguments": {},
364 "action_type": "HideDatasetAction",
365 "output_name": "output"
366 },
367 "RenameDatasetActionunaligned": {
368 "action_arguments": {
369 "newname": "Non A. gambiae sequences"
370 },
371 "action_type": "RenameDatasetAction",
372 "output_name": "unaligned"
373 }
374 },
375 "tool_errors": null,
376 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
377 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"indexed\\\", \\\"index\\\": \\\"AgamP4\\\", \\\"__current_case__\\\": 0}\", \"method\": \"\\\"k_option\\\"\"}",
378 "tool_version": "1.1.2",
379 "type": "tool",
380 "uuid": "None",
381 "workflow_outputs": [
382 {
383 "label": null,
384 "output_name": "unaligned",
385 "uuid": "e00fc25f-c655-4854-a3e3-e1f6ae204302"
386 }
387 ]
388 },
389 "9": {
390 "annotation": "",
391 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
392 "id": 9,
393 "input_connections": {
394 "input": {
395 "id": 8,
396 "output_name": "unaligned"
397 }
398 },
399 "inputs": [],
400 "label": null,
401 "name": "sRbowtie",
402 "outputs": [
403 {
404 "name": "output",
405 "type": "tabular"
406 },
407 {
408 "name": "aligned",
409 "type": "fasta"
410 },
411 {
412 "name": "unaligned",
413 "type": "fasta"
414 }
415 ],
416 "position": {
417 "left": 724.96533203125,
418 "top": 780.3819885253906
419 },
420 "post_job_actions": {
421 "HideDatasetActionaligned": {
422 "action_arguments": {},
423 "action_type": "HideDatasetAction",
424 "output_name": "aligned"
425 },
426 "HideDatasetActionoutput": {
427 "action_arguments": {},
428 "action_type": "HideDatasetAction",
429 "output_name": "output"
430 },
431 "HideDatasetActionunaligned": {
432 "action_arguments": {},
433 "action_type": "HideDatasetAction",
434 "output_name": "unaligned"
435 },
436 "RenameDatasetActionunaligned": {
437 "action_arguments": {
438 "newname": "unmatched Plasmodium Berghei"
439 },
440 "action_type": "RenameDatasetAction",
441 "output_name": "unaligned"
442 }
443 },
444 "tool_errors": null,
445 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
446 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"k_option\\\"\"}",
447 "tool_version": "1.1.2",
448 "type": "tool",
449 "uuid": "None",
450 "workflow_outputs": []
451 },
452 "10": {
453 "annotation": "",
454 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
455 "id": 10,
456 "input_connections": {
457 "input": {
458 "id": 9,
459 "output_name": "unaligned"
460 }
461 },
462 "inputs": [],
463 "label": null,
464 "name": "sRbowtie",
465 "outputs": [
466 {
467 "name": "output",
468 "type": "tabular"
469 },
470 {
471 "name": "aligned",
472 "type": "fasta"
473 },
474 {
475 "name": "unaligned",
476 "type": "fasta"
477 }
478 ],
479 "position": {
480 "left": 725.920166015625,
481 "top": 996.3889465332031
482 },
483 "post_job_actions": {
484 "HideDatasetActionaligned": {
485 "action_arguments": {},
486 "action_type": "HideDatasetAction",
487 "output_name": "aligned"
488 },
489 "HideDatasetActionoutput": {
490 "action_arguments": {},
491 "action_type": "HideDatasetAction",
492 "output_name": "output"
493 },
494 "HideDatasetActionunaligned": {
495 "action_arguments": {},
496 "action_type": "HideDatasetAction",
497 "output_name": "unaligned"
498 },
499 "RenameDatasetActionunaligned": {
500 "action_arguments": {
501 "newname": "Unaligned PhiX174"
502 },
503 "action_type": "RenameDatasetAction",
504 "output_name": "unaligned"
505 }
506 },
507 "tool_errors": null,
508 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2",
509 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"unal\\\"\", \"v_mismatches\": \"\\\"2\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"null\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": null, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"k_option\\\"\"}",
510 "tool_version": "1.1.2",
511 "type": "tool",
512 "uuid": "None",
513 "workflow_outputs": []
514 },
515 "11": {
516 "annotation": "",
517 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4",
518 "id": 11,
519 "input_connections": {
520 "inputs_0|input": {
521 "id": 10,
522 "output_name": "unaligned"
523 }
524 },
525 "inputs": [],
526 "label": null,
527 "name": "Oases_optimiser",
528 "outputs": [
529 {
530 "name": "transcripts",
531 "type": "fasta"
532 }
533 ],
534 "position": {
535 "left": 1090.4688110351562,
536 "top": 339.39238357543945
537 },
538 "post_job_actions": {
539 "RenameDatasetActiontranscripts": {
540 "action_arguments": {
541 "newname": "Oases Contigs"
542 },
543 "action_type": "RenameDatasetAction",
544 "output_name": "transcripts"
545 }
546 },
547 "tool_errors": null,
548 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_oases/oasesoptimiserv/1.1.4",
549 "tool_state": "{\"__page__\": 0, \"inputs\": \"[{\\\"__index__\\\": 0, \\\"input\\\": null}]\", \"end_hash_length\": \"\\\"29\\\"\", \"__rerun_remap_job_id__\": null, \"start_hash_length\": \"\\\"13\\\"\"}",
550 "tool_version": "1.1.4",
551 "type": "tool",
552 "uuid": "None",
553 "workflow_outputs": [
554 {
555 "label": null,
556 "output_name": "transcripts",
557 "uuid": "68909f85-3532-47e2-956b-73dfad6bdc5f"
558 }
559 ]
560 },
561 "12": {
562 "annotation": "",
563 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.1.06",
564 "id": 12,
565 "input_connections": {
566 "db_opts|histdb": {
567 "id": 1,
568 "output_name": "output"
569 },
570 "query": {
571 "id": 11,
572 "output_name": "transcripts"
573 }
574 },
575 "inputs": [],
576 "label": null,
577 "name": "NCBI BLAST+ blastx",
578 "outputs": [
579 {
580 "name": "output1",
581 "type": "tabular"
582 }
583 ],
584 "position": {
585 "left": 1149.49658203125,
586 "top": 607.3785095214844
587 },
588 "post_job_actions": {},
589 "tool_errors": null,
590 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_blastx_wrapper/0.1.06",
591 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"__page__\": 0, \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"query\": \"null\", \"query_gencode\": \"\\\"1\\\"\", \"blast_type\": \"\\\"blastx\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\"}",
592 "tool_version": "0.1.06",
593 "type": "tool",
594 "uuid": "None",
595 "workflow_outputs": [
596 {
597 "label": null,
598 "output_name": "output1",
599 "uuid": "2bcd52a4-3023-4f30-918d-0383c0ef4455"
600 }
601 ]
602 },
603 "13": {
604 "annotation": "",
605 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3",
606 "id": 13,
607 "input_connections": {
608 "blast": {
609 "id": 12,
610 "output_name": "output1"
611 },
612 "sequences": {
613 "id": 11,
614 "output_name": "transcripts"
615 }
616 },
617 "inputs": [],
618 "label": null,
619 "name": "Parse blast output and compile hits",
620 "outputs": [
621 {
622 "name": "tabularOutput",
623 "type": "tabular"
624 },
625 {
626 "name": "fastaOutput",
627 "type": "fasta"
628 },
629 {
630 "name": "al_sequences",
631 "type": "fasta"
632 },
633 {
634 "name": "un_sequences",
635 "type": "fasta"
636 }
637 ],
638 "position": {
639 "left": 1454.5486907958984,
640 "top": 436.9097480773926
641 },
642 "post_job_actions": {
643 "HideDatasetActional_sequences": {
644 "action_arguments": {},
645 "action_type": "HideDatasetAction",
646 "output_name": "al_sequences"
647 },
648 "HideDatasetActionun_sequences": {
649 "action_arguments": {},
650 "action_type": "HideDatasetAction",
651 "output_name": "un_sequences"
652 }
653 },
654 "tool_errors": null,
655 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_blastparser_and_hits/BlastParser_and_hits/2.4.3",
656 "tool_state": "{\"__page__\": 0, \"flanking\": \"\\\"5\\\"\", \"additional_filters\": \"{\\\"use_filters\\\": \\\"no\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"mode\": \"\\\"verbose\\\"\", \"sequences\": \"null\", \"blast\": \"null\"}",
657 "tool_version": "2.4.3",
658 "type": "tool",
659 "uuid": "32401021-0c03-4c16-a8a3-b08c54d34ce5",
660 "workflow_outputs": [
661 {
662 "label": null,
663 "output_name": "tabularOutput",
664 "uuid": "0ecb04ea-b8fe-45ce-aa11-c4a67f1e17dd"
665 },
666 {
667 "label": null,
668 "output_name": "fastaOutput",
669 "uuid": "f37bfebc-7b87-4dfc-a98c-2cdc3b18a84a"
670 }
671 ]
672 },
673 "14": {
674 "annotation": "",
675 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/cherry_pick_fasta/cherry_pick_fasta/0.9.0",
676 "id": 14,
677 "input_connections": {
678 "input": {
679 "id": 13,
680 "output_name": "fastaOutput"
681 }
682 },
683 "inputs": [],
684 "label": null,
685 "name": "Pick Fasta sequences",
686 "outputs": [
687 {
688 "name": "output",
689 "type": "fasta"
690 }
691 ],
692 "position": {
693 "left": 1746.0938415527344,
694 "top": 672.5000305175781
695 },
696 "post_job_actions": {
697 "HideDatasetActionoutput": {
698 "action_arguments": {},
699 "action_type": "HideDatasetAction",
700 "output_name": "output"
701 }
702 },
703 "tool_errors": null,
704 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/cherry_pick_fasta/cherry_pick_fasta/0.9.0",
705 "tool_state": "{\"__page__\": 0, \"input\": \"null\", \"__rerun_remap_job_id__\": null, \"query\": \"\\\"Drosophila_C_virus\\\"\"}",
706 "tool_version": "0.9.0",
707 "type": "tool",
708 "uuid": "None",
709 "workflow_outputs": []
710 },
711 "15": {
712 "annotation": "",
713 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/cherry_pick_fasta/cherry_pick_fasta/0.9.0",
714 "id": 15,
715 "input_connections": {
716 "input": {
717 "id": 13,
718 "output_name": "fastaOutput"
719 }
720 },
721 "inputs": [],
722 "label": null,
723 "name": "Pick Fasta sequences",
724 "outputs": [
725 {
726 "name": "output",
727 "type": "fasta"
728 }
729 ],
730 "position": {
731 "left": 1745.104248046875,
732 "top": 765.4861450195312
733 },
734 "post_job_actions": {
735 "HideDatasetActionoutput": {
736 "action_arguments": {},
737 "action_type": "HideDatasetAction",
738 "output_name": "output"
739 }
740 },
741 "tool_errors": null,
742 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/cherry_pick_fasta/cherry_pick_fasta/0.9.0",
743 "tool_state": "{\"__page__\": 0, \"input\": \"null\", \"__rerun_remap_job_id__\": null, \"query\": \"\\\"Cricket_paralysis_virus\\\"\"}",
744 "tool_version": "0.9.0",
745 "type": "tool",
746 "uuid": "None",
747 "workflow_outputs": []
748 },
749 "16": {
750 "annotation": "",
751 "content_id": "cat1",
752 "id": 16,
753 "input_connections": {
754 "input1": {
755 "id": 14,
756 "output_name": "output"
757 },
758 "queries_0|input2": {
759 "id": 15,
760 "output_name": "output"
761 }
762 },
763 "inputs": [],
764 "label": null,
765 "name": "Concatenate datasets",
766 "outputs": [
767 {
768 "name": "out_file1",
769 "type": "input"
770 }
771 ],
772 "position": {
773 "left": 1983.5938415527344,
774 "top": 680.4861450195312
775 },
776 "post_job_actions": {
777 "RenameDatasetActionout_file1": {
778 "action_arguments": {
779 "newname": "Dicistroviridae Hits"
780 },
781 "action_type": "RenameDatasetAction",
782 "output_name": "out_file1"
783 }
784 },
785 "tool_errors": null,
786 "tool_id": "cat1",
787 "tool_state": "{\"__page__\": 0, \"__rerun_remap_job_id__\": null, \"input1\": \"null\", \"queries\": \"[{\\\"input2\\\": null, \\\"__index__\\\": 0}]\"}",
788 "tool_version": "1.0.0",
789 "type": "tool",
790 "uuid": "None",
791 "workflow_outputs": [
792 {
793 "label": null,
794 "output_name": "out_file1",
795 "uuid": "f73ab6cc-279f-4a9e-8860-73e3b206b9ca"
796 }
797 ]
798 },
799 "17": {
800 "annotation": "",
801 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0",
802 "id": 17,
803 "input_connections": {
804 "inputSequences": {
805 "id": 16,
806 "output_name": "out_file1"
807 }
808 },
809 "inputs": [],
810 "label": null,
811 "name": "cap3",
812 "outputs": [
813 {
814 "name": "contigsandsinglets",
815 "type": "fasta"
816 },
817 {
818 "name": "cap3stdout",
819 "type": "txt"
820 },
821 {
822 "name": "contigs",
823 "type": "fasta"
824 },
825 {
826 "name": "contigsqual",
827 "type": "txt"
828 },
829 {
830 "name": "contigslink",
831 "type": "txt"
832 },
833 {
834 "name": "ace",
835 "type": "txt"
836 },
837 {
838 "name": "info",
839 "type": "txt"
840 },
841 {
842 "name": "singlets",
843 "type": "txt"
844 }
845 ],
846 "position": {
847 "left": 2192.100830078125,
848 "top": 513.489616394043
849 },
850 "post_job_actions": {
851 "HideDatasetActionace": {
852 "action_arguments": {},
853 "action_type": "HideDatasetAction",
854 "output_name": "ace"
855 },
856 "HideDatasetActioncap3stdout": {
857 "action_arguments": {},
858 "action_type": "HideDatasetAction",
859 "output_name": "cap3stdout"
860 },
861 "HideDatasetActioncontigs": {
862 "action_arguments": {},
863 "action_type": "HideDatasetAction",
864 "output_name": "contigs"
865 },
866 "HideDatasetActioncontigslink": {
867 "action_arguments": {},
868 "action_type": "HideDatasetAction",
869 "output_name": "contigslink"
870 },
871 "HideDatasetActioncontigsqual": {
872 "action_arguments": {},
873 "action_type": "HideDatasetAction",
874 "output_name": "contigsqual"
875 },
876 "HideDatasetActioninfo": {
877 "action_arguments": {},
878 "action_type": "HideDatasetAction",
879 "output_name": "info"
880 },
881 "HideDatasetActionsinglets": {
882 "action_arguments": {},
883 "action_type": "HideDatasetAction",
884 "output_name": "singlets"
885 },
886 "RenameDatasetActioncontigs": {
887 "action_arguments": {
888 "newname": "CAP assemblies of Dicistroviridae hits"
889 },
890 "action_type": "RenameDatasetAction",
891 "output_name": "contigs"
892 }
893 },
894 "tool_errors": null,
895 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_cap3/cap3/1.2.0",
896 "tool_state": "{\"overlapidentity\": \"\\\"90\\\"\", \"inputSequences\": \"null\", \"__rerun_remap_job_id__\": null, \"overlaplength\": \"\\\"40\\\"\", \"__page__\": 0}",
897 "tool_version": "1.2.0",
898 "type": "tool",
899 "uuid": "None",
900 "workflow_outputs": [
901 {
902 "label": null,
903 "output_name": "contigsandsinglets",
904 "uuid": "e413fdea-3b18-40c1-b423-cf2bd33eeadf"
905 }
906 ]
907 },
908 "18": {
909 "annotation": "",
910 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_tblastx_wrapper/0.1.06",
911 "id": 18,
912 "input_connections": {
913 "db_opts|histdb": {
914 "id": 4,
915 "output_name": "outfile"
916 },
917 "query": {
918 "id": 17,
919 "output_name": "contigsandsinglets"
920 }
921 },
922 "inputs": [],
923 "label": null,
924 "name": "NCBI BLAST+ tblastx",
925 "outputs": [
926 {
927 "name": "output1",
928 "type": "tabular"
929 }
930 ],
931 "position": {
932 "left": 2424.0973510742188,
933 "top": 837.5000305175781
934 },
935 "post_job_actions": {},
936 "tool_errors": null,
937 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/ncbi_blast_plus/ncbi_tblastx_wrapper/0.1.06",
938 "tool_state": "{\"evalue_cutoff\": \"\\\"0.001\\\"\", \"__page__\": 0, \"adv_opts\": \"{\\\"adv_opts_selector\\\": \\\"basic\\\", \\\"__current_case__\\\": 0}\", \"__rerun_remap_job_id__\": null, \"db_opts\": \"{\\\"db_opts_selector\\\": \\\"histdb\\\", \\\"subject\\\": \\\"\\\", \\\"histdb\\\": null, \\\"__current_case__\\\": 1, \\\"database\\\": \\\"\\\"}\", \"query_gencode\": \"\\\"1\\\"\", \"output\": \"{\\\"out_format\\\": \\\"cols\\\", \\\"std_cols\\\": [\\\"qseqid\\\", \\\"sseqid\\\", \\\"pident\\\", \\\"length\\\", \\\"mismatch\\\", \\\"gapopen\\\", \\\"qstart\\\", \\\"qend\\\", \\\"sstart\\\", \\\"send\\\", \\\"evalue\\\", \\\"bitscore\\\"], \\\"ids_cols\\\": null, \\\"tax_cols\\\": null, \\\"__current_case__\\\": 2, \\\"misc_cols\\\": null, \\\"ext_cols\\\": [\\\"slen\\\"]}\", \"query\": \"null\"}",
939 "tool_version": "0.1.06",
940 "type": "tool",
941 "uuid": "None",
942 "workflow_outputs": [
943 {
944 "label": null,
945 "output_name": "output1",
946 "uuid": "7ad377ba-ad8f-421f-af4c-6835a1994f46"
947 }
948 ]
949 },
950 "19": {
951 "annotation": "",
952 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0",
953 "id": 19,
954 "input_connections": {
955 "blast_tab": {
956 "id": 18,
957 "output_name": "output1"
958 },
959 "guideSequence": {
960 "id": 2,
961 "output_name": "outfilename"
962 },
963 "sequences": {
964 "id": 17,
965 "output_name": "contigsandsinglets"
966 }
967 },
968 "inputs": [],
969 "label": null,
970 "name": "blast_to_scaffold",
971 "outputs": [
972 {
973 "name": "output",
974 "type": "fasta"
975 }
976 ],
977 "position": {
978 "left": 2718.003662109375,
979 "top": 597.9167022705078
980 },
981 "post_job_actions": {
982 "RenameDatasetActionoutput": {
983 "action_arguments": {
984 "newname": "New AnCV sequences in DCV scaffold"
985 },
986 "action_type": "RenameDatasetAction",
987 "output_name": "output"
988 }
989 },
990 "tool_errors": null,
991 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/blast_to_scaffold/blast2scaffold/0.9.0",
992 "tool_state": "{\"__page__\": 0, \"guideSequence\": \"null\", \"blast_tab\": \"null\", \"__rerun_remap_job_id__\": null, \"sequences\": \"null\"}",
993 "tool_version": "0.9.0",
994 "type": "tool",
995 "uuid": "d6fcfcf9-1b9b-4ac3-8217-f7ddbc84be91",
996 "workflow_outputs": [
997 {
998 "label": null,
999 "output_name": "output",
1000 "uuid": "c052be17-d78e-4a17-891c-7154936c7935"
1001 }
1002 ]
1003 }
1004 },
1005 "uuid": "ac35209c-d243-403c-95c7-5500b022ae10"
1006 }